Prosecution Insights
Last updated: April 19, 2026
Application No. 18/262,438

COMPOUNDS AND METHODS FOR REDUCING DUX4 EXPRESSION

Non-Final OA §101§103§112§DP
Filed
Jul 21, 2023
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ionis Pharmaceuticals Inc.
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
3y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allow Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +63% interview lift
Without
With
+62.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
233
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§101 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The Preliminary Amendment filed June 21, 2023 is acknowledged. Claims 5-17, 22, 24, 26, 28-31, 36-37, 114-116 and 134-138 are pending and under examination. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 8 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 8 recites “The oligomeric compound of claim 5 wherein the modified oligonucleotide consists of 12 to 20, 12 to 25… or 23 to 50 linked nucleotides.” Claim 5 recites “An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides…” All of the ranges recited in claim 8 are entirely encompassed by the range recited in claim 5. There is a no oligonucleotide encompassed by claim 5 that also isn’t also encompassed by claim 8. Thus, claim 8 does not further limit the subject matter of claim 5. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 5-17, 22-24, 26-31, 36-37, 114-116 and 134-138 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 5 recites a modified oligonucleotide consisting of 12-50 linked oligonucleosides having a nucleobase sequence comprising at least 8… at least 21, at least 22, or 23 nucleobases complementary to nucleobases 4503-4522 of SEQ ID NO: 1…” The recited range is only 20 nucleobases. It is confusing how an oligonucleotide can have at least 21 bases complementary to a sequence that is only 20 nucleobases. Claims 7-17, 22-24, 26-31, 36-37 and 114-116 are rejected for depending from claim 5 and not remedying the indefiniteness. Claim 6 recites a modified oligonucleotide consisting of 12-50 linked oligonucleosides and having a nucleobase sequence comprising at least 8… at least 17, at least 18, at least 20, at least 21, at least 22, or 23 nucleobases of a sequence selected from SEQ ID NOs: 299, 340, 379 and 420-421…” Each of the recited SEQ ID NOs are only 16 nucleobases. It is confusing how an oligonucleotide can comprise at least 17 bases of a sequence that is only 16 nucleobases. Claims 134-138 are rejected for depending from claim 6 and not remedying the indefiniteness. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 5-10, 13, 17, 28-31 36-37, 114, 135 and 137 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to modified oligonucleotides (i.e., a natural product). However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below. Subject Matter Eligibility Test for Products and Processes – Claims 5 and 6 Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES Claims 5 and 6 are directed to “an oligomeric compound”. Thus, the claims are directed to a statutory category (e.g., a product). Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES Judicial exceptions have been identified by the courts by way of example, including natural products. The claims each recite 1 judicial exception that is a natural product. Claim 5 recites an oligomeric compound comprising a modified oligonucleotide consisting of 12-50 linked nucleosides and having a nucleobase sequence having at least at least 8-20 nucleobases complementary to nucleobases 4503-4522 of SEQ ID NO: 1. Claim 6 recites an oligomeric compound comprising a modified oligonucleotide consisting of 12-50 linked nucleosides and having a nucleobase sequence comprising having at least at least 8-16 nucleobases of a sequence selected from SEQ ID NOs: 299, 340, 379 and 420-421. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). MPEP 2106.04(c) outlines the markedly different analysis. First, the claims recite “a modified oligonucleotide”. The Specification defines “modified oligonucleotide” as an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified (page 7) and “modified nucleoside” as a nucleoside comprising a modified nucleobase and/or a modified sugar moiety (page 6). Thus a “modified oligonucleotide” is one having a modification relative to a reference oligonucleotide. One such “modification” includes an RNA oligonucleotide in which a uracil is methylated to form thymine and the ribose sugar is modified at the 2’ carbon to comprise deoxyribose. Such a “modified RNA oligonucleotide” would essentially comprise DNA. Another “modification” is a cytosine nucleobase in DNA being methylated to form 5-methylcytosine, which naturally occur in genomic DNA. Therefore, a “modified oligonucleotide” does not distinguish the claimed oligonucleotides from naturally occurring oligonucleotides. It is noted that the courts have identified “isolated DNA”, including oligonucleotides “consisting of” limited numbers of nucleotides as one such natural product that may not be markedly different from their counterpart, DNA in cells. Claims 5 and 6 also require the oligonucleotide to either be complementary to nucleobases 4503-4522 of SEQ ID NO 1 or comprise SEQ ID NOs 299, 340, 379 and 420-421. The recited region in claim 5 is within intron 2 on the sense strand of the DUX4 gene. As such the claimed oligonucleotide has a sequence on the antisense (non-coding) strand of intron 2 of the DUX4 gene. The closest naturally occurring counterpart to the claimed oligonucleotides is the antisense DNA strand of the DUX4 gene (See e.g., US 20120225034 A1, FIG. 31). SEQ ID NO: 396 is cgctccggcggctcgc. As indicated above a DNA sequence is encompassed within the genus of “a modified RNA oligonucleotide”. The antisense strand of the intron 2 within the DUX4 gene in a cell is a “modified” version of an RNA comprising the sequence cgcuccggcggcucgc. As such, the claimed isolated nucleic acid is not markedly different than its naturally occurring counterpart and constitutes a judicial exception. Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, there are no additional limitations recited in claims that integrated the claimed oligomer compound comprising the oligonucleotide in a practical application. Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, in this case there are no additional limitations recited in claims such that the claim amounts to significantly more than the claimed oligomer compound. Subject Matter Eligibility Test for Products and Processes – Dependent Claims The dependent claims of claim 5 and 6 do not recite any additional limitations that are directed to any additional element other than the products or compositions comprising the products that would integrate them into a practical application or amount to significantly more than the compound or composition. Therefore, the analysis below focuses on the “markedly different” analysis for each oligomeric compound and composition. Claims 7-8 and 36 do not further limit the sequence of size of the oligonucleotide and therefore are not markedly different than the DUX4 DNA antisense strand. Claim 9 recites the oligonucleotide comprises at least one modified nucleoside, which still encompasses the DUX4 DNA strand which is “modified” from an RNA cgcuccggcggcucgc having methylated uracil nucleosides. Claims 10, 13 and 135 recite the oligonucleotide comprises a modified sugar moiety, specifically a non-bicyclic modified sugar moiety. The Specification defines “modified sugar moiety” as “a modified furanosyl sugar moiety or a sugar surrogate” (page 9) but does not specifically define a “modified furanosyl sugar”. Furanosyl sugars comprise both ribose and deoxyribose, which can be considered modified versions of each other by the conversion of a 2’ hydroxyl to 2’ hydrogen and vice versa. Thus, oligonucleotides with “the modified sugar moiety” still encompasses the DUX4 DNA antisense strand which is “modified” from an RNA cgcuccggcggcucgc having a dehydroxylated ribose sugar (i.e., a non-bicyclic modified sugar moiety). Claim 17 recites the oligonucleotide having a 5’ region of 1-6 linked nucleotides and a 3’ region of 1-6 linked nucleosides having “a [generic] modified sugar moiety” and a central region of 6-10 linked nucleosides comprising a 2’-b-D-deoxylribosyl sugar moiety. 2’-b-D-deoxylribosyl sugar is the sugar that is normally found in DNA. The DUX4 DNA strand which is “modified” from an RNA cgcuccggcggcucgc already has all 2’-b-D-deoxylribosyl sugars, which is also encompassed in the generic modified sugar moiety. Therefore, the claimed oligomeric compound is still not markedly different than DUX4 DNA antisense strand. Claims 28-29 recite “wherein the modified oligonucleotide comprises a modified nucleobase [which] is a 5-methylcytosine”. The DUX4 gene in adult somatic non-stem cells is in a heterochromatin region of chromosome 4 and the DUX4 gene is heavily methylated (See Ansseau et al., Genes (2017), 8: 93, pages 1-21; Section 1.3). Cytosines in heterochromatin are methylated to 5’-methylcytosine. Therefore, the DUX4 gene, including the antisense strand of intron 2 comprises a modified nucleobase that is 5’-methylcytosine. The claimed oligomeric compound is still not markedly different than DUX4 DNA antisense strand. Claims 30-31 recite a pharmaceutically acceptable salt of the oligonucleotide, including sodium, potassium, calcium and magnesium. Genomic DNA in cells naturally coordinates positive counterions due to the negative nature of the phosphate backbone. Counterions include Na+ and K+ (See e.g., Cheng et al., Nucleic Acids Research (2006), 34: 686-696). The claimed oligomeric compound is still not markedly different than DUX4 DNA antisense strand. Claim 37 recites “the modified oligonucleotide and a conjugate group”. The Specification defines “conjugate group” as “a group of atoms that is directly attached to an oligonucleotide”. This broad definition includes additionally nucleotides added to the claimed oligonucleotide, including additional nucleotides in the DUX4 gene. The claimed oligomeric compound is still not markedly different than DUX4 DNA antisense strand. Claims 114 and 137 recite “a pharmaceutical composition comprising an oligomeric compound of claim 5 [6]”. The Specification defines “pharmaceutical composition” as “a mixture of substances suitable for administering to a subject” (page 7). Given that organ transplants, blood donations and tissue grafts are routinely administered to subjects, human cells are encompassed in “pharmaceutical compositions”. As indicated above for claim 5, the DUX4 antisense DNA strand that is present in cells reads on the claimed oligonucleotide. Therefore, human cells comprising the DUX4 antisense DNA strand are not markedly different than a pharmaceutical composition comprising the claimed oligomeric compound. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 5-10, 13-16, 22, 24, 26, 36-37, 114-116 and 135-138 are rejected under 35 U.S.C. 103 as being unpatentable over Belayew (US 20120225034 A1, published September 6, 2012) in view of and Harper (US 20140322169 A1, published October 30, 2014). Regarding claims 5, 6 and 8, Belayew teaches aberrant expression of DUX4 in muscles causes Facioscapulohumeral muscular dystrophy (FSHD) ([0004]-[0005]). Belayew teaches antisense oligonucleotides (ASOs) targeted to DUX4 pre-mRNA ([0292]). Belayew teaches the ASOs comprise 25 nucleotides that have 2’-O-methyl sugars and phosphorothioate linkages (i.e., the ASOs are modified oligonucleotides with 12-50 linked nucleosides) ([0293]). Belayew teaches designing ASOs to a variety of sequences including exon/intron borders and the 3’ UTR ([0255]). Belayew teaches two of the ASOs at least partially target a sequence in intron II ([0255], [0292]). Belayew teaches treating cells having aberrant DUX4 expression with the ASOs suppresses DUX4 expression ([0296]-[0297]) and markers of FSHD (page 7, ¶4). Belayew teaches the sequence of the DUX4 pre-mRNA (Figure 31). Belayew teaches the sequence CACCGCTCCGGCGGCTCGCC is in Intron II (Figure 31). Belayew teaches designing RNA-interfering siRNAs (i.e., another type of oligomeric compound to suppress target gene expression) to intronic sequences of DUX4 (Figure 31). Belayew does not teaches the ASOs comprise a sequence that is complementary to 8-20 nucleotides of CACCGCTCCGGCGGCTCGCC or comprise a sequence that has at least 8-20 nucleotides of GGCGAGCCGCCGGAGCGGTG (i.e., the reverse complement of GAGGCGAGCCGCCGGAGCG). Harper teaches designing RNA-interfering miRNAs to target aberrant DUX4 RNA expression ([0049], Figure 2A). Harper teaches miRNAs can comprise a miRNA antisense guide strand (i.e., the strand that hybridizes to the target RNA) is selected from a group including SEQ ID NO 276 ([0014]). Harper teaches SEQ ID NO 276 is GAGGCGAGCCGCCGGAGCG in the sequence listing of Application 14/234413, which is incorporated by reference ([0003]). Regarding claims 5-6 and 8, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed the 25-30-mer ASO comprising a modified oligonucleotide having the sequence of Harper’s miRNA GAGGCGAGCCGCCGGAGCG (i.e., complementary to 17 nucleobases of positions 4503-4522 of SEQ ID NO 1 and comprising at least 16 nucleobases of SEQ ID NO 379), which are aligned as follows: SEQ ID NO 379 (instant application:) GCGAGCCGCCGGAGCG Harper miRNA sequence: GAGGCGAGCCGCCGGAGCG Reverse complement of SEQ ID NO 1(4503-4522): GGCGAGCCGCCGGAGCGGTG It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have expected that an ASO comprising SEQ ID NO 379 could be designed and produced because 1) Belayew teaches ASOs having various complementarity to DUX4 pre-mRNA can be designed, 2) Belayew teaches interfering RNAs can be designed to DUX4 intronic sequences and teaches the sequence of introns 1 and 2, and 3) Harper teaches miRNAs targeting the intron 2 region, including a sequence that comprises SEQ ID NO 379. The skilled artisan would have been motivated to design and produce an ASO targeted to the claimed sequence because Harper suggests targeting the intron 2 sequence. Regarding claim 7, the oligonucleotide rendered obvious for claim 5 with Harper’s suggested sequence has 100% complementarity to SEQ ID NO 1 as shown here, which is 19 out of the 25 nucleotides of the ASO. Harper miRNA sequence: GAGGCGAGCCGCCGGAGCG Reverse complement of SEQ ID NO 1(4503-4524): GAGGCGAGCCGCCGGAGCGGTG It would have been obvious to one skilled in the art to have designed the additional nucleotides in the 25-mer ASO to have been 100% complementary to the intron II sequence taught in Harper because Belayew teaches ASOs have 100% complementarity to their target sequence. Regarding claims 9-10, 13-14, and 135, Belayew teaches the ASOs have a 2’-O-methyl sugars (i.e., modified nucleosides with a non-bicyclic 2’-OMe modified sugar moiety) ([0293]). Regarding claims 15-16, Belayew teaches ASOs with morpholino backbones (i.e., comprising sugar surrogates) are used with comparable results ([0258]). It would have been obvious to have used ASOs comprising the sequence of Harper with a morpholino backbone because Belayew teaches such a modified backbone gives comparable results to a 2’-OMe phosphorothioate backbone. Regarding claims 22, 24, 26 and 136, Belayew teaches the ASOs have a phosphorothioate linkages ([0293]). Regarding claims 36, Belayew teaches the ASO as described for claim 5 (i.e., an oligomeric compound consisting of the modified oligonucleotide). Regarding claim 37, Belayew teaches ASOs conjugated to a cell penetrating peptide (CPP, i.e., a conjugate) are used with at least comparable results ([0258]). It would have been obvious to have used ASOs comprising the sequence of Harper further comprising a CPP conjugate because Belayew teaches conjugated CPPs to an ASO gives comparable results. Regarding claims 114-116 and 137-138, Belayew teaches administering the ASOs to cells using Lipofectamine 2000 (i.e., a pharmaceutical composition comprising the ASO and an acceptable diluent) ([0295]). Belayew teaches the RNAi agents in pharmaceutical compositions comprising phosphate buffered saline ([0217]). Claims 11-12, 17, 28-31 and 134 are rejected under 35 U.S.C. 103 as being unpatentable over Belayew (US 20120225034 A1, published September 6, 2012) and Harper (US 20140322169 A1, published October 30, 2014) as applied to claims 5-10, 13-16, 22, 24, 26, 36-37, 114-116 and 135-138 above, and further in view of Seth (WO 2019157531 A1, published August 15, 2019). The teachings of Belayew and Harper are recited above and applied as for claims 5-10, 13-16, 22, 24, 26, 36-37, 114-116 and 135-138. Briefly Belayew and Harper teach RNA-interfering oligonucleotides such as ASOs, siRNA and miRNAs and targeting intronic sequences of DUX4 pre-mRNA. Belayew also teaches nucleic acids can comprise 5’-methylcytosins bases ([0160]). Belayew teaches the RNAi agents includes pharmaceutically acceptable salts including sodium and potassium ([0213]-[0214]). Belayew and Harper do not teach RNA-interfering oligonucleotides having bicyclic modified sugars (claims 11-12), a gapmer-based design or an oligonucleotide up to 20 nucleotides (claims 17 and 30) or with 5’-methylcytosine bases (claims 28-29). Seth teaches the principle behind antisense technology is for the antisense compound to hybridize to a target nucleic acid and modulates the amount, activity and/or function of the target nucleic acid (page 1, lines 14-16). Seth summarizes the mechanisms of various antisense oligonucleotides including ASOs and miRNAs (page 1, lines 14-29). Seth teaches that chemically modified nucleosides can be incorporated into antisense compounds to enhance properties such as nuclease resistance, pharmacokinetics, or target affinity (page 1, lines 30-34). Seth teaches “gapmers” are antisense oligonucleotides having 14-23 linked nucleosides with a 1) 5’ region a central region and a 3’ region of 2-5 linked nucleotides each and having 2’-modiifed furanosyl sugar moieties, including bicyclic sugar moieties with a 4’-2’ bridge and 2) a central region of 7-10 linked nucleosides having a 2’-b-D-deoxyribosyl sugar moiety (page 194, lines 8-33). Seth teaches gapmers can also comprise 5-methylcytosine in the 5’ region, 3’ region or central region (pages 16-18, embodiments 18, 37 and 52). Seth teaches that gapmers can be targeted to the DUX4 RNA (page 36, embodiment 308). Seth teaches that gapmers are suitable therapeutic agents (page 207, lines 32-25). Seth teaches designing and testing gapmer antisense oligonucleotides to various RNA targets including CXCL12 (page 212) and Factor XI (page 222). Seth teaches target nucleic acids of the described oligonucleotides (i.e., gapmers) can be targeted to intronic regions (¶ spanning pages 209-210) and be comprised in compositions as pharmaceutically acceptable salts, including sodium and potassium salts (page 206, lines 6-13). Regarding claims 11-12, 17, 28-31 and 134, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have modified the DUX4 Intron II-targeting RNAi agent rendered obvious above for claims 5 and 6 to have the structure of a gapmer RNAi agent, with the 3-10-3 or 5-10-5 gapmer structure including bicyclic 2’-4’ bridge modified sugars and 5’-methylcytosine residues taught in Seth. It would have amounted to designing an RNAi agent targeting a known sequence in DUX4 pre-mRNA using known design parameters. The skilled artisan would have predicted that a gapmer could be designed and produced that targeted the DUX4-intron II region taught in Harper because Seth teaches that 1) gapmers can be designed to intronic regions and 2) gapmers can be designed to target DUX4 RNA. The skilled artisan would have been motivated to use a gapmer to target Harper’s intron II sequence because Seth suggests using gapmers to target DUX4 RNA. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 5-12, 17-22, 24, 26, 28-31, 36-37, 114-116, 134 and 136-138 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of U.S. Patent No. 11149264 in view of Harper (US 20140322169 A1, published October 30, 2014) and Seth (WO 2019157531 A1, published August 15, 2019). Patented claim 1 recites An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a 5′-region, a central region, and a 3′-region, wherein: the 5′-region consists of 3 linked nucleosides, each comprising a 4′-to-2′ linked bicyclic sugar moiety; the 3′ region consists of 3 linked nucleosides, each comprising a 4′-to-2′ linked bicyclic sugar moiety; and the central region consists of 10 linked nucleosides, wherein the central region has the following formula: (Nd)(Nx)(Nd)n, wherein Nx is a nucleoside comprising a 2′-OMe-β-D-ribofuranosyl sugar moiety and each Nd is a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety; and n is 8. Patented claim 5 recites wherein each nucleobase of each nucleoside of the modified oligonucleotide is independently selected from thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine. Patented claim 6 recites wherein each internucleoside linkage is independently selected from phosphodiester and phosphorothioate internucleoside linkages. Patented claims 8-9 recite wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to a target RNA including a a target pre-mRNA. Patented claim 12 recites wherein the target RNA is selected from a DUX4 RNA. Patented claim 15 recites the oligomeric compound comprising a conjugate group. Patented claim 29 recites administering the modified oligomeric compound to a subject. The patented claims do not recite a specific sequence or target sequence for the DUX4-targeting oligomeric compound. The patented claims also do not recite compound in a pharmaceutical acceptable composition as a salt or with PBS (claims 31, 114-116, 137-138). The teachings of Harper are recited above in paragraph 35 and incorporated here. Briefly, Harper teaches a miRNA targeted to the instantly claimed DUX4 region in intron II. The teachings of Seth are recited above in paragraph 50 and incorporated here. Briefly, Seth teaches the design of gapmers, which can be targeted to intronic regions and DUX4 RNA. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed the patented gapmer oligonucleotide to comprise a sequence that can specifically target the DUX4 Intron II region taught in Harper. It would have amounted to designing an RNAi gapmer to target a known sequence in DUX4 pre-mRNA. The skilled artisan would have predicted that the patented gapmer structure could be designed and produced that targeted the DUX4-intron II region taught in Harper because Seth teaches that 1) gapmers can be designed to intronic regions and 2) gapmers can be designed to target DUX4 RNA. The skilled artisan would have been motivated to use a gapmer to target Harper’s intron II sequence because Seth suggests using gapmers to target DUX4 RNA. Regarding claims 31, 114-116, 137-138, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the patented gapmer modified to comprise Harper’s DUX4-targeting sequence in a pharmaceutical acceptable composition comprising PBS because the patented claims recite administering the oligonucleotide compound to a subject and Seth teaches such administration compositions can include PBS and salts. Claims 5-12, 17-22, 24, 26, 28-31, 36-37, 114-116, 134 and 136-138 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11332733 in view of Harper (US 20140322169 A1, published October 30, 2014) and Seth (WO 2019157531 A1, published August 15, 2019). Patented claim 1 recites An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 16 linked nucleosides, wherein the modified oligonucleotide has a 5′-region, a central region, and a 3′-region, wherein: the 5′-region consists of 1-3 linked nucleosides, each comprising a 4′-to-2′ linked bicyclic sugar moiety; the 3′ region consists of 1-3 linked nucleosides, each comprising a 4′-to-2′ linked bicyclic sugar moiety; and the central region consists of 9-10 linked nucleosides, wherein the central region has the following formula: (Nd)(Nx)(Nd)n, wherein Nx is a nucleoside comprising a 2′-OMe-β-D-ribofuranosyl sugar moiety and each Nd is a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety; and n is 7 or 8. Patented claims 3-5 recite wherein each 4′-to-2′ linked bicyclic sugar moiety of each nucleoside of the 5′, 3’ or central region is independently selected from cEt, LNA, and ENA. Patented claim 7 recites wherein each nucleobase of each nucleoside of the modified oligonucleotide is independently selected from thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine. Patented claim 8 recites wherein each internucleoside linkage is independently selected from phosphodiester and phosphorothioate internucleoside linkages. Patented claims 10-11 and 17 recite wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to a target RNA, including a target pre-mRNA, and can be a DUX4 RNA. The patented claims do not recite a specific sequence or target sequence for the DUX4-targeting oligomeric compound. The patented claims also do not recite compound in a pharmaceutical acceptable composition as a salt or with PBS (claims 31, 114-116, 137-138). The teachings of Harper are recited above in paragraph 35 and incorporated here. Briefly, Harper teaches a miRNA targeted to the instantly claimed DUX4 region in intron II. The teachings of Seth are recited above in paragraph 50 and incorporated here. Briefly, Seth teaches the design of gapmers, which can be targeted to intronic regions and DUX4 RNA. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed the patented gapmer oligonucleotide to comprise a sequence that can specifically target the DUX4 Intron II region taught in Harper. It would have amounted to designing an RNAi gapmer to target a known sequence in DUX4 pre-mRNA. The skilled artisan would have predicted that the patented gapmer structure could be designed and produced that targeted the DUX4-intron II region taught in Harper because Seth teaches that 1) gapmers can be designed to intronic regions and 2) gapmers can be designed to target DUX4 RNA. The skilled artisan would have been motivated to use a gapmer to target Harper’s intron II sequence because Seth suggests using gapmers to target DUX4 RNA. Regarding claims 31, 114-116, 137-138, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the patented gapmer modified to comprise Harper’s DUX4-targeting sequence in a pharmaceutical acceptable composition comprising PBS because the patented claims recite administering the oligonucleotide compound to a subject and Seth teaches such administration compositions can include PBS and salts. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jul 21, 2023
Application Filed
Feb 16, 2026
Non-Final Rejection — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454686
In Vitro Cleavage of DNA Using Argonaute
2y 5m to grant Granted Oct 28, 2025
Patent 12448630
CRISPR-CAS SYSTEMS AND USES THEREOF
2y 5m to grant Granted Oct 21, 2025
Patent 12442052
ANALYSIS OF POLYNUCLEOTIDES
2y 5m to grant Granted Oct 14, 2025
Patent 12435321
CRISPR/CAS12J ENZYME AND SYSTEM
2y 5m to grant Granted Oct 07, 2025
Patent 12416011
BIOCONTAINMENT/BIOCONTROL SYSTEM AND METHODS
2y 5m to grant Granted Sep 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+62.6%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month