Prosecution Insights
Last updated: October 02, 2026
Application No. 18/269,622

COMPOSITIONS AND METHODS FOR TREATING AND/OR PREVENTING GLYCOGEN STORAGE DISEASES

Non-Final OA §103§112
Filed
Jun 26, 2023
Priority
Dec 26, 2020 — provisional 63/130,687 +2 more
Examiner
SPENCER, ANDREA LYNNE MORRIS
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Duke University
OA Round
1 (Non-Final)
22%
Grant Probability
At Risk
1-2
OA Rounds
6m
Est. Remaining
58%
With Interview

Examiner Intelligence

Grants only 22% of cases
22%
Career Allowance Rate
2 granted / 9 resolved
-37.8% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
41 currently pending
Career history
63
Total Applications
across all art units

Statute-Specific Performance

§101
3.5%
-36.5% vs TC avg
§103
45.1%
+5.1% vs TC avg
§102
17.6%
-22.4% vs TC avg
§112
22.7%
-17.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 9 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Detailed Action Election/Restrictions Applicant's election with traverse of Group I (claims 1, 3, 5-8, 10-12, and 15) in the reply filed on 03/10/2026 is acknowledged. Regarding the traversal: Applicant submits that unity of invention is not lacking as the claimed methods provide a special technical feature and is patentable over the cited art. This is not persuasive because, as recited in the requirement for restriction filed 01/16/2026: Groups I and II lack unity of invention because even though the inventions of these groups require the technical feature of a vector comprising a nucleic acid molecule codon-optimized for mammalian cells which encodes a polypeptide comprising a glycogen branching enzyme, this technical feature is not a special technical feature as it does not make a contribution over the prior art in view of Yi et al (Human Gene Therapy (2017) 28:3;286-294) and Fu et al (Scientific Reports (2020) 10:17617;1-9). Yi teach an AAV9 vector containing glycogen branching enzyme (GBE) (abstract). This reads on an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide capable of degrading accumulated glycogen comprising a glycogen branching enzyme as required by the instant claim 7. Yi is silent on if the nucleic acid sequence is codon-optimized for expression in a mammalian cell. Fu teach codon optimization is necessary for heterologous expression of recombinant proteins (Abstract). Fu further teach expression levels of proteins are highly correlated with codon usage bias and codon optimization improves translation efficiency of the target gene (p1 ¶1/2). It would have been obvious to one of ordinary skill in the art to adapt the vector comprising a nucleic acid sequence comprising a glycogen branching enzyme of Yi by codon optimizing the nucleic acid as taught by Fu because Fu discloses codon optimization improves translation efficiency and expression levels of the target gene. Accordingly, one of ordinary skill in the art would have been motivated to modify the nucleic acid vector as taught by Yi with the teachings of Fu to generate a more efficient expression vector. One would have had a reasonable expectation of success because Fu further teach codon optimization does not change the amino acid sequence and can promote expression of recombinant genes in different host organisms (p1 ¶2). Thus the technical feature of a vector comprising a nucleic acid molecule codon-optimized for mammalian cells which encodes a polypeptide comprising a glycogen branching enzyme is not a special technical feature as it does not make a contribution over the prior art. Thus the argument that unity of invention is not lacking as the claimed methods provide a special technical feature and is patentable over the cited art is not persuasive and the requirement for restriction is deemed proper and is Final. Election of the following species without traverse on the reply filed on 03/10/2026 is acknowledged: 1) Promoter type: tissue-specific 2) Agent: small molecule Priority The present application is a 35 U.S.C. 371 national stage filing of International Application No. PCT/US21/65160, filed 12/23/2021. Applicant' s claim for the benefit of a prior-filed parent provisional application 63243127, filed on 09/11/2021, 63130687 filed 12/26/2020 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged. Thus, the earliest possible priority for the instant application is 12/26/2020. Claims Status Claims 11, 16, 21, 23-26, 28 and 30-32 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1, 3, 5-8, 10, 12, and 15 have been considered on the merits. Claim Objections Claim 1 is objected to because the claim recites “sequence is a codon-optimized for expression in a human or mammalian cell”. This is improper grammar. If the claim were amended to recite “sequence is [ Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 5 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Regarding claim 5: The claim recites “50-69% identity with Seq ID NO: 3 or 4”. Seq ID NOs: 3 and 4 are nucleic acid sequences comprising 2109 residues. Thus the broadest reasonable interpretation of the claim limitation “at least 50% identity” is a nucleic acid sequence that can differ from Seq ID NO: 3 or 4 by up to 50% (about 1,054 residues) compared to Seq ID No: 3 or 4. Thus the claim is drawn to an extremely broad genus of nucleic acid molecules which comprise at least 50% identity with Seq ID NO: 3 or 4. Teachings of the instant specification The instant specification teaches an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide for preventing glycogen accumulation and/or degrading accumulated glycogen, wherein the nucleic acid sequence is CpG-depleted and codon-optimized for expression in a human or mammalian cell (p5 [0030]). The instant specification teach the nucleic acid molecule can encode genes such as glucose-6-phosphatase-alpha (p21 [0084]). The instant specification teach the sequence of the isolated nucleic acid molecule is set forth in Seq ID NO:03 and 04 (p33 [0126]). The instant specification further teach an isolated nucleic acid molecule comprising a sequence having at least at least 50% identity to the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 (p33 [0126]). Example 12 teach the generation of an AAV construct of CpG-depleted human GBE with a neuron-specific promoter (i.e., synapsin) (Fig 23A, p134 [0438]). The specification is silent on a specific nucleotide sequence for the AAV construct of example 12. The state of the art: It is well known in the art that the effect of nucleic acid substitutions on polynucleotide sequences which encode functional proteins is not predictable. It is well known in the art that proteins require specific structure features in order to perform a function. Nucleic acid sequence encoding polypeptides capable of capable of preventing glycogen accumulation and/or degrading accumulated glycogen are known in the art. Yi et al (Human Gene Therapy (2017) 28:3;286-294; cited in the IDS filed 09/05/2023) teach the nucleic acid sequence encoding human glycogen branching enzyme (GBE) is known as NCBI Reference Sequence: MN_000158.3 (p287 col1 ¶3). Yi also teach the most common mutation in the gene encoding GBE is the point mutation Y329S (p286 col2 ¶1). Thus while nucleic acid sequences encoding polypeptides that can perform the required function are known in the art, the change of a single amino acid can result in a dysfunctional protein and changes to the nucleic acid sequence encoding the functional polypeptide must be empirically tested to determine the effect on the function of the encoded polypeptide. Furthermore, Alberts et al (The Shape and Structure of Proteins(2002) Molecular Biology of the Cell 4th ed. New York:Garland Science) teach only a very small fraction of the vast set of conceivable polypeptide chains would adopt a single, stable three-dimensional conformation, and that the vast majority of possible protein molecules could adopt many conformations, each conformation having different chemical properties (p7 ¶2). Alberts further teach the amino acid sequence (encoded by a nucleic acid sequence) of a present-day protein is extremely stable, but the conformation has chemical properties that perform a particular function in the cell, and proteins (polypeptides) are precisely build such that the change of even a few atoms in one amino acid can disrupt the structure of the whole molecule such that all function is lost (p7 ¶3). This demonstrates that, while nucleic acid sequences encoding polypeptides capable of capable of preventing glycogen accumulation and/or degrading accumulated glycogen are known in the art are known in the art, the effect of changes to the polynucleotides (and thus the encoded polypeptide sequence) is highly specific to the location and reside residue in question and the effects of such changes are unpredictable. This supports the effect of changes of up to 50% of the nucleotides encoding a polypeptide capable of preventing glycogen accumulation and/or degrading accumulated glycogen is unpredictable and would require trial-and-error experimentation to identify the nucleic acid sequences which encode polypeptides with a structure that could perform the required function. Conclusion As described supra, the instant specification provides two specific nucleic acid sequences which read on the claimed genus of isolated nucleic acid molecules. However the two species of nucleic acid molecule variants disclosed in the instant specification are not sufficient to predict the broad genus of nucleic acid molecules encoding a polypeptide capable of preventing glycogen accumulation and/or degrading accumulated glycogen, wherein the nucleic acid sequence is a codon-optimized for expression in a human or mammalian cell with at least 50% sequence identity to Seq Id NO: 03 or 04 in view of the unpredictability of nucleic acid changes to polynucleotide sequences encoding polypeptides capable of preventing glycogen accumulation and/or degrading accumulated glycogen as evidenced by the art. Furthermore, the instant specification provides no guidance as how to avoid losing key structural or binding components for polypeptides encoded by the claimed nucleic acid sequences with nucleic acid changes of up to 1,054 bases, and the art does not provide a remedy. One of ordinary skill in the art would understand that polypeptides which perform a function require specific structures to comprise a functional system. One of ordinary skill in the art would also understand that the effect of nucleic acid changes in the nucleic acid sequence encoding a functional polypeptide can have unpredictable effects on the encoded polypeptide structure and thus activity. This demonstrates that, while polynucleotide sequences encoding polypeptides capable of preventing glycogen accumulation and/or degrading accumulated glycogen are known in the art, the effect of changes to nucleic acid sequence encoding said polypeptides must be tested empirically to determine how the sequence change affects polypeptide function. MPEP states “[a] specification may call for a reasonable amount of experimentation to make and use a patented invention. What is reasonable in any case will depend on the nature of the invention and the underlying art”. In the case of the instant claim 5, trial and error and/or laborious screening methods are required to identify an isolated nucleic acids that encode a polypeptide capable of performing the required function as claimed and the species examples provided in the art are not of a large enough breadth to impart predictability on the genus as claimed. If the claim were amended to recite “having at least 90% Claims 1, 3, 5-8, 10,12, and 15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a nucleic acid sequence capable of preventing glycogen accumulation wherein the nucleic acid sequence is codon-optimized for expression in a human or mammalian cell and wherein the polypeptide comprises a glycogen branching enzyme (GBE), does not reasonably provide enablement for a nucleic acid sequence that is capable of degrading accumulated glycogen wherein the polypeptide comprises a glycogen branching enzyme (GBE). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to generate a nucleic acid molecule commensurate in scope with these claims. Regarding claim 1: The claim recites a nucleic acid molecule which encodes a polypeptide that comprises a glycogen branching enzyme (GBE) and is capable of “preventing glycogen accumulation and/or degrading accumulated glycogen” (emphasis added). Zmasek et al (BMC evolutionary Biology (2014) p0-13) teach humans and other mammals possess one glycogen branching enzyme, which for humans is encoded by the gene GBE1 and is involved with glycogen synthesis (p1 col1 ¶1/2). Zmasek further teach humans and other mammals possess one glycogen debranching enzyme (p1 col1 ¶1). Zmasek teach that for humans the debranching enzyme is encoded by the gene GDE (p2 col2 ¶2). A debranching enzyme is considered to read on a polypeptide capable of degrading accumulated glycogen, as recited by the instant claim. Thus, as taught in the art, a glycogen branching enzyme is distinct from an enzyme that degrades accumulated glycogen. Therefore the ability of a glycogen branching enzyme to degrade accumulated glycogen is not taught in the art and thus would need to be empirically tested. Therefore the results of using a glycogen branching enzyme to degrade accumulated glycogen are unpredictable and thus not considered enabled for degrading accumulated glycogen. The instant specification is silent on nucleic acid molecule encoding a glycogen branching enzyme which is capable of degrading accumulated glycogen and the art does not provide a remedy. Thus the specification is only considered to provide enablement for a nucleic acid sequence encoding a polypeptide capable of preventing glycogen accumulation wherein the nucleic acid sequence is codon-optimized for expression in a human or mammalian cell and wherein the polypeptide comprises a glycogen branching enzyme (GBE). Note that claims 3, 5-8, 10, 12, and 15 depend from rejected claim 1 and fail to cure the deficiency. Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 5: The claim recites “a sequence having at least 50-69% identity to the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04”. It is unclear if the claimed sequence identity comprises values over 69% (e.g. 70%). The phrase “at least” suggests that the claim limitation encompasses all values of 50% or greater. However the recited range of 50-69% suggests the claim limitation only includes values in the recited range. For purposes of compact prosecution the claim is broadly interpreted to encompass values of 50% and greater. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 5-7, 12 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Yi et al (Human Gene Therapy (2017) 28:3;286-294; cited in the IDS filed 09/05/2023) in view of Fu et al (Scientific Reports (2020) 10:17617;1-9; published 10/19/2020). Regarding claims 1, 7, 12: Claim 1 recites the phrase “capable of preventing glycogen accumulation and/or degrading accumulated glycogen”. Glycogen branching enzyme (GBE) is considered to read on an enzyme capable of preventing glycogen accumulation because Yi teach GBE deficiency causes the accumulation of glycogen (polyglucosan) (p286 col1 ¶1). Claim 1 recites “wherein the polypeptide… comprises a glycogen branching enzyme (GBE)”. The instant specification defines glycogen branching enzyme (GBE) as “the enzyme that introduces branches to the growing glycogen molecule during the synthesis of glycogen.” (p1 [0003]). Thus a glycogen branching enzyme (GBE) is interpreted as the species of enzymes that introduce branches to the glycogen molecule (e.g. human GBE1, mouse GBE1 etc.). Turning to the art, Yi teach GBE deficiency causes glycogen storage disease in humans which normally lead to death by 5 years of age (p286 col1 ¶1). Yi teach promising treatment for those affected with glycogen storage disease includes a method to correct GBE enzyme, such as correcting GBE enzyme activity through gene therapy (p287 col1 ¶1). Yi teach an AAV9 vector containing glycogen branching enzyme (GBE) (abstract). This reads on an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide capable of degrading accumulated glycogen comprising a glycogen branching enzyme as required by the instant claim 7. Yi is silent on if the nucleic acid sequence is codon-optimized for expression in a mammalian cell. Fu teach codon optimization is necessary for heterologous expression of recombinant proteins (Abstract). Fu further teach expression levels of proteins are highly correlated with codon usage bias and codon optimization improves translation efficiency of the target gene (p1 ¶1/2). It would have been obvious to one of ordinary skill in the art to adapt the vector comprising a nucleic acid sequence comprising a glycogen branching enzyme of Yi by codon optimizing the nucleic acid as taught by Fu because Fu discloses codon optimization improves translation efficiency and expression levels of the target gene. Accordingly, one of ordinary skill in the art would have been motivated to modify the nucleic acid vector as taught by Yi with the teachings of Fu to generate a more efficient expression vector for expression in humans because Yi teach that glycogen storage disease in humans has no definitive treatment. One would have had a reasonable expectation of success because Fu teach codon optimization does not change the amino acid sequence and can promote expression of recombinant genes in different host organisms (p1 ¶2). Regarding claim 5: The instant claim recites “the nucleic acid sequence comprises a sequence having at least 50-69% identity to the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04”. Claim language such as “a sequence having at least 50-69% identity to the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04” encompasses nucleic acids that comprise 50-69% identity with the full-length sequence of SEQ ID NO: 03 or 04, or 50-69% identity with any portion of SEQ ID NO: 03 or 04. If the claim were amended to recite “the nucleic acid sequence comprises the [ sequence having at least 50-69% identity to the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04” the examiner would interpret the claims to encompass only nucleic acids that comprise at least 50-69% identity with the full length of the specified SEQ ID NO:, with or without additional nucleotides at either or both ends. The teachings of Yi and Fu are discussed supra. Yi also teach the encoded human GBH comprises the sequence of reference sequence NM_000158.3 (p287 col1 ¶3). The nucleotide sequence NM_000158.3 shares 96.68% sequence identity with Seq ID NO: 4 of the instant invention, and thus reads on a sequence having at least 50% identity to the sequence set forth in Seq ID NO: 4. Alignment below (Query is Seq ID NO: 4 and Sbjct is NM_000158.3). Query 1 ATGGCTGCTCCCATGACTCCTGCTGCTAGACCTGAGGACTATGAGGCTGCCCTCAATGCT 60 ||||| ||||| |||||||| || ||| | || |||||||| ||||| || |||||||| Sbjct 284 ATGGCGGCTCCGATGACTCCCGCGGCTCGGCCCGAGGACTACGAGGCGGCGCTCAATGCC 343 Query 61 GCCCTGGCTGATGTGCCTGAACTGGCCAGACTCCTGGAGATTGACCCCTACTTGAAGCCC 120 ||||||||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| Sbjct 344 GCCCTGGCTGACGTGCCCGAACTGGCCAGACTCCTGGAGATCGACCCGTACTTGAAGCCC 403 Query 121 TATGCTGTGGACTTCCAGAGAAGGTATAAGCAGTTTAGCCAAATTTTGAAGAACATTGGA 180 || || |||||||||||| | ||||||||||||||||||||||||||||||||||||||| Sbjct 404 TACGCCGTGGACTTCCAGCGCAGGTATAAGCAGTTTAGCCAAATTTTGAAGAACATTGGA 463 Query 181 GAAAATGAAGGTGGTATTGATAAGTTTTCCAGAGGCTATGAATCATTTGGAGTCCACAGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 464 GAAAATGAAGGTGGTATTGATAAGTTTTCCAGAGGCTATGAATCATTTGGCGTCCACAGA 523 Query 241 TGTGCTGATGGTGGTTTATACTGCAAAGAATGGGCCCCTGGAGCAGAAGGAGTTTTTCTT 300 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 524 TGTGCTGATGGTGGTTTATACTGCAAAGAATGGGCCCCGGGAGCAGAAGGAGTTTTTCTT 583 Query 301 ACTGGAGATTTTAATGGTTGGAATCCATTTAGCTACCCATACAAAAAACTGGATTATGGA 360 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct 584 ACTGGAGATTTTAATGGTTGGAATCCATTTTCGTACCCATACAAAAAACTGGATTATGGA 643 Query 361 AAATGGGAGCTGTATATCCCACCAAAGCAGAATAAATCTGTACTGGTGCCTCATGGATCC 420 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 644 AAATGGGAGCTGTATATCCCACCAAAGCAGAATAAATCTGTACTCGTGCCTCATGGATCC 703 Query 421 AAATTAAAGGTAGTTATTACTAGTAAATCTGGAGAGATCTTGTATAGAATTTCACCCTGG 480 ||||||||||||||||||||||||||| ||||||||||||||| | |||||||| ||| Sbjct 704 AAATTAAAGGTAGTTATTACTAGTAAAAGCGGAGAGATCTTGTATCGTATTTCACCGTGG 763 Query 481 GCAAAGTATGTGGTTAGAGAAGGTGATAATGTGAATTATGATTGGATACACTGGGATCCA 540 ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| Sbjct 764 GCAAAGTATGTGGTTCGTGAAGGTGATAATGTGAATTATGATTGGATACACTGGGATCCA 823 Query 541 GAACACTCATATGAGTTTAAGCATTCCAGACCAAAGAAGCCAAGAAGTCTAAGAATTTAT 600 |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| Sbjct 824 GAACACTCATATGAGTTTAAGCATTCCAGACCAAAGAAGCCACGGAGTCTAAGAATTTAT 883 Query 601 GAATCTCATGTGGGAATTTCTTCCCATGAAGGAAAAGTAGCTTCTTATAAACATTTTACA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 884 GAATCTCATGTGGGAATTTCTTCCCATGAAGGAAAAGTAGCTTCTTATAAACATTTTACA 943 Query 661 TGCAATGTACTACCAAGAATCAAAGGCCTTGGATACAACTGCATTCAGTTGATGGCAATC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 944 TGCAATGTACTACCAAGAATCAAAGGCCTTGGATACAACTGCATTCAGTTGATGGCAATC 1003 Query 721 ATGGAGCATGCTTACTATGCCAGCTTTGGTTACCAAATCACAAGCTTCTTTGCAGCTTCC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1004 ATGGAGCATGCTTACTATGCCAGCTTTGGTTACCAAATCACAAGCTTCTTTGCAGCTTCC 1063 Query 781 AGCAGATATGGAACACCTGAAGAGCTACAAGAACTGGTAGACACAGCTCATTCCATGGGT 840 ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1064 AGCCGTTATGGAACACCTGAAGAGCTACAAGAACTGGTAGACACAGCTCATTCCATGGGT 1123 Query 841 ATCATAGTCCTCTTAGATGTGGTACACAGCCATGCTTCAAAAAATTCAGCAGATGGATTG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1124 ATCATAGTCCTCTTAGATGTGGTACACAGCCATGCTTCAAAAAATTCAGCAGATGGATTG 1183 Query 901 AATATGTTTGATGGGACAGATTCCTGTTATTTTCATTCTGGACCTAGAGGGACTCATGAT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1184 AATATGTTTGATGGGACAGATTCCTGTTATTTTCATTCTGGACCTAGAGGGACTCATGAT 1243 Query 961 CTTTGGGATAGCAGATTGTTTGCCTACTCCAGCTGGGAAGTTTTAAGATTCCTTCTGTCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1244 CTTTGGGATAGCAGATTGTTTGCCTACTCCAGCTGGGAAGTTTTAAGATTCCTTCTGTCA 1303 Query 1021 AACATAAGATGGTGGTTGGAAGAATATAGATTTGATGGATTTAGATTTGATGGTGTTACC 1080 ||||||||||||||||||||||||||| | |||||||||||| | |||||||||||||| Sbjct 1304 AACATAAGATGGTGGTTGGAAGAATATCGCTTTGATGGATTTCGTTTTGATGGTGTTACG 1363 Query 1081 TCCATGCTTTATCATCACCATGGAGTGGGTCAAGGTTTCTCAGGTGATTACAGTGAATAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1364 TCCATGCTTTATCATCACCATGGAGTGGGTCAAGGTTTCTCAGGTGATTACAGTGAATAT 1423 Query 1141 TTTGGACTACAAGTAGATGAAGATGCCTTGACTTACCTCATGTTGGCAAATCATTTGGTT 1200 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1424 TTCGGACTACAAGTAGATGAAGATGCCTTGACTTACCTCATGTTGGCAAATCATTTGGTT 1483 Query 1201 CACACCCTGTGTCCTGATTCTATAACAATAGCTGAGGATGTATCAGGAATGCCAGCTCTG 1260 ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1484 CACACGCTGTGTCCCGATTCTATAACAATAGCTGAGGATGTATCAGGAATGCCAGCTCTG 1543 Query 1261 TGCTCTCCAATTTCCCAGGGAGGGGGTGGTTTTGACTATAGACTAGCCATGGCAATTCCA 1320 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 1544 TGCTCTCCAATTTCCCAGGGAGGGGGTGGTTTTGACTATCGACTAGCCATGGCAATTCCA 1603 Query 1321 GATAAGTGGATTCAGCTACTTAAAGAGTTTAAAGATGAAGACTGGAACATGGGAGATATA 1380 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1604 GATAAGTGGATTCAGCTACTTAAAGAGTTTAAAGATGAAGACTGGAACATGGGCGATATA 1663 Query 1381 GTATACACCCTCACAAACAGGAGATACCTTGAAAAGTGCATTGCTTATGCAGAGAGCCAT 1440 |||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||| Sbjct 1664 GTATACACGCTCACAAACAGGCGCTACCTTGAAAAGTGCATTGCTTATGCAGAGAGCCAT 1723 Query 1441 GATCAGGCATTGGTTGGGGATAAGAGCCTGGCATTTTGGTTGATGGATGCTGAAATGTAT 1500 |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| Sbjct 1724 GATCAGGCATTGGTTGGGGATAAGTCGCTGGCATTTTGGTTGATGGATGCCGAAATGTAT 1783 Query 1501 ACAAACATGAGTGTCCTGACTCCTTTTACTCCAGTTATTGATAGAGGAATACAGCTTCAT 1560 |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| Sbjct 1784 ACAAACATGAGTGTCCTGACTCCTTTTACTCCAGTTATTGATCGTGGAATACAGCTTCAT 1843 Query 1561 AAAATGATTAGACTCATTACCCATGGGCTTGGTGGAGAAGGCTATCTCAATTTCATGGGT 1620 ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 1844 AAAATGATTCGACTCATTACGCATGGGCTTGGTGGAGAAGGCTATCTCAATTTCATGGGT 1903 Query 1621 AATGAATTTGGGCATCCTGAATGGTTAGACTTCCCAAGAAAAGGAAATAATGAGAGTTAC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1904 AATGAATTTGGGCATCCTGAATGGTTAGACTTCCCAAGAAAAGGAAATAATGAGAGTTAC 1963 Query 1681 CATTATGCCAGGAGACAGTTTCATTTAACTGATGATGACCTTCTTAGATACAAGTTCCTA 1740 |||||||||||| | ||||||||||||||||| || ||||||||| | |||||||||||| Sbjct 1964 CATTATGCCAGGCGGCAGTTTCATTTAACTGACGACGACCTTCTTCGCTACAAGTTCCTA 2023 Query 1741 AATAATTTTGACAGGGATATGAATAGATTGGAAGAAAGATATGGTTGGCTTGCAGCTCCA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2024 AATAATTTTGACAGGGATATGAATAGATTGGAAGAAAGATATGGTTGGCTTGCAGCTCCA 2083 Query 1801 CAGGCCTATGTGAGTGAAAAACATGAAGGCAATAAGATCATTGCTTTTGAAAGAGCAGGT 1860 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2084 CAGGCCTACGTGAGTGAAAAACATGAAGGCAATAAGATCATTGCTTTTGAAAGAGCAGGT 2143 Query 1861 CTTCTTTTCATTTTCAACTTCCATCCAAGCAAGAGCTACACTGACTACAGAGTTGGAACA 1920 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 2144 CTTCTTTTCATTTTCAACTTCCATCCAAGCAAGAGCTACACTGACTACCGAGTTGGAACA 2203 Query 1921 GCATTGCCAGGGAAATTCAAAATTGTGCTAGATTCAGATGCAGCTGAATATGGAGGGCAT 1980 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 2204 GCATTGCCAGGGAAATTCAAAATTGTGCTAGATTCAGATGCAGCGGAATATGGAGGGCAT 2263 Query 1981 CAGAGACTGGACCACAGCACTGACtttttttCTGAGGCTTTTGAACATAATGGGAGACCC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| Sbjct 2264 CAGAGACTGGACCACAGCACTGACTTTTTTTCTGAGGCTTTTGAACATAATGGGCGTCCC 2323 Query 2041 TATTCTCTTTTGGTGTACATTCCAAGCAGAGTGGCCCTCATCCTTCAGAATGTGGATCTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2324 TATTCTCTTTTGGTGTACATTCCAAGCAGAGTGGCCCTCATCCTTCAGAATGTGGATCTG 2383 Query 2101 CCCAATTGA 2109 || |||||| Sbjct 2384 CCGAATTGA 2392 Regarding claim 6: As discussed supra, Yi teach GBE deficiency causes the accumulation of polyglucosan, an amylopectin-like glycogen (p286 col1 ¶1). Regarding claim 15: The teachings of Yi and Fu are discussed supra. Yi also teach the AAV vector was administered intravenously (p287 col2 ¶1). One of ordinary skill in the art would understand that the administration of an AAV vector intravenously requires the vector to be in a pharmaceutical formulation comprising a pharmaceutically acceptable carrier. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Yi and Fu as applied to claims 1, 5-7, 12 and 15 above, and further in view of Doering et al (US 2017/0326256; cited in the IDS filed 06/26/2023). Regarding claim 3: The teachings of Yi and Fu are discussed supra. Yi do not teach the nucleic acid sequence is CpG-depleted. Doering teach gene therapy using AAV vectors to deliver functional transgenes to a patient who has missing or defective proteins which cause disease (p1 [0004]). Doering teach CpG DNA motifs are removed from the transgene because they can lead to gene methylation and silencing (p12 [0139]). Doering further teach CpG removal can reduce an immune response to a vector including the modified transgene, which enhances the safety and efficacy of the vector (p12 [0139]). It would have been obvious to one of ordinary skill in the art to adapt the vector comprising a nucleic acid sequence comprising a glycogen branching enzyme of Yi by removing CpG sequences as taught by Doering. One of ordinary skill in the art would have been motivated to modify the nucleic acid vector as taught by Yi with the teachings of Doering, to remove CpG from the transgene in order to generate a more efficient expression vector for expression in humans because Yi teach that glycogen storage disease in humans has no definitive treatment. Doering teach that removal of CpGs in a gene therapy vector enhances the safety and efficacy of the vector. One would have had a reasonable expectation of success because Doering teach deletion of CpG motifs within the transgene resulted in increased activity of the transgene (p3 [0035]). Claims 8 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Yi and Fu as applied to claims 1, 5-7, 12 and 15 above, and further in view of McLean et al (Neuroscience Letters (2014) 576;1-6). Regarding claims 8 and 10: The teachings of Yi and Fu are discussed supra. Yi further teach that an AAV9 vector is desirable for gene therapy directed to glycogen storage disease because AAV9 can cross the blood-brain barrier to deliver genes to the CNS (p287 col1 ¶2). Yi teach the AAV vector comprises a chicken beta-actin promoter (p287 col1 ¶3). Yi do not teach the vector comprises the tissue-specific synapsin 1 promoter. McLean teach use of AAV9 vectors to deliver transgenes to the CNS can result in variable cellular tropism which can make gene transfer to the nervous system a challenge (abstract). McLean further teach the human synapsin 1 gene promoter drives neuron-specific expression of an AAV9 delivered transgene in the brain, spinal cord and peripheral nerves and ganglia (abstract). It would have been obvious to one of ordinary skill in the art to adapt the vector comprising a nucleic acid sequence comprising a glycogen branching enzyme of Yi by removing using the synapsin 1 promoter as taught by Mclean. One of ordinary skill in the art would have been motivated to modify the nucleic acid vector as taught by Yi with the teachings of Jackson, to use the synapsin 1 promoter to drive transgene expression, because Yi teach delivery of the transgene to the CNS is desirable and McLean teach the synapsin 1 promoter results in CNS expression. One would have had a reasonable expectation of success because one of ordinary skill in the arts would understand that exchanging functional components of an AAV expression vector requires standard molecular biology methods that are well known in the art, and thus the results would have been predictable. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571)272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631 /JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jun 26, 2023
Application Filed
Jun 29, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702730
ENGINEERED CARTILAGE
4y 3m to grant Granted Aug 11, 2026
Patent 12606833
MODIFIED MINI-NUCLEOSOME CORE PROTEINS AND USE IN NUCLEIC ACID DELIVERY
3y 6m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
22%
Grant Probability
58%
With Interview (+35.7%)
3y 10m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 9 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month