DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 13-15 & 17 are under examination on the merits.
Claims 1-3, 5-11, 21-22, 25 & 27 have been withdrawn.
The objections to claims 13, 15, 17 & 20 are withdrawn in light of Applicant’s amendments.
The rejections of claims 13-15, 17 & 19-20 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph are withdrawn in light of Applicant’s amendments.
The rejection of claim 19 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in light of Applicant’s amendments.
The rejection of claim(s) 13-15, 17 & 19-20 under 35 U.S.C. 103 as being unpatentable over Fister et al (2018) Frontiers in Plant Science. 9. 268. (hereafter Fister) in view of Gómez-Muñoz et al (2017) Molecular Plant Pathology. 18(9), 1253 –1266 (hereafter Gómez-Muñoz) and NCBI Reference Sequence: XM_006468378.3 is withdrawn in light of Applicant’s amendments.
Specification
The disclosure is objected to because of the following informalities: The description of figure 3 (page 2, line 6) does not provide definitions for the labeled features of the CTV vector. The description of the figure should describe or provide the full feature name for the abbreviated labels depicted in figure 3.
Appropriate correction is required.
Claim Interpretation
The instant specification has defined “gene” as a segment of DNA involved in producing a polypeptide chain including regions preceding and following the coding region involved in transcription/translation of the gene product and regulation of transcription/translation (page 4, liens 10-13). The instant specification has defined “altering DNA sequence, gene structure and function” as introducing an indel of deoxynucleotides in the gene’s coding sequence, introducing an indel in the promoter region, or introducing an indel in the gene’s 5’ untranslated region (page 4, lines 26-29). “CsNPR3” or “Citrus Non-expresser of Pathogenesis Related Genes 3” has been defined as a member of a group of negative regulators of the plant immune system (page 5, lines 15-24). These definitions have been used in the examination of the claims.
Claim Objections
Claims 14 & 15 are objected to because of the following informalities:
Claim 14 (lines 1-2): “said nucleic acid sequence encoding a Cas protein is a Type-II CRISPR-associated nuclease” should read --said Cas protein is a Type-II CRISPR-associated nuclease--. A Nucleic acid sequence would not be a nuclease.
Claim 15 (line 1): “Type II” should read --Type-II-- to match claim 14 (line 2).
Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 13-15 & 17 are rejected under 35 U.S.C. 103 as being unpatentable over Fister et al (2018) Frontiers in Plant Science. 9. 268. (published 3/2/2018, hereafter Fister) in view of Gómez-Muñoz et al (2017) Molecular Plant Pathology. 18(9), 1253 –1266 (published 9/2/2016, hereafter Gómez-Muñoz), NCBI Reference Sequence: XM_006468378.3 (available 5/16/2018) and Fu et al (2017) Frontiers in Plant Science. 8. 1419 (published 8/31/2017, hereafter Fu).
This is a new rejection necessitated by Applicant’s amendments to the claims. Applicant' s arguments filed 1/9/2026 have been fully considered as they pertain to the current rejection, but they are not persuasive.
Claims 13-15 & 17 are drawn to a method for activating SAR in a citrus plant comprising introducing into citrus plant cels a gene editing system comprising a nuclease Cas protein and a gRNA that targets CsNPR3 wherein the gene editing system disrupts or alters CsNPR3 expression or function, wherein the citrus plant comprises sweet orange, blood orange or navel orange.
Fister teaches a method wherein vectors comprising cassettes for Cas9 and sgRNAs targeting NPR3 were constructed and transformed into leaves of Theobroma cacao plants (figure 2A; page 3, left column, paragraph 2-right column, paragraph 1 & page 5, left column, paragraph 4-5). The vector used by Fister comprised a sequence encoding Cas9 operably linked to a NOS terminator (figure 2A). The transformation resulted in deletion in the TcNPR3 gene creating a premature stop codon (page 5, left column, paragraph 5-right column paragraph 1). Gene expression of five pathogenesis-related genes was elevated while expression of TcNPR3 was reduced (page 6, left column, paragraph 1). Pathogen susceptibility was decreased in gene edited tissue, leading to smaller lesions and a reduction in Phytophthora replication (figure 4A-D; page 5, right column, paragraph 4). Somatic embryo cotyledons were also transformed with the plasmids to create transgenic embryos (page 4, right column, paragraph 5). The transformation resulted in some cell comprising a deletion and insertion in the TcNPR3 gene (page 8, right column, paragraph 1-2).
Fister teaches that NPR3 negatively regulates NPR1 based on evidence from Arabidopsis (page 2, left column, paragraph 2). Fister teaches that genome editing via CRISPR/Cas9 has already proven useful in improving plant defense response by inhibiting transcription of susceptibility genes, and CRISPR/Cas9 methods have been used in orange (page 10, left column, paragraph 1 & page 2, left column, paragraph 3). An example cited by Fister teaching CRISPR/Cas9 editing in orange is specifically in sweet orange. See Fister References, page 13, right column, final paragraph.
Fister teaches that CRISPR target sites and sgRNAs can be designed for a plant gene using the CRISPR site tool and RNAfold Webserver program (page 2, right column, paragraph 3).
Fister does not teach the introduction of a gene editing system comprising a nuclease and a gRNA that targets CsNPR3 into citrus plant cells or that the gRNA spacer sequence comprises instant SEQ ID NO: 2 or 3.
NCBI Reference Sequence XM_006468378.3 teaches an mRNA sequence of the NPR3 gene in citrus that comprises a sequence with 100% sequence identity to instant SEQ ID NO: 2 as well as a sequence with 100% sequence identity to instant SEQ ID NO: 3. See alignments below.
SEQ ID NO: 2 alignment
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
2e-08
20/20(100%)
0/20(0%)
Plus/Plus
Query 1 TGATGAGAACACTGCAGTTG 20
||||||||||||||||||||
Sbjct 759 TGATGAGAACACTGCAGTTG 778
SEQ ID NO: 3 alignment
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
2e-08
20/20(100%)
0/20(0%)
Plus/Plus
Query 1 CAAGAGACTTCGTCCTAGGA 20
||||||||||||||||||||
Sbjct 1461 CAAGAGACTTCGTCCTAGGA 1480
Gómez-Muñoz teaches a method wherein cDNA fragments of the npr3 and npr4 genes from Valencia late sweet orange, homologous to NPR3 in Arabidopsis, were cloned into a vector for silencing and introduced into sour orange plants subjected to virions of Citrus tristeza virus (CTV); these NPR3 and NPR4-silenced plants had decreased CTV titer (page 1256, right column, paragraph 4-page 1257, right column, paragraph 1 & figure 5). NPR3 and NPR4-silenced plants grew bigger than wildtype plants when exposed to CTV (figure 6). Furthermore, Gómez-Muñoz teaches that induction of systemic acquired resistance in plants requires salicylic acid and that NPR3 and NPR4 are salicylic acid adaptor proteins, mutants of which show enhanced pathogen resistance (page 1254, left column, paragraph 2). Gómez-Muñoz also teaches fragments of the NPR3 sequence can be found in GenBank gene 102621158 (page 1263, right column, paragraph 1).
Gómez-Muñoz teaches a motivation to reduce expression of NPR3 and NPR4 in citrus, because CTV causes economically important diseases in citrus worldwide (page 1253, right column, paragraph 2), and sweet orange grafted on sour orange rootstock can experience decline caused by CTV (page 1253, right column, paragraph 2). Sweet orange is described as a CTV-susceptible host (page 1253, right column, paragraph 2).
Fu teaches that severe strains of CTV cause decline and death of sweet orange on sour orange rootstocks and stem pitting of sweet orange on other rootstocks (page 2, left column, paragraph 1). Fu teaches that sweet orange, which accounts for ~60% of citrus production, is susceptible to CTV (page 2, left column, paragraph 3). Fu provides a picture of sweet orange seedlings infected with CTV (figure 2). Fu teaches that CTV is one of the most destructive and globally distributed citrus diseases, responsible for tremendous economic losses to the citrus industries worldwide (page 2, left column, paragraph 1).
Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Fister to use CRISPR/Cas9 gene editing to knockout the citrus NPR3 gene. One of ordinary skill in the art would have been motivated to do so to reduce NPR3 expression in order to improve resistance to CTV, a cause of economically important citrus diseases worldwide, in sweet orange, a susceptible host. One of ordinary skill would have had reasonable expectation of success, because Fister teaches that CRISPR/Cas9 genome editing had already been successfully used to reduce transcription of susceptibility genes in orange.
In view of Fister, Gómez-Muñoz, NCBI Reference Sequence XM_006468378.3, and Fu, a method of introducing into sweet orange plant cells a non-naturally occurring gene editing system comprising a vector encoding a Cas protein, specifically a Cas9 nuclease, and a gRNA that targets CsNPR3, altering CsNPR3 expression or function is obvious (instant claims 13 & 15). The vector of Fister teaches the sequence encoding the Cas nuclease operably linked to a NOS terminator, which reads on a terminator sequence functional in a plant cell (instant claim 14).
Claim 13 recites that the method is to provide tolerance to Huanglongbing (line 2). This reads as an intended result of the process steps positively recited, and so does not add an additional limitation of patentable weight. Although neither Gómez-Muñoz nor Fister teach that the method would provide tolerance to HLB specifically, the instant specification teaches that alteration or disruption of CsNPR3 expression inherently provides tolerance to HLB by increasing NPR1 levels (specification page 16, lines 14-17). Therefore, the method of Fister, Gómez-Muñoz, NCBI Reference Sequence XM_006468378.3, and Fu would inherently result in an SAR that would provide tolerance to HLB in a citrus plant.
Although Fister, Gómez-Muñoz, NCBI Reference Sequence XM_006468378.3, and Fu do not explicitly teach that the gRNA spacer sequence to target the CsNPR3 gene comprises SEQ ID NO: 2 or SEQ ID NO: 3, NCBI Reference Sequence XM_006468378.3 teaches the coding sequence of the gene to be targeted and Fister teaches tools with which the gRNA sequence, including spacer sequence, could be designed. Given that design of gRNA sequences to target genes with known sequences was routine to one of ordinary skill in the art prior to the filing of the instant application, it would have been obvious to one of ordinary skill to use a gRNA spacer sequence of SEQ ID NO: 2 or 3 (claim 17) to target the CsNPR3 gene taught by NCBI Reference Sequence: XM_006468378.3.
Applicant urges that Fister is silent with respect to citrus plants or bacterial plant pathogens including Liberibacter species that cause HLB (Remarks, page 6, paragraph 1).
This argument is unpersuasive, because Fister does teach that the CRISPR/Cas9 system, which is the basis for Fister’s defense gene targeting method, has been applied to orange. The rationale to combine a method does not need to be Applicant’s own in order to be obvious, and Gómez-Muñoz and Fu provide motivation to apply the method to sweet orange to provide protection against CTV even if they are silent with respect to HLB.
Applicant urges that Gómez-Muñoz is silent regarding gene editing, HLB and manipulations in oranges other than sour orange and emphasizes that sour orange is highly susceptible to CTV infection. Applicant urges that the combination of references would not lead one skilled in the art to conduct gene editing in Citrus sinensis, because Applicant urges that CTV is an issue with rootstocks and not fruit trees themselves. Applicant urges that CTV is “readily addressed” by grafting C. sinensis trees to other rootstocks known to be CTV resistant (Remarks, page 6, paragraphs 2-4).
This argument is unpersuasive because Gómez-Muñoz and Fu teach that C. sinensis, which is commonly known as sweet orange, is susceptible to CTV and not just on sour orange rootstocks. The existence of alternative methods of control, such as grafting onto resistant rootstocks, does not make non-obvious a method of knocking out or silencing NPR3 in sweet orange in order to provide tolerance to CTV.
Applicant urges that Gómez-Muñoz presents data that the double silencing in sour orange is not impactful and imparts a “slight” effect in reducing CTV infection and improving growth in sour orange (Remarks, page 6, paragraph 3).
This argument is unpersuasive, because the teaching of a slight improvement of growth as a result of the method would still be a motivation to use the method.
Applicant urges that Gómez-Muñoz does not suggest that NPR3 could address tolerance to an entirely different pathogen, and there would be no reasonable expectation that such silencing could improve tolerance against a different pathogen because Liberibacter is in a different kingdom of organisms from Phytophthora and CTV and the cellular and physiological mechanisms underlying the diseases is complicated and varies from pathogen to pathogen (Remarks, page 6, paragraph 4-5).
This argument is unpersuasive, because the recitation in claim 13 that the method is to provide tolerance to Huanglongbing (line 2) reads as an intended result of the process steps positively recited. Intended results of recited method steps are not given additional weight (see for example MPEP 2111.04(I). One of ordinary skill in the art would have been motivated by Fister, Gómez-Muñoz, NCBI Reference Sequence XM_006468378.3, and Fu to arrive at the positively recited steps of the claimed method in order to provide tolerance to CTV in sweet orange. Because the motivation to combine references does not need to be Applicant’s own motivation in order to be obvious, the claims would have been obvious to one of ordinary skill in the art prior to the filing of the instant application.
Claim(s) 13-15 & 17 are rejected under 35 U.S.C. 103 as being unpatentable over Dutt et al (2020) Knockout or Silencing of the NPR3 Homolog Enhances Pathogenesis-Related Gene 1 (PR1) Expression in Citrus. In 2020 ASHS Annual Conference. ASHS. (talk given 8/11/2020, prior to but within the 1 year grace period of the provisional filing date; hereafter Dutt) in view of Fister et al (2018) Frontiers in Plant Science. 9. 268. (published 3/2/2018, hereafter Fister) and NCBI Reference Sequence: XM_006468378.3 (available 5/16/2018).
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 10/9/2025, as applied to claims 13-15, 17 & 19-20. Applicant' s arguments filed 1/9/2026 have been fully considered but they are not persuasive.
Dutt has at least one author that is listed as an inventor on the instant application. A disclosure made within one year before the effective filing date of the claimed invention is not prior art under AIA 35 U.S.C. 102(a)(1) if it is apparent from the disclosure itself that it is an inventor-originated disclosure. If, however, the application names fewer joint inventors than a publication, it would not be readily apparent from the publication that it is an inventor-originated disclosure and the publication would be treated as prior art under AIA 35 U.S.C. 102(a)(1) unless there is evidence of record that an exception under AIA 35 U.S.C. 102(b)(1) applies. In the situations in which it is not apparent from the grace period disclosure itself or the patent application specification that the disclosure is an inventor-originated disclosure, the applicant may establish that the AIA 35 U.S.C. 102(b)(1)(A) exception applies by way of an affidavit or declaration under 37 CFR 1.130(a). See MPEP § 2155.01.
Dutt teaches CRISPR/Cas9 genomic editing of CsNPR3 in Citrus sinensis leading to deletions in the CsNPR3 gene in 21% of the CRISPR lines. Dutt suggests that CRISPR could be a viable technique for production of disease resistant citrus trees through modulating expression of negative regulators of SAR (abstract).
Dutt is silent as to whether the CRISPR/Cas9 genomic editing of CsNPR3 in Citrus sinensis comprises introducing a gRNA that targets CsNPR3 or that the sequence encoding the nuclease is operably linked to a terminator or the gRNA spacer sequence comprises SEQ ID NO: 2 and/or SEQ ID NO: 3.
The teachings of Fister and NCBI Reference Sequence XM_006468378.3 are presented above.
Before the filing date of the instant application, it would have been obvious to one of skill in the art to use a CRISPR/Cas vector such as taught by Fister encoding Cas9 operably linked to a NOS terminator and a gRNA targeting NPR3 in the CRISPR/Cas editing method of Dutt. One of ordinary skill in the art would have been motivated to use a vector comprising a gRNA and a terminator in order to accomplish CRISPR/Cas9 because Fister teaches that it is an effective vector for genome editing, and Dutt is silent as to the exact details by which the CRISPR/Cas system is introduced into the citrus cells. One of ordinary skill in the art would have had reasonable expectation of success, because Fister teaches that CRISPR/Cas9 genome editing had already been successfully used to reduce transcription of susceptibility genes in orange. Citrus sinensis is sweet orange. Thus, claims 13-15 are obvious over Fister, Dutt, and NCBI Reference Sequence XM_006468378.3.
Although neither Dutt nor Fister teach that the method would provide tolerance to HLB specifically, the instant specification teaches that alteration or disruption of CsNPR3 expression inherently provides tolerance to HLB by increasing NPR1 levels (specification page 16, lines 14-17). Therefore, the method of Fister, Dutt, and NCBI Reference Sequence XM_006468378.3 would inherently result in an SAR that would provide tolerance to HLB in a citrus plant.
Although Fister, Dutt, and NCBI Reference Sequence XM_006468378.3 do not explicitly teach that the gRNA spacer sequence to target the CsNPR3 gene comprises SEQ ID NO: 2 or SEQ ID NO: 3, NCBI Reference Sequence XM_006468378.3 teaches the coding sequence of the gene to be targeted and Fister teaches tools with which the gRNA sequence, including spacer sequence, could be designed. Given that design of gRNA sequences to target genes with known sequences was routine to one of ordinary skill in the art prior to the filing of the instant application, it would have been obvious to one of ordinary skill to use a gRNA spacer sequence of SEQ ID NO: 2 or 3 (claim 17) to target the CsNPR3 gene taught by NCBI Reference Sequence: XM_006468378.3.
Applicant urges that Dutt only mentions the possibility that RNAi and CRISPR could be a viable technique to produce disease resistant citrus trees but does not suggest that editing of NPR3 could improve tolerance to HLB or establish reasonable expectation of successfully improving HLB (Remarks, page 7, paragraph 2).
This argument is unpersuasive, because the recitation in claim 13 that the method is to provide tolerance to Huanglongbing (line 2) reads as an intended result of the process steps positively recited. Intended results of recited method steps are not given additional weight (see for example MPEP 2111.04(I). One of ordinary skill in the art would have been motivated by Dutt to use RNAi or CRISPR to repress expression of CsNPR3 to produce disease resistant citrus trees, even if Dutt is silent with respect to specific diseases. One of ordinary skill in the art would have had reasonable expectation of success for producing disease resistant citrus trees, because Dutt teaches that the edited plants had significantly higher basal levels pf PR1, which Dutt teaches is believed to directly participate in resistance against pathogens. Additionally, Fister teaches that knockout of NPR3 in cacao enhanced resistance to P. tropicalis. Thus, one of ordinary skill would have had reasonable expectation of successfully improving disease resistance to some disease with the method of the instant claims. The motivation to combine references to arrive at the steps of the claimed method does not need to be Applicant’s own in order to be obvious.
Applicant urges that Applicant provides under separate cover a declaration under 37 CFR 1.130 that the inventive entity in the subject application is the same as that which invented the subject presented in Dutt (Remarks, page 7, paragraph 2).
This argument is unpersuasive, because no declaration under separate cover has been provided in the documents filed 1/9/2026 stating that the inventive entity in the subject application is the same as that which invented the subject presented in Dutt.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663
Prosecution Insights