tDETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group 2 (claims 13-15, 17 & 19-20) in the reply filed on 9/17/2025 is acknowledged.
Claims 1-3, 5-11, 21, 22, 25 & 27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 9/17/2025.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
The restriction is made FINAL.
Status of Claims
Claims 13-15, 17 & 19-20 are under examination on the merits.
Claim Interpretation
The instant specification has defined “gene” as a segment of DNA involved in producing a polypeptide chain including regions preceding and following the coding region involved in transcription/translation of the gene product and regulation of transcription/translation (page 4, liens 10-13). The instant specification has defined “altering DNA sequence, gene structure and function” as introducing an indel of deoxynucleotides in the gene’s coding sequence, introducing an indel in the promoter region, or introducing an indel in the gene’s 5’ untranslated region (page 4, lines 26-29). “CsNPR3” or “Citrus Non-expresser of Pathogenesis Related Genes 3” has been defined as a member of a group of negative regulators of the plant immune system (page 5, lines 15-24). These definitions have been used in the examination of the claims.
Claim Objections
Claims 13, 15, 17 & 20 are objected to because of the following informalities:
Claim 13 (line 1): the acronym “SAR” has not been defined in the claim. A definition of SAR is provided in withdrawn claim 1; however, the term should be written in full upon its first usage in an independent claim before using an acronym.
Claim 13 (line 2): “a citrus plant cells” should read --cells of a citrus plant-- or --a citrus plant cell--.
Claim 15 (line 2): “type II” should read --Type-II-- to correspond with claim 14.
Claim 17 (line 2): “SEQ ID NO. 2 and/or SEQ ID NO. 3” should read --SEQ ID NO: 2 and/or SEQ ID NO: 3--.
Claim 20 (line 1): the acronym “HLB” has not been defined in the claim. A definition of HLB is provided in withdrawn claim 2; however, the term should be written in full upon its first usage in an independent claim before using an acronym.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 13-15, 17 & 19-20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 13 requires “a nuclease encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) protein” (lines 3-4). However, a nuclease would not encode a protein. A nuclease is a protein. It is unclear from the wording whether claim 13 requires a polynucleotide sequence encoding the Cas protein or if claim 13 merely requires the introduction of a nuclease. Because there are two distinct interpretations of the limitation, the invention encompassed by the claim is indefinite and claims 13 and dependent claims 14-15, 17 & 19-20 are likewise indefinite.
Claim 14 recites the limitation "said sequence encoding a type-II CRISPR-associated nuclease" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim, because while claim 13 recites a nuclease it does not recite a type-II CRISPR associated nuclease specifically and does not require a sequence encoding a nuclease.
Claim 15 recites the limitation “said type II CRISPR-associated nuclease” in lines 1-2. There is insufficient antecedent basis for this limitation in the claim, because while claim 13 recites a nuclease it does not recite a type-II CRISPR associated nuclease specifically.
Improper Dependency
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 19 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 19 is drawn to the method of claim 13 wherein disrupting or altering CsNPR3 expression or function activates SAR in the citrus plant. This is an intended result of the method of claim 13 and does not provide any additional step or limitation to the method of claim 13, so claim 19 fails to further limit the subject matter of claim 13. Claim 20, which requires that the SAR provides tolerance to HLB, does provide an additional limitation not found in claim 13.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 13-15, 17 & 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Fister et al (2018) Frontiers in Plant Science. 9. 268. (published 3/2/2018, hereafter Fister) in view of Gómez-Muñoz et al (2017) Molecular Plant Pathology. 18(9), 1253 –1266 (published 9/2/2016, hereafter Gómez-Muñoz) and NCBI Reference Sequence: XM_006468378.3 (available 5/16/2018).
Claims 13-15, 17 & 19-20 are drawn to a method for activating SAR in a citrus plant comprising introducing into citrus plant cels a gene editing system comprising a nuclease Cas protein and a gRNA that targets CsNPR3 wherein the gene editing system disrupts or alters CsNPR3 expression or function.
Although the meaning of “a nuclease encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) protein” (claim 13, lines 3-4) is not definite for the reasons presented above, for purposes of examination and in light of claim 14, it has been interpreted to encompass a nucleic acid sequence encoding a Cas nuclease protein.
Fister teaches a method wherein vectors comprising cassettes for Cas9 and sgRNAs targeting NPR3 were constructed and transformed into leaves of Theobroma cacao plants (figure 2A; page 3, left column, paragraph 2-right column, paragraph 1 & page 5, left column, paragraph 4-5). The vector used by Fister comprised a sequence encoding Cas9 operably linked to a NOS terminator (figure 2A). The transformation resulted in deletion in the TcNPR3 gene creating a premature stop codon (page 5, left column, paragraph 5-right column paragraph 1). Gene expression of five pathogenesis-related genes was elevated while expression of TcNPR3 was reduced (page 6, left column, paragraph 1). Pathogen susceptibility was decreased in gene edited tissue, leading to smaller lesions and a reduction in Phytophthora replication (figure 4A-D; page 5, right column, paragraph 4). Somatic embryo cotyledons were also transformed with the plasmids to create transgenic embryos (page 4, right column, paragraph 5). The transformation resulted in some cell comprising a deletion and insertion in the TcNPR3 gene (page 8, right column, paragraph 1-2).
Fister teaches that NPR3 negatively regulates NPR1 based on evidence from Arabidopsis (page 2, left column, paragraph 2). Fister teaches that genome editing via CRISPR/Cas9 has already proven useful in improving plant defense response by inhibiting transcription of susceptibility genes, including in orange (page 10, left column, paragraph 1 & page 2, left column, paragraph 3).
Fister teaches that CRISPR target sites and sgRNAs can be designed for a plant gene using the CRISPR site tool and RNAfold Webserver program (page 2, right column, paragraph 3).
Fister does not teach the introduction of a gene editing system comprising a nuclease and a gRNA that targets CsNPR3 into citrus plant cells or that the gRNA spacer sequence comprises instant SEQ ID NO: 2 or 3.
NCBI Reference Sequence XM_006468378.3 teaches an mRNA sequence of the NPR3 gene in citrus that comprises a sequence with 100% sequence identity to instant SEQ ID NO: 2 as well as a sequence with 100% sequence identity to instant SEQ ID NO: 3. See alignments below.
SEQ ID NO: 2 alignment
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
2e-08
20/20(100%)
0/20(0%)
Plus/Plus
Query 1 TGATGAGAACACTGCAGTTG 20
||||||||||||||||||||
Sbjct 759 TGATGAGAACACTGCAGTTG 778
SEQ ID NO: 3 alignment
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
2e-08
20/20(100%)
0/20(0%)
Plus/Plus
Query 1 CAAGAGACTTCGTCCTAGGA 20
||||||||||||||||||||
Sbjct 1461 CAAGAGACTTCGTCCTAGGA 1480
Gómez-Muñoz teaches a method wherein cDNA fragments of the npr3 and npr4 genes from Valencia late sweet orange, homologous to NPR3 in Arabidopsis, were cloned into a vector for silencing and introduced into sour orange plants subjected to virions of Citrus tristeza virus (CTV); these NPR3 and NPR4-silenced plants had decreased CTV titer (page 1256, right column, paragraph 4-page 1257, right column, paragraph 1 & figure 5). NPR3 and NPR4-silenced plants grew bigger than wildtype plants when exposed to CTV (figure 6). Furthermore, Gómez-Muñoz teaches that induction of systemic acquired resistance in plants requires salicylic acid and that NPR3 and NPR4 are salicylic acid adaptor proteins, mutants of which show enhanced pathogen resistance (page 1254, left column, paragraph 2). Gómez-Muñoz also teaches fragments of the NPR3 sequence can be found in GenBank gene 102621158 (page 1263, right column, paragraph 1).
Gómez-Muñoz teaches a motivation to reduce expression of NPR3 and NPR4 in citrus, because CTV causes economically important diseases in citrus worldwide (page 1253, right column, paragraph 2).
Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Fister to use CRISPR/Cas9 gene editing to knockout the citrus NPR3 gene. One of ordinary skill in the art would have been motivated to do so to reduce NPR3 expression in order to improve resistance to CTV, a cause of economically important citrus diseases worldwide. One of ordinary skill would have had reasonable expectation of success, because Fister teaches that CRISPR/Cas9 genome editing had already been successfully used to reduce transcription of susceptibility genes in orange.
In view of Fister, Gómez-Muñoz, and NCBI Reference Sequence XM_006468378.3, a method of introducing into citrus plant cells a non-naturally occurring gene editing system comprising a vector encoding a Cas protein, specifically a Cas9 nuclease, and a gRNA that targets CsNPR3, altering CsNPR3 expression or function is obvious (instant claims 13 & 15). The vector of Fister teaches the sequence encoding the Cas nuclease operably linked to a NOS terminator, which reads on a terminator sequence functional in a plant cell (instant claim 14).
Claim 19, which requires that the disruption or alteration of CsNPR3 expression or function activates SAR in the citrus plant, recites an intended result rather than an additional step, so it does not add an additional limitation. Regardless, claim 19 would have been obvious because Gómez-Muñoz teaches that the altered expression of CsNPR3 would induce systemic acquired resistance in plants.
Although neither Gómez-Muñoz nor Fister teach that the method would provide tolerance to HLB specifically, the instant specification teaches that alteration or disruption of CsNPR3 expression inherently provides tolerance to HLB by increasing NPR1 levels (specification page 16, lines 14-17). Therefore, the method of Fister, Gómez-Muñoz, and NCBI Reference Sequence XM_006468378.3 would inherently result in an SAR that would provide tolerance to HLB in a citrus plant.
Although Fister, Gómez-Muñoz, and NCBI Reference Sequence XM_006468378.3 do not explicitly teach that the gRNA spacer sequence to target the CsNPR3 gene comprises SEQ ID NO: 2 or SEQ ID NO: 3, NCBI Reference Sequence XM_006468378.3 teaches the coding sequence of the gene to be targeted and Fister teaches tools with which the gRNA sequence, including spacer sequence, could be designed. Given that design of gRNA sequences to target genes with known sequences was routine to one of ordinary skill in the art prior to the filing of the instant application, it would have been obvious to one of ordinary skill to use a gRNA spacer sequence of SEQ ID NO: 2 or 3 (claim 17) to target the CsNPR3 gene taught by NCBI Reference Sequence: XM_006468378.3.
Claim(s) 13-15, 17 & 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Dutt et al (2020) Knockout or Silencing of the NPR3 Homolog Enhances Pathogenesis-Related Gene 1 (PR1) Expression in Citrus. In 2020 ASHS Annual Conference. ASHS. (talk given 8/11/2020, prior to but within the 1 year grace period of the provisional filing date; hereafter Dutt) in view of Fister et al (2018) Frontiers in Plant Science. 9. 268. (published 3/2/2018, hereafter Fister) and NCBI Reference Sequence: XM_006468378.3 (available 5/16/2018).
Dutt has at least one author that is listed as an inventor on the instant application. A disclosure made within one year before the effective filing date of the claimed invention is not prior art under AIA 35 U.S.C. 102(a)(1) if it is apparent from the disclosure itself that it is an inventor-originated disclosure. If, however, the application names fewer joint inventors than a publication, it would not be readily apparent from the publication that it is an inventor-originated disclosure and the publication would be treated as prior art under AIA 35 U.S.C. 102(a)(1) unless there is evidence of record that an exception under AIA 35 U.S.C. 102(b)(1) applies. In the situations in which it is not apparent from the grace period disclosure itself or the patent application specification that the disclosure is an inventor-originated disclosure, the applicant may establish that the AIA 35 U.S.C. 102(b)(1)(A) exception applies by way of an affidavit or declaration under 37 CFR 1.130(a). See MPEP § 2155.01.
Dutt teaches CRISPR/Cas9 genomic editing of CsNPR3 in Citrus sinensis leading to deletions in the CsNPR3 gene in 21% of the CRISPR lines. Dutt suggests that CRISPR could be a viable technique for production of disease resistant citrus trees through modulating expression of negative regulators of SAR (abstract).
Dutt is silent as to whether the CRISPR/Cas9 genomic editing of CsNPR3 in Citrus sinensis comprises introducing a gRNA that targets CsNPR3 or that the sequence encoding the nuclease is operably linked to a terminator or the gRNA spacer sequence comprises SEQ ID NO: 2 and/or SEQ ID NO: 3.
The teachings of Fister and NCBI Reference Sequence XM_006468378.3 are presented above.
Before the filing date of the instant application, it would have been obvious to one of skill in the art to use a CRISPR/Cas vector such as taught by Fister encoding Cas9 operably linked to a NOS terminator and a gRNA targeting NPR3 in the CRISPR/Cas editing method of Dutt. One of ordinary skill in the art would have been motivated to use a vector comprising a gRNA and a terminator in order to accomplish CRISPR/Cas9 because Fister teaches that it is an effective vector for genome editing, and Dutt is silent as to the exact details by which the CRISPR/Cas system is introduced into the citrus cells. One of ordinary skill in the art would have had reasonable expectation of success, because Fister teaches that CRISPR/Cas9 genome editing had already been successfully used to reduce transcription of susceptibility genes in orange. Thus, claims 13-15 are obvious over Fister, Dutt, and NCBI Reference Sequence XM_006468378.3.
Claim 19, which requires that the disruption or alteration of CsNPR3 expression or function activates SAR in the citrus plant, recites an intended result rather than an additional step, so it does not add an additional limitation. Regardless, claim 19 would have been obvious because Dutt teaches that CRISPR can modulate the negative regulators of systemic acquired resistance in plants.
Although neither Dutt nor Fister teach that the method would provide tolerance to HLB specifically, the instant specification teaches that alteration or disruption of CsNPR3 expression inherently provides tolerance to HLB by increasing NPR1 levels (specification page 16, lines 14-17). Therefore, the method of Fister, Dutt, and NCBI Reference Sequence XM_006468378.3 would inherently result in an SAR that would provide tolerance to HLB in a citrus plant.
Although Fister, Dutt, and NCBI Reference Sequence XM_006468378.3 do not explicitly teach that the gRNA spacer sequence to target the CsNPR3 gene comprises SEQ ID NO: 2 or SEQ ID NO: 3, NCBI Reference Sequence XM_006468378.3 teaches the coding sequence of the gene to be targeted and Fister teaches tools with which the gRNA sequence, including spacer sequence, could be designed. Given that design of gRNA sequences to target genes with known sequences was routine to one of ordinary skill in the art prior to the filing of the instant application, it would have been obvious to one of ordinary skill to use a gRNA spacer sequence of SEQ ID NO: 2 or 3 (claim 17) to target the CsNPR3 gene taught by NCBI Reference Sequence: XM_006468378.3.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-Th 7:30am-5pm EST; F 7:30am-12pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Shubo (Joe) Zhou can be reached at (571) 272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1662
Prosecution Insights