DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 1/6/2025. Claims 26-36, 46, 212-215, and 222-223 are pending. Claims 34-36 and 223 are withdrawn from consideration because they are drawn to a non-elected species. Claims 26-33, 46, 212-215, and 222 are presently under examination.
Election/Restrictions
Applicant’s election without traverse of invention Group I and SEQ ID NOs 26 and 31 in the reply filed on 7/20/2026 is acknowledged. The Applicant’s elections read on claims 26-33, 36, 46, 212-215, and 222. Claim 223 is withdrawn from consideration because it is not a claim in invention Group I. Claims 34-35 are withdrawn from consideration because these claims recite features of sugar moiety modifications which are not present in the Applicant’s elected species of SEQ ID NOs 26 and 31. Claim 36 is withdrawn from consideration because the Applicant’s elected species comprises 4 2’-F but claim 36 requires no more than 3 2’-F modifications. The Applicant has elected mesyl phosphoramidate as the embodiment of Formula I in claim 26, where X is O and R is methyl in Formula I.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO’s electronic filing system (see Section I.1 of the Legal Framework for EFS-Web or Patent Center (https://www.uspto.gov/patents-application- process/filing-online/legal-framework-efs-web), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via EFS-Web or Patent Center as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via EFS-Web or Patent Center as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above. In particular, the sequence incorporation statement entitled “Sequence Listing” in the specification refers to the sequence listing file in terms of “KB,” but must refer to the size of the file in terms of “bytes.” See MPEP 2422.03, section I, “ASCII Text File Submitted VIA EFS-Web.”
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 214-215 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 214, claim 214 recites “at least one particular internucleoside linkage having a particular stereochemical configuration.” Regarding the guidance provided in the specification with respect to the recited claim language, the specification offers a discussion of phosphorothioate chiral nucleoside linkages and “particular” configurations (page 75, second paragraph). The specification also recites that “Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration,” (page 76, first paragraph). The specification therefore does not offer clear guidance with respect to “a particular configuration” or “one particular linkage with a particular stereochemical configuration.” Both the “one particular internucleoside linkage” and “a particular stereochemical configuration” are unclear because it is unclear to which linkage and stereochemical configurations are being referred, or what is encompassed by the breadth of the claim.
Claim 215 depends from claim 214 and does not remedy this 112(b) issue and is also rejected. Furthermore, claim 215 also recites “one particular internucleoside,” where it is unclear which “particular internucleoside” is being referred to. Additionally, Formula I itself is not an “internucleoside,” but is instead an “internucleoside linkage,” where it is unclear how Formula I could be considered an “internucleoside.”
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 26-33, 36, 46, 212-213, and 222 are rejected under 35 U.S.C. 103 as being unpatentable over Akinc (WO 2016/179342 A2) in view of Patutina (Patutina OA et al. Proc Natl Acad Sci U S A. 2020 Dec 22;117(51):32370-32379), Schirle (Schirle NT et al. J Am Chem Soc. 2016 Jul 20;138(28):8694-7), Seth (WO 2019/157531), Kenski (Kenski DM et. al. Mol Ther Nucleic Acids. 2012 Jan 24;1(1):e5).
Regarding the following rejection, this rejection is made in light of Applicant’s elected species of sense/antisense RNA which comprises SEQ ID NOs 26 and 31, respectively and represented by compounds 1523578 and 1599520, respectively . The sequence and the chemical modifications of the Applicant’s election are shown below:
GysAysAyoAyoCyoUyoCfoAyoAfoUfoAfoAyoAyoGyoUyoGyoCyoUyoUyoUyoAy-HPPO-GalNAc (1523578)
vP-TesAfzAyoAyoGyoCfoAyoCyoUyoUyoUyoAyoUyoUfoGyoAfoGyoUyoUyoUyoCyzUysGy (1599520)
In the above chemical structures, “y” represents a 2’-OMe modification, “vP” is a 5’ vinyl phosphate modification, “e” represents a 2’-MOE sugar moiety, “f” represents a 2’-F sugar moiety, “s” represents a phosphorothioate linkage, “o” represents a phosphodiester linkage, and “z” represents a mesyl phosphoramidate linkage.
Regarding claim 26 in view of Applicant’s elected, species, Akinc is a patent document which teaches RNAi agents directed to Factor XII and treating patients with HAE (Title, Abstract, and throughout). Akinc teaches that it is useful to target Factor XII using RNAi because this gene is associated with the disease Type III HAE (page 3, first paragraph, page 4 first paragraph). Akinc teaches the compound AD-73598, which comprises sense and antisense strands directed against Factor XII which are represented by SEQ ID NOs 2096 and 2141 (see Table 26 at page 214). SEQ ID NO: 2096 of Akinc is a 100% match of instant SEQ ID NO: 26 and SEQ ID NO: 2141 is a 100% match of instant SEQ ID NO: 31 with the exception of the first “U” of instant SEQ ID NO: 3 compared with a “U” in Akinc’s SEQ ID NO: 2141 (below):
GAAACUCAAUAAAGUGCUUUA – SEQ ID NO: 2096 (Akinc)
GAAACUCAAUAAAGUGCUUUA - Instant SEQ ID NO: 26
UAAAGCACUUUAUUGAGUUUCUG – SEQ ID NO: 2141 (Akinc)
TAAAGCACUUUAUUGAGUUUCUG – Instant SEQ ID NO: 31
Thus, the antisense/sense pairing of Akinc and the instant SEQ ID NOs 26 and 31 are identical, where the “T” substituted with a “U” shares the same base pairing (“A”), and is therefore functionally equivalent. Furthermore, Akinc teaches that the end nucleotide can be modified to be a DNA nucleotide, and that this is a well-known technique in RNAi agent synthesis (page 38, second paragraph). Akinc teaches that the SEQ ID NO: 2096/2141 compound is called AD-73598 (page 214, Table 26). Akinc further reduced to practice AD-73598 and showed that it is effective at knocking down the target F12 gene (Table 28, page 218, first line). Thus, Akinc teaches that the Applicant’s elected sequence is a known siRNA which has already been reduced to practice, which Akinc further teaches is useful for targeting the F12 gene to treat human disease (above).
Regarding chemical and linkage modifications to the siRNAs of Akinc, Akinc teaches that a 5’ vP is added to the end of the dsRNA of AD-73598, where this addition demonstrated a prolonged efficiency at knocking down the target F12 gene in vivo (see Figure 13, a comparison of AD-73598 (no vP) and AD-73620 (with vP), where knockdown is sustained at day 15 using the vP modification of AD-73620). Akinc therefore teaches the recited RNAi agent comprising a 5’vP with the beneficial teaching of sustained knockdown of an in vivo target gene (Figure 13, Table 27, page 216).
Regarding the phosphorothioate “s” nucleotide linkages, Akin teaches a modified version of AD-73598, where SEQ ID NO: 2096 (corresponding to instant SEQ ID NO: 26) comprises two “s” modifications in the same position as the Applicant’s elected compound (see Table 27 at page 216, row “AD-73598” where an “s” occurs between the first two bases, “G” and “A”). Note that Akinc teaches that “s” represents a phosphorothioate linkage (page 15, paragraph 6). Furthermore, Akinc teaches that the modified AD-73598 on the antisense strand comprises “s” linkages at the 5’ and 3’ ends in the same positions corresponding to the “s” and “z” linkages of instant SEQ ID NO: 31 (compound 1599520). Akinc further teaches that the inclusion of such nucleotide linkage modifications at the 5’ and 3’ ends is a known practice in designing siRNAs in general (page 45, second paragraph). Thus, Akinc teaches modifying the same nucleotide linkages at the same position in the same sequence as the Applicant’s elected compound (i.e., at the 5’ and 3’ ends). Akinc further teaches that the other linkages in the siRNA are phosphodiester links (i.e., not modified, see Table 27 at page 216). Akinc teaches that modifications prevent exonuclease degradation (page 79, first paragraph).
Regarding the 2’F (“f”) modifications of the Applicant’s elected compound, Akinc teaches the same 2’-F modification at the same positions of instant SEQ ID NO: 26/Compound 1523578 (i.e., the C, U, A, U residues at positions 7, 9-11, see Table 27, page 216, AD-73598). Furthermore, Akinc teaches that the 2’-F modification occurs at position 2, 6, 8, 9, 14, and 16, where the instant SEQ ID NO: 31/Compound 1599520 comprises 2’-F modifications at positions 2, 6, 14, and 16, and therefore overlaps where the 2’-F modifications occur with Akinc’s modified AD-73598 compound (Table 27, page 216). Note that Akinc teaches that “F” is the 2’-fluoro modification (see page 15, paragraph 6).
Akinc further teaches that the known 2’-MOE sugar modification can be used in the modified RNAi of their invention (page 40, second paragraph). Akinc further teaches that the RNAi can comprise multiple 2’-OMe modifications (e.g., page 54, third paragraph, page 15, paragraph 6). Akinc teaches that GalNac modification at the end of RNAi agent molecules attached via a linker (e.g., page 69, second paragraph).
Akinc does not teach the HPPO-GalNac modification at the end of the RNAi agent. Akinc, while teaching 2’-OMe modifications, and that such modifications are known and can exist throughout the molecule, does not teach that they are placed in the pattern presently recited (i.e., the majority of the RNA molecules). Akinc teaches 2’-MOE modification to be used but does not teach that it is as the first position. Akinc teaches 2’-F at positions 2, 6, 8, 9, 14, and 16, but the instant compound has 2’-OMe modifications at positions 8 and 9. Akinc, while teaching phosphorothioate linkages at the 5’ and 3’ ends, and that modifications are useful for preventing degradation by exonucleases, does not teach the linkage modification mesyl phosphoramidate.
Kenski is a research article that focuses on modifying siRNAs for enhanced in vivo delivery and activity (Title, Abstract, and throughout). Akinc and Kenski therefore directly overlap in subject matter because they are drawn to the same types of molecules, siRNA, as well as how to modify such molecules for effective delivery. Kenski teaches that:
“The most widely used and commercially available modifications in siRNAs have been limited to ones discovered over 10 years ago in the antisense field and developed at the 2′ position of the ribose ring including 2′-methoxy (2′-OMe), 2′-fluoro (2′-F), and 2′-O-methoxyethyl (2′-MOE). 2′-OMe and 2′-F modifications are well tolerated at multiple positions in the siRNA guide strand due to their small size that is comparable to the natural RNA 2′-OH. They provide increased stability, increased specificity and reduced immunogenicity. The structures of other, larger, 2′-O-modifications such as 2′-O-MOE and 2′-O-allyl modifications caused attenuated silencing activity. These modifications were tolerated in only a very position-specific manner within the guide strand,” (page 1, right column, second paragraph).
Thus, Kenski not only teaches that modifications such as 2’-F and 2’-OMe are widely known and used in the industry, but also teaches that such modifications are well-tolerated throughout the molecule, and further teaches that such modifications have known benefits which would motivate a practitioner to include them in an siRNA molecule because such modifications improve stability, specificity, and reduce immunogenicity (above).
Regarding the 2’-MOE modification at the first position of the antisense, Schirle is a research article which focuses on the functionality of modified siRNA (Title, Abstract, and throughout). Schirle, Kenski, and Akinc therefore directly overlap in subject matter because they are all focused on modified siRNA molecules. Furthermore, Schirle also teaches 2’-OMe, 2’-F, 2’-MOE, and 5’-vP modifications, all of which are also taught by Akinc (e.g., see Figure 1). Furthermore, Schirle teaches that “the 2-OMOE modification on nucleotide-1 extends into the Ago2 central cleft without steric clash with the protein,” (page 3, first paragraph). Thus, while Kenski teaches that bulkier molecules such as MOE can sometimes interfere with siRNA applications, Schirle teaches and reduces to practice such MOE molecules at the 1st position (Figure 1 of Schirle), which is where the 2’-MOE modification occurs in the Applicant’s elected species. Thus, as Kenski teaches that the 2’-MOE modification is a known beneficial modification, and Schirle teaches that the 1st position tolerates such MOE molecules, it was known in the art the MOE molecule at the first position was a known, useful modification to siRNAs (Kenski, Schirle, above). In addition, Schirle teaches that the 5’-vP is attached with a “T” residue comprising a 2’-MOE moiety (Figure 1). Schirle teaches that this configuration was reduced to practice with a 5-fold increase in potency (page 2, first paragraph). Thus, Schirle further teaches that siRNAs comprising a “T” at the first position is a known engineering technique which has been reduced to practice with both an adjacent 5’-vP modification and 2’-MOE modification (above). Thus, Schirle teaches the same 5’ end configuration as the present compound elected by the Applicant (above).
Furthermore, Patutina is a research article which focuses on modified antisense RNAs with enhanced in vivo efficacy (Title, Abstract, and throughout). Patutina teaches mesyl phosphoramidate, the Applicant’s elected embodiment of Formula I (Figure 1):
PNG
media_image1.png
211
170
media_image1.png
Greyscale
Patutina teaches miRNAs which comprise mesyl phosphoramidate modifications throughout the molecule and further reduced such molecules to practice (Figure 1). Patutina teaches that:
“mesyl phosphoramidate (or μ-) oligonucleotide was described that demonstrates
high affinity to RNA, exceptional nuclease resistance, efficient recruitment of RNase H, and potent inhibition of key carcinogenesis processes in vitro μ-oligonucleotides administered in complex with folate-containing liposomes dramatically inhibit primary tumor growth via long-term down-regulation ofmiR-21 in tumors and increase in biosynthesis of miR-21–regulated tumor suppressor proteins. This antitumoral effect is superior to the effect of the corresponding phosphorothioate. Peritumoral administration of μ-oligonucleotide results in its rapid distribution and efficient accumulation in the tumor. Blood biochemistry and morphometric studies of internal organs revealed no pronounced toxicity of μ-oligonucleotides. This new oligonucleotide class provides a powerful tool for antisense technology,” (Abstract).
Patutina therefore teaches a direct motivation to include modifications such as mesyl phosphoromadiate in RNA technologies because for instance such modifications were known to confer exceptional nuclease resistance and have successfully demonstrated and reduced to practice (Abstract, above). Furthermore, given that Patutina reduced to practice RNA where each position was modified with mesyl phosphoromidate, Patutina has shown that such modifications are highly tolerated by RNA. Patutina furthermore directly compares mesyl phosphoromaidate to phosphorthioate linkage modifications and teaches that the mesyl phosphoromidatae linkages have several advantages such as superior nuclease resistance (page 32375, left column).
Finally, Seth is a patent document which focuses specifically on modified oligos to be used with RNAi applications (Title, Abstract, Background, and throughout). Seth therefore directly overlaps with Akinc, Schirle, Patutina, and Kenski. Seth teaches that HPPO-GalNac attachments to the ends of RNAi agent RNA molecules are a known linker-GalNac combination (e.g., Table on page 250, Example 38). Thus, such HPPO-GalNac end modifications are already known in the art and have been reduced to practice in the art of RNAi agent technologies.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the present claims to modify the F12 siRNA taught by Akinc to further include 2’-OMe modifications throughout the siRNA, as Kenski teaches that such modifications are not only highly useful (e.g. increased stability) but are also well-tolerated by siRNAs throughout the molecule. Futthermore, the 2’-F modifications at positions 8 and 9 of the compound taught by Akinc could be replaced by 2’-OMe with a similar rationale because Kenski teaches that such 2’-F and 2’-OMe are well known and highly tolerated. The combination is therefore the simple substitution of one know prior art element for another (i.e., two 2’-F modifications for 2’-OMe modifications) with predictable success to arrive at the present 2’-OMe and 2’-F pattern of the Applicant’s elected species.
The practitioner is furthermore highly motivated to include mesyl phosphoramidate modifications to replace a phosphorothioate linkage near the 5’ and 3’ ends of such siRNAs because Patutina teaches that mesyl phosphoromidate linkages have superior nuclease resistance.
Furthermore, as Akinc has already taught the useful 2’-MOE modification, the practitioner is motivated to place the MOE modification at the 5’ end, as Schirle teaches that this is a known location which will not prevent the functionality of the siRNA, where such siRNAs comprising such 2’-MOE molecules at the 5’ end are functional and reduced to practice. Thus, this placement of the 2’-MOE molecule, which is the same as the Applicant’s elected species, is the simple combination of known prior art elements with predictable success.
Finally, given that Akinc already teaches attaching GalNac via linkers to the RNA molecule, and further that Seth teaches that HPPO-GalNac molecules have already been taught and reduced to practice in siRNAs, the combination of such elements is the simple combination of known prior art elements with predictable success, where a practitioner can arrive at such a combination simply by design choice of a given siRNA.
Regarding claims 27-28, as discussed above in the rejection of claim 26, Formula I comprising X as O and R as methyl is mesyl phosphoromidate which is taught by Patutina.
Regarding claim 29, as discussed above in the rejection of claim 26, each of the internucleoside linkages in the siRNA molecule rendered obvious is either a phosphodiester linkage, a phosphorothioate linkage, or a mesyl phosphoromidate (Formula I) linkage (see rejection of claim 26).
Regarding claim 30, Applicant’s elected species follows the sz(o)zs pattern. The rejection of the Applicant’s elected species of compound therefore addresses the pattern recited in claim 30 (see rejection of claim 26).
Regarding claim 31, Akinc teaches the same sequence as the Applicant’s elected species, where the antisense is 23 nucleotides in length (see rejection of claim 26).
Regarding claim 32, the Applicant’s elected species follows the pattern of “szooooooooooooooooooozs,” (first item of line 5 of claim 32). Thus, the rejection of the Applicant’s elected species addresses the limitations of claim 32 (see rejection of claim 26).
Regarding claim 33, Formula I comprising an X as O and R as methyl is mesyl phosphoromoidate; thus, the rejection of Applicant’s elected species addresses the limitations of claim 33 (see rejection of claim 26).
Regarding claim 46, the Applicant’s elected antisense sugar motif comprises “efyyyfyyyyyyyfyfyyyyyyy.” Thus, the limitations of claim 46 are addressed in the rejection of Applicant’s elected species (see rejection of claim 26).
Regarding claims 212-213, each of the bases taught by Akinc are uracil, guanine, adenine, and cytosine, where Akinc further teaches that end bases can be DNA, which would include thymine (Akin AD-73598, Table 27 at page 216, page 38 second paragraph).
Regarding claim 222, Akinc teaches administration of siRNAs to mice (e.g., Example 15, Figure 13) and therefore teaches a population of the siRNAs of claim 26. Furthermore, given that such Akinc teaches that such siRNAs were made and administered, such a population would be stoichiometrically randomized, i.e., stereorandom.
Claims 214-215 are rejected under 35 U.S.C. 103 as being unpatentable over Akinc (WO 2016/179342 A2) in view of Patutina (Patutina OA et al. Proc Natl Acad Sci U S A. 2020 Dec 22;117(51):32370-32379), Schirle (Schirle NT et al. J Am Chem Soc. 2016 Jul 20;138(28):8694-7), Seth (WO 2019/157531), Kenski (Kenski DM et. al. Mol Ther Nucleic Acids. 2012 Jan 24;1(1):e5) as applied to claims 26-33, 36, 46, 212-213, and 222, above, and further in view of Hu (Hu B et al. Signal Transduct Target Ther. 2020 Jun 19;5(1):101).
A discussion of Akinc, Patutina, Schirle, Kenski, and Seth is given above and incorporated here.
Regarding claims 214-215, Akinc, Patutina, Schirle, Kenski, and Seth do not teach that the population is enriched for a particular stereochemical of the internucleoside linkages.
Hu is a review article that teaches therapeutic siRNAs, as well as modifications to siRNAs (Title, Abstract, and throughout). Hu therefore overlaps with the prior art above because each relate to siRNAs and therapeutic applications of such molecules. Furthermore, given that Hu is a review article, it represents a general sense of knowledge a person of ordinary of skill in the art would possess. Additionally, Hu teaches that:
“there are two configurations for PS linkages, namely, Rp and Sp isomers. Verdine and colleagues (team from Wave Life Sciences) demonstrated that the stereochemistry of PS significantly influences the pharmacologic performance of ASOs. PS linkages with the Sp configuration are more stable than those with the Rp configuration,” (page 4, left column, third paragraph).
Thus, Hu has already taught that selecting a specific configuration, namely Sp or Rp of a given internucleotide linkage, is already a known factor of consideration for the development of siRNAs, where specific selection of a particular configuration, such as the Sp configuration, are known to be more stable.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to generate a population of siRNAs with a particular Sp or Rp configuration with respect to the nucleotide linkages because such a strategy is already known in the art where furthermore the practitioner is motivated to make such a population because particular configurations are known to have preferred pharmacological performances.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635