CTNF 18/277,969 CTNF 77512 DETAILED ACTION 07-03-aia AIA 15-10-aia The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. This Office action is in response to the communication filed 5-5-26. Claims 1-5, 30, 32, 35, 37, 40-42, 44, 50, 57, 59, 63, 64, 80, and 81 are pending in the instant application. Election/Restrictions Applicant hereby elects Group I, claims 1, 3-5, 30, 32, 35, 37, 40-42, 44 and 50, the first, second, and third genes are different genes (i.e., a heterologous combination); (a) the first gene is SMN1; the second gene is BINI; and the third gene is MTMI and (b) SEQ ID NO: 729; and AAV9. 08-06 AIA Claim s 2, 57, 59, 63, 64, 80, and 81 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention and species , there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5-5-26 . 08-25-01 AIA Applicant’s election without traverse of Group I, claims 1, 3-5, 30, 32, 35, 37, 40-42, 44 and 50, the first, second, and third genes are different genes (i.e., a heterologous combination); (a) the first gene is SMN1; the second gene is BINI; and the third gene is MTMI and (b) SEQ ID NO: 729; and AAV9 in the reply filed on 5-5-26 is acknowledged. Claim Rejections - 35 USC § 112 07-30-02 AIA The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 07-34-01 Claims 3 and 4 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The claims recite acronyms without reciting the names of the genes claimed. Spelling out the gene names with corresponding acronyms following the gene name in parentheses would be remedial. Appropriate correction is required. Claim Rejections - 35 USC § 103 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-20-02-aia AIA This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 07-21-aia AIA Claim (s) 1, 3-5, 30, 32, 35, 37, 40-42, 44 and 50 is/are rejected under 35 U.S.C. 103 as being unpatentable over Daines et al (Leukemia Research, Vol. 37, pages 1125-1131 (2013)), Rentero et al (BMC Molecular Biology, Vol. 7, No. 39, pages 1-9 (2006)), Paushkin et al (US 2011/0086833) and Davidson et al (WO 2020/033473), the combination in view of Dreyfuss et al USPN 8,993,741), Sarepta Therapeutics, Inc. (USPN 10,905,709), Venter et al (US 2007/0037165), National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index (2011), Liu et al (WO 2018/204764), and Wu et al (WO 2004/030615), the combination further in view of Esteves et al (WO 2019/210269) . The claims are drawn to transgenes comprising:(i) a constitutive exon and one or more intronic sequences, each from a first gene optionally comprising survival motor neuron 1 (SMN1); (ii) an alternatively-spliced exon cassette comprising a) an alternatively-spliced exon, and (b) flanking intronic sequences, wherein each of (a) and (b) are from a second gene optionally comprising Myc box-dependent-interacting protein 1 (BIN1); and (iii) a coding region of interest from a third gene optionally comprising myotubularin 1 (MTM1), which alternatively-spliced exon comprises an ATG start codon, which constitutive exon of (i) comprises exon 6 of SMN1, or a portion thereof; the one or more intronic sequences of (i) are or are derived from intron 6 and/or intron 7 of SMN1; the alternatively-spliced exon of (ii) comprises exon 11 of BIN1; or the flanking intronic sequences of (ii) are or are derived from intron 10 and/or intron 11 of BIN1, which constitutive exon of (i)comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity relative to SEQ ID NO: 102; the one or more intronic sequences of (i) comprise(s) a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 103 and/or SEQ ID NO: 104, the alternatively-spliced exon of (ii) comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to either SEQ ID NO: 37 or SEQ ID NO: 38;the flanking intronic sequences of (ii) each comprise a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity with either SEQ ID NO: 15 or SEQ ID NO: 16; the alternatively-spliced exon cassette of (ii) comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence SEQ ID NO: 729; or the coding region of interest of (iii) comprises a polynucleotide having at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 1881 or SEQ ID NO: 1882, which constitutive exon of (i)is located 5’ relative to the alternatively-spliced exon cassette of (ii): the one or more intronic sequences of (i) flank the alternatively-spliced exon cassette of(ii): the alternatively-spliced exon cassette of (ii) is located 5' relative to the coding region of interest of (iii): the ATG start codon in the alternatively spliced exon of (ii) is in the same reading frame as the coding region of interest of (iii): the ATG start codon in the alternatively spliced exon of (ii) is within up to 5, 10, 20, or 30 nucleotides upstream of the 3' end of the alternative-spliced exon, which alternatively-spliced exon of (ii comprises a heterologous, in-frame stop codon, optionally wherein the heterologous, in-frame stop codon is at least 50 nucleotides upstream of the next 5' splice junction or elicits nonsense- mediated decay, which alternatively-spliced exon of (ii is retained in the spliced transcript in distinct tissues, which flanking intronic sequences of (ii)(b) are or are derived from native flanking introns of the alternatively-spliced exon or each comprise at least one modification relative to a naturally occurring intronic sequence, and which ATG start codon is located at the 3' end of the alternatively-spliced exon of (ii), or optionally which wild-type alternatively- spliced exon does not comprise an ATG start codon at its 3' end and the first 10 nucleotides of the flanking intronic sequence which is immediately 3' to the alternatively-spliced exon of (ii) comprise 1-5 nucleotide substitutions relative to the wild-type flanking intronic sequence which is immediately 3' to the wild-type alternatively-spliced exon, wherein the one or more intronic sequences of (i) each comprise at least one modifications relative to a naturally occurring intronic sequence, optionally wherein the modification is a substitution or deletion of one or more nucleic acids, which coding region of interest of (iii) comprises at least one modification relative to a naturally occurring coding region of the third gene, optionally wherein the modification is a substitution or deletion of one or more nucleic acids; the coding region of interest comprises a deletion or disruption of a native start codon; or the coding region of interest comprises at least one heterologous stop codon, further optionally wherein the at least one heterologous stop codon is at least 50 nucleotides upstream of the next 5' splice junction or the at least one heterologous stop codon elicits nonsense-mediated decay, and optionally further comprising a 3' untranslated region (UTR) or a promoter located 5' relative to all of (i), (ii), and (iii), optionally wherein the 3' UTR comprises a polyadenylation (pA) site and a cleavage site and the promoter is a tissue-specific promoter, further optionally wherein the tissue-specific promoter is an MHCK7 promoter. Daines et al (Leukemia Research, Vol. 37, pages 1125-1131 (2013)) (See IDS filed 3-22-24) teach tumor associated alternative mRNA splicing of CD44 isoforms for antitumor therapy. The approach exploits the tumor specific phenotype of CD44 alternative splicing, where therapy involves compositions comprising toxin gene fragments fused to two variant exons preferentially expressed in tumor cells. Fusions involved splice activated suicide vectors comprising fusions of exotoxin A with a truncated variant 6 protein consisting of two exons, Exon 5 and Exon 10, that are spliced together in frame in the variant CD44v6 protein and/or CD44v8, another tumor associated variant. The tumor specific splice activated vectors with the truncated active toxin provided highly selective toxin based therapeutic approaches (see esp. Table 1, text on page 1126, Figure 1 on page 1127). Rentero et al (BMC Molecular Biology, Vol. 7, No. 39, pages 1-9 (2006)) (See IDS filed 3-22-24) teach that phosphodiesterase 9A (PDE9A) has a large number of alternative splice variants that produce numerous mRNAs, differing in their 5’ region while the 3’ domain containing the coding region of the catalytic site is present in all cases. A new PDE9A splice variant, PDE9A21, was found. Rentero teaches the utilization of two different start codons to produce a variety of different PDE9A proteins, and allowing specific subcellular locations of PDE9A splice variants (see the Abstract, text on page 2, Figure 1 on page 3, Figure 2 on page 4, Figure 3 on page 6). Paushkin et al (US 2011/0086833) teach the following nucleic acid constructs (See Figure 1 and the Abstract and the paragraphs below). Cryptic Splice Site [0427] This example demonstrates that insertion of a guanine residue inserted after nucleotide 48 of exon 7 of SMN2 in a nucleic acid construct of the present invention results in the creation of a cryptic splice site. As a result, such a construct does not reproduce the splicing reaction that occurs at the 5' splice site of intron 7 of SMN2, and thus, the construct cannot be used to screen for compounds that may modulate the inclusion of exon 7 of SMN2 into mRNA transcribed from the SMN2 gene. [0436] SMN1 and SMN2 transcripts derived from minigenes containing exon 6 through 8 and the intervening introns recapitulate the splicing of their endogenous pre-mRNAs ... An SMN2-alternative splicing reporter construct which contains exons 6 to 8 and the intervening introns followed by a luciferase reporter gene was generated. Salient features of this construct are the lack of the start codon in the luciferase gene, inactivation of the termination codon (in the open reading frame that encodes the SMN protein) of exon 7 by insertion of a nucleotide after nucleic acid 48 of exon 7 and addition of a start codon (ATG) immediately upstream of exon 6. Four versions of the SMN2 minigene were generated in which a single adenine (SMN2-A), thymine (SMN2-T), cytosine (SMN2-C) or guanine (SMN2-G) residue was inserted after nucleic residue 48 of exon 7. [0437] The SMN2 minigene was designed such that the luciferase reporter is in frame with the ATG codon immediately upstream of exon 6 when exon 7 is present in the mRNA and the luciferase reporter is out of frame with the ATG codon immediately upstream of exon 6 if exon 7 of SMN2 is removed during splicing of the pre-mRNA. In addition, in the absence of exon 7, the open reading frame that starts from the ATG codon immediately upstream of exon 6 contains a stop codon in the fragment of exon 8 of SMN. Thus, in the presence of compounds that increase the inclusion of exon 7 of SMN2 into mRNA transcribed from the SMN2 gene, more transcripts containing exon 7 and more functional reporter are produced. A schematic illustration of this description can be found in FIG. 1. [0438] The DNA sequence of the minigene from the SMN2-G construct is provided in FIG. 2. The DNA sequence of the minigene from the SMN2-A construct is provided in FIG. 3. [0439] SMN1 versions of the four SMN2 minigene constructs were also generated in which the sixth nucleotide (T) of exon 7 was mutated to C. Similarly to the SMN2 minigene constructs, the four versions of the SMN1 minigene construct had a single adenine (SMN1-A), thymine (SMN1-T), cytosine (SMN1-C) or guanine (SMN1-G) residue inserted after nucleic residue 48 of exon 7. Davidson et al (WO 2020/033473) teach chimeric transactivator minigenes, alternative splicing of the minigene determines whether a transactivator is expressed, Expression of the transactivator results in transcription of a target gene that is under control of a designer promoter sequence. Davidson also teaches chimeric target gene minigenes with alternative splicing of the minigene determines expression of a target gene. Davidson teaches the following nucleic acid constructs: [0008] In one embodiment, methods include administering to a cell: a first expression cassette comprising a chimeric gene operably linked to a first expression control element, wherein the chimeric gene comprises a first portion comprising an alternatively spliced minigene and a second portion that encodes an RNA that encodes the protein, wherein expression of the protein is controlled by the alternative splicing of the first portion, thereby providing and/or controlling expression of a protein. [0009] In another embodiment, methods of providing a protein include administering to subject: a first expression cassette comprising a chimeric gene operably linked to a first expression control element, wherein the chimeric gene comprises a first portion comprising an alternatively spliced minigene and a second portion that encodes an RNA that encodes the protein, wherein expression of the protein is controlled by the alternative splicing of the first portion. [0010] The invention further provides methods of treating disease states, such as neurodegenerative diseases, diseases caused by genetic defects, or disease caused by deficiencies in gene expression. [0011] In one embodiment, methods of treating a disease in a mammal include administering to the mammal: a I.sup.st expression cassette comprising a chimeric gene operably linked to a I.sup.st expression control element, wherein the chimeric gene comprises a first portion comprising an alternatively spliced minigene and a second portion that encodes an RNA that encodes a protein, wherein expression of the protein is controlled by the alternative splicing of the first portion. [0012] In some embodiments, the second portion that encodes the RNA that encodes the protein includes a translation stop codon, lacks an initiation or start codon, is not an open reading frame to produce the protein, or encodes only a portion of the protein. In some embodiments, alternative splicing of the first portion modifies the transcript thereby deleting or nullifying the stop codon, introducing an initiation or start codon, restoring the open reading frame, or providing a missing portion of the protein. [0013] In some embodiments, the first portion is 5’ of the second portion. In some embodiments, the first portion includes an in-frame translation stop codon. In some embodiments, alternative splicing of the first portion removes the translation stop codon. [0014] In some embodiments, the protein is a transactivator protein. In some embodiment, the protein is not a reporter protein. [0015] In one embodiment, methods include administering to a cell: a I.sup.st expression cassette comprising a chimeric gene operably linked to a I.sup.st expression control element, wherein the chimeric gene comprises a first portion comprising an alternatively spliced minigene and a second portion that encodes a transactivator protein that binds to a 2.sup.nd expression control element, wherein expression of the transactivator is controlled by the alternative splicing of the first portion; and a 2.sup.nd expression cassette comprising a nucleic acid sequence encoding an RNA operably linked to the 2.sup.nd expression control element that the transactivator protein binds, thereby increasing expression of the RNA in the mammalian cell. The primary references do not teach the SEQ ID Nos. claimed, nor the MHCK7 promoter. Dreyfuss et al (USPN 8,993,741) the following constructs, including instantly claimed SEQ ID No. 102 for correcting aberrant SMN deficiencies (See the alignment below between instantly claimed SEQ ID No. 102 and SEQ ID No. 14 of Dreyfuss. See also the paragraphs below). RESULT 1 US-13-510-149-14 Sequence 14, US/13510149 Patent No . 8993741 GENERAL INFORMATION APPLICANT: The Trustees of the University of Pennsylvania APPLICANT: Dreyfuss, Gideon APPLICANT: Cho, Sungchan TITLE OF INVENTION: SMNdelta7 Degron: Novel Compositions and Methods of Use FILE REFERENCE: 046483-5178-00-US (601423) CURRENT APPLICATION NUMBER: US/13/510,149 CURRENT FILING DATE: 2012-05-16 PRIOR APPLICATION NUMBER: PCT/US2010/056985 PRIOR FILING DATE: 2010-11-17 PRIOR APPLICATION NUMBER: US 61/261,952 PRIOR FILING DATE: 2009-11-17 NUMBER OF SEQ ID NOS: 25 SEQ ID NO 14 LENGTH: 48 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Chemically synthesized Query Match 88.9%; Score 24; Length 48; Best Local Similarity 100.0%; Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTGGCTATCATACTGGCTATTAT 24 |||||||||||||||||||||||| Db 7 AGTGGCTATCATACTGGCTATTAT 30 3) Although SMN deficiency manifests itself as a motor neuron disease, its molecular consequences are evident as profound disruptions in RNA metabolism in all tissues tested in a SMA mouse model (Zhang et al., 2008, Cell 133(4):585-600). There are two SMN genes in humans, SMN1 and SMN2, both encoding the same open reading frame. The vast majority of SMA patients have homozygous SMN1 deletions and are sustained by one or more copies of SMN2. However, due to a C/T substitution at position 6 of exon 7 that does not change the encoded amino acid, the splicing of the SMN2 pre-mRNA incurs frequent (-80%) exon 7 skipping. This produces an SMN protein (SMN.DELTA.7) that lacks the normal carboxyl-terminal 16 amino acids, and acquires instead four amino acids, EMLA, encoded by exon 8 (Le et al., 2005, Hum Mol Genet 14(6):845-57). Thus, BIM deletions expose the splicing defect of SMN2 and its ineffectiveness in producing full-length normal SMN protein (Wirth et al., 2006, Semin Pediatr Neurol 13(2):121-31; Cooper et al., 2009, Cell 136(4):777-93). (4) Biochemical experiments in vitro suggest that SMN.DELTA.7 is not fully functional compared to normal SMN protein, including a diminished oligomerization and binding to protein substrates, such as the snRNP Sm proteins (Pellizzoni et al., 1999, Proc Natl Acad Sci USA 96(20):11167-72; Lorson et al., 1998, Nat Genet 19(1):63-6). (5) Increased SMN2 copy number correlates with a milder clinical phenotype in SMA patients (Wirth et al., 2006, Hum Genet 119(4):422-8). Furthermore, studies in cells suggest (Wang et al., 2001, J Biol Chem 276(48):45387-93) and experiments in SMN-deficient mice demonstrate that expression of an increasing copy number of SMN.DELTA.7 cDNA transgenes proportionately lessens SMA severity (Le et al., 2005, Hum Mol Genet 14(6):845-57). This suggests that even a modest SMN.DELTA.7 increase is beneficial in SMA. (287) Example 5 (288) Role of snRNP Assembly Defect with SMN Protein Functionality (289) The deficiency in functional SMN protein is directly correlated with snRNP assembly defects in cells of SMA patients (Wan et al., 2005, Mol Cell Biol 25(13):5543-51). Accordingly, the role of SMN.DELTA.7.sup.s270A in snRNP assembly as a further measure of functionality was examined. Extracts from cells expressing SMN and SMN.DELTA.7.sup.S270A were prepared and their snRNP assembly activity was measured. As shown in FIG. 4D, both cell lines showed similar activity. These data indicate that SMN.DELTA.7.sup.S270A is a functional protein similar to normal SMN in S5 cells. The instability of SMN.DELTA.7 conferred by SMN.DELTA.7-DEG is a principal contributor to the deleterious phenotype of exon 7 skipping. However, S270A substitution in SMN.DELTA.7 abrogates the degron activity, thereby restoring the function of SMN. (291) The reduced oligomerization efficiency of SMN.DELTA.7 has been recently suggested to account for its instability (Burnett et al., 2009, Mol Cell Biol 29(5):1107-15). Indeed, intermolecular SMN oxidative crosslinking provided direct evidence that SMN is oligomeric in cells (Wan et al., 2008, Mol Cell 31(2):244-54). Oligomerization is likely to be important for SMN function and also to contribute to its stability. However, although SMN oligomerization correlated with its stability, this did not explain the intrinsic instability of SMN.DELTA.7. The findings presented herein show that attachment of SMN.DELTA.7-DEG to monomeric protein reporters (luciferase and GFP) triggered their rapid degradation, indicating that lack of oligomerization is not the major cause of SMN.DELTA.7's instability. Loss of oligomerization capacity and other possible deficits as a result of deletion of the peptide encoded by exon 7 may result in a SMN protein that is functionally suboptimal. However, the detrimental effect of exon 7 skipping does not arise primarily from deletion of a functionally essential domain but from the creation of a positively acting and potent degron that causes severe deficiency of SMN.DELTA.7 protein. (292) Given the ability of S270A mutation to restore SMN.DELTA.7's stability and complement SMN loss of function, it is reasonable to predict that polymorphisms that inactivate SMN.DELTA.7-DEG, such as at S270, would result in a milder SMA phenotype than the genotype predicts based on SMN2 copy number in SMN/-deleted individuals. Our finding with SMN07.sup.S270A indicates that SMN.DELTA.7 is a functional SMN protein and that its stabilization could prevent or lessen SMA severity. We suggest that interfering with SMN.DELTA.7-DEG activity could be an effective approach for mitigating its deficiency as a potential treatment for SMA. Although the inhibitor studies suggest that the degradation of SMN.DELTA.7 likely occurs in the proteasome, general inhibition of proteasome activity would be very toxic, particularly in the long-term treatment that SMA would be expected to require. A targeted inhibition of the factors that mediate the SMN.DELTA.7-DEG-dependent degradation should provide a more specific therapeutic approach, and their identification will be of great interest for SMA therapy. (293) SMA is thus the result of a fateful chain of events. Homozygous SMA1 deletion is a cause of SMA only because it exposes the splicing defect of SMN2. We argue that the splicing defect in SMN2 causes SMN deficiency because it fortuitously creates a degron. The degron is a key to SMA as it is the most direct cause of SMN deficiency, which then results in major perturbations in RNA metabolism. Sarepta Therapeutics, Inc. (USPN 10,905,709) teaches instantly claimed SEQ ID No. 102 and the following nucleic acid constructs for inducing inclusion of exon 7 in SMN2 mRNA (see the alignment below between instantly claimed SEQ ID No. 102 and SEQ ID No. 2 of Sarepta Therapeutics, Inc. See also the paragraphs below). RESULT 2 US-15-754-782A-2 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 2, US/15754782A Patent No. 10905709 GENERAL INFORMATION APPLICANT: SAREPTA THERAPEUTICS, INC. TITLE OF INVENTION: MODIFIED ANTISENSE OLIGOMERS FOR EXON INCLUSION IN SPINAL TITLE OF INVENTION: MUSCULAR ATROPHY FILE REFERENCE: 12676.0010-00000 CURRENT APPLICATION NUMBER: US/15/754,782A CURRENT FILING DATE: 2018-09-25 PRIOR APPLICATION NUMBER: PCT/US2016/048965 PRIOR FILING DATE: 2016-08-26 PRIOR APPLICATION NUMBER: 62/379,696 PRIOR FILING DATE: 2016-08-25 PRIOR APPLICATION NUMBER: 62/211,678 PRIOR FILING DATE: 2015-08-28 NUMBER OF SEQ ID NOS: 54 SEQ ID NO 2 LENGTH: 111 TYPE: DNA ORGANISM: Homo sapiens Query Match 88.9%; Score 24; Length 111; Best Local Similarity 100.0%; Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTGGCTATCATACTGGCTATTAT 24 |||||||||||||||||||||||| Db 85 AGTGGCTATCATACTGGCTATTAT 108 The present disclosure relates to modified antisense oligomers and related compositions and methods for increasing the expression of functional SMN protein and methods for treating spinal muscular atrophy and relates to inducing inclusion of exon 7 in SMN2 mRNA. (2) Modified antisense oligomers and related compositions and methods are disclosed, including methods for increasing expression levels of functional Survival Motor Neuron (SMN) protein, methods for treating Spinal Muscular Atrophy (SMA), and methods for inducing exon inclusion as a treatment for SMA. Furthermore, methods for inducing inclusion of exon 7 to restore levels of SMN protein encoded by the SMN gene are disclosed. (3) Antisense technology, recently has been adapted to alter the splicing process of a precursor messenger RNA (pre-mRNA). Pre-mRNA is an immature single strand of messenger RNA synthesized from a DNA transcript through a process known as transcription. The pre-mRNA transcript comprises two different segment types, introns and exons. Introns are removed in a process called splicing, which is generally performed by a spliceosome complex. The remaining exons are joined together and become part of the final, mature mRNA molecule. (4) The precise process of intron/exon splicing involves various structural elements within the intron region. These include an intron splice donor site, located at the 5′ end of the intron, a branch site, located near the 3′ end of the intron, and a splice acceptor site, located at the 3′ end of the intron. The splice donor site generally includes a conserved GU sequence at the 5′ end of the exon/intron junction. The splice acceptor site generally includes an AG sequence at the 3′ end of the intron/exon junction. (5) Variations in the splicing process can create variations in the resultant mRNA by varying the exon composition within the mRNA, a process often referred to as alternative splicing. Alternative splicing can occur in many ways. Exons may be extended or skipped. Portions of introns may be retained. Alternative splicing increases the coding potential of the human genome by producing multiple proteins from a single gene. Inappropriate alternative splicing is also associated with a growing number of human diseases. (6) SMA is an often-fatal genetic disorder resulting from the loss of the SMN protein encoded by the Survival Motor Neuron SMN gene. The SMN genes, SMN1 and SMN2, are located on chromosome 5 and SMA is caused by the loss of SMN1 from both chromosomes. SMN2, while being almost identical to SMN1, is less effective at making the SMN protein. The severity of SMA is affected by the efficiency at which SMN2, of which there are several copies, produces the SMN protein. (7) SMN1 encodes a ubiquitously expressed 38 kDa SMN protein that is necessary for snRNP assembly, an essential process for cell survival. A nearly identical copy of the gene, SMN2, fails to compensate for the loss of SMN1 because of exon 7 skipping, producing an unstable truncated protein, SMNΔ7. SMN1 and SMN2 differ by a critical C to T substitution at position 6 of exon 7 (C6U in transcript of SMN2). C6U does not change the coding sequence, but is sufficient to cause exon 7 skipping in SMN2. (11) In certain aspects, the present disclosure provides compositions and methods for increasing the expression of functional SMN protein. In further aspects, the present disclosure provides variously described modified antisense oligomers for enhancing levels of exon 7-containing SMN2 mRNA in a subject. In further aspects, the present disclosure provides methods of enhancing levels of exon 7-containing SMN2 mRNA in a subject, comprising administering a modified antisense oligomer of sufficient length and complementarity to specifically hybridize a region within the SMN2 pre-mRNA. In certain aspects, the subject has SMA. (12) Various aspects include a modified antisense oligomer of 8 to 40 subunits, optionally comprising at least one subunit that is a nucleotide analog having (i) a modified internucleoside linkage, (ii) a modified sugar moiety, or (iii) a combination of the foregoing; and a targeting sequence which is complementary to a target region of 8 or more contiguous nucleotides within SMN2 pre-mRNA, such as a region within intron 6, exon 7, intron 7 or exon 8 (or a region which spans a splice junction) of the SMN2 gene. In further aspects, the modified antisense oligomers further comprise a peptide moiety which enhances cellular uptake. (13) Additional aspects include modified antisense oligomers of 8 to 40 subunits, comprising at least one subunit that is a nucleotide analog having (i) a modified internucleoside linkage, (ii) a modified sugar moiety, and (iii) a targeting sequence which is complementary to intron 6 or intron 7 of SMN2 pre-mRNA. In further aspects, the antisense oligomer comprises a sequence which is complimentary to the −7/−14, −7/−16, −10/−27, −10/−29, −10/−34, −137/−159, −149/−174, −167/−186, −249/−273, or −281/−299 region of intron 7 or the −58/−39, −112/−67, or −264/−245 region of intron 6 of SMN2 pre-mRNA. In some aspects, the modified antisense oligomer comprises a sequence which is complimentary to the −10/−27, −10/−29, or −10/−34 region of intron 7 of SMN2 pre-mRNA. (96) II. Modulation of the Splicing of SMN2 Pre-mRNA (97) Various aspects relate to methods for modulating the splicing of intron and exons of SMN2 pre-mRNA, such that the level of exon 7-containing SMN2 mRNA relative to the level of exon 7-deleted SMN2 mRNA is enhanced, in a given sample (e.g., serum, plasma, tissue, cellular etc.). Various methods include administering a modified antisense oligomer described herein that is complementary to a target region within the SMN2 pre-mRNA, where expression of exon 7-containing SMN2 mRNA is increased relative to the expression of exon 7-deleted SMN2 mRNA . (98) For illustration purposes, and without being bound by theory, modified antisense oligomers as described herein are believed to facilitate blocking, inhibiting or modulating the processing of a pre-mRNA, such as by inhibiting the action of a spliceosome and production of a mature mRNA transcript, and may also induce degradation of targeted mRNAs. In some instances, a spliceosome may be inhibited from binding to an exon/intron splice junction such that an exon/intron splice junction is skipped and one or more exons are removed from a mRNA transcript. A mature mRNA transcript having one or more exons less than a wild-type mRNA transcript may result in a mRNA transcript that maintains the open reading frame such that the mRNA transcript may be translated to functional protein rather than degraded. A protein translated from a mRNA transcript having fewer exons than the wild-type mRNA may result in a transcribed protein comprising fewer amino acid residues than a protein transcribed from a wild-type mRNA transcript. A functional protein composed of fewer amino acid residues than a wild-type protein may have the same or similar activity/functionality as the wildtype protein. The modified antisense oligomer may be said to be “directed to” or “targeted against” a target sequence or target region with which it hybridizes. In certain embodiments, the target sequence includes a region including a 3′ or 5′ splice junction site of a pre-mRNA, a branch point, Exonic Splicing Enhancers (ESE) or Intronic Splicing Enhancers (ISE), or other sequence involved in the regulation of splicing. Within an intron, a donor site (5′ end of the intron) and an acceptor site (3′ end of the intron) are required for splicing. The splice donor site includes an almost invariant sequence GU at the 5′ end of the intron, within a larger, less highly conserved region. The splice acceptor site at the 3′ end of the intron terminates the intron with an almost invariant AG sequence. The target sequence may include sequences within an exon/intron splice junction site, or spanning an exon/intron splice junction. The target sequence may include an exon/intron donor splice site. Venter et al (US 2007/0037165) teach variant nucleic acids resulting in pathological conditions. Venter teaches SEQ ID No. 103 (See the alignment below between instantly claimed SEQ ID No. 103 and SEQ ID No. 42616 of Venter. See also the following paragraphs). RESULT 6 US-10-940-774-42616/c (NOTE: this sequence has 11 duplicates in the database searched. See complete list at the end of this report) Sequence 42616, US/10940774 Publication No. US20070037165A1 GENERAL INFORMATION APPLICANT: VENTER, J. Craig et al. TITLE OF INVENTION: POLYMORPHISMS IN KNOWN GENES ASSOCIATED TITLE OF INVENTION: WITH HUMAN DISEASE, METHODS OF DETECTION AND USES THEREOF FILE REFERENCE: CL001307 CURRENT APPLICATION NUMBER: US/10/940,774 CURRENT FILING DATE: 2004-09-15 PRIOR APPLICATION NUMBER: 60/241,755 PRIOR FILING DATE: 2000-10-20 PRIOR APPLICATION NUMBER: 60/237,768 PRIOR FILING DATE: 2000-10-03 PRIOR APPLICATION NUMBER: 60/231,498 PRIOR FILING DATE: 2000-09-08 NUMBER OF SEQ ID NOS: 207012 SEQ ID NO 42616 LENGTH: 601 TYPE: DNA ORGANISM: Human Query Match 68.3%; Score 136; Length 601; Best Local Similarity 100.0%; Matches 136; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTAAGTAATCACTCAGCATCTTTTCCTGACAATTTTTTTGTAGTTATGTGACTTTGTTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 136 GTAAGTAATCACTCAGCATCTTTTCCTGACAATTTTTTTGTAGTTATGTGACTTTGTTTT 77 Qy 61 GTAAATTTATAAAATACTACTTGCTTCTCTCTTTATATTACTAAAAAATAAAAATAAAAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 76 GTAAATTTATAAAATACTACTTGCTTCTCTCTTTATATTACTAAAAAATAAAAATAAAAA 17 Qy 121 AATACAACTGTCTGAG 136 |||||||||||||||| Db 16 AATACAACTGTCTGAG 1 [0008] Causative SNPs are those SNPs that produce alterations in gene expression or in the expression or function of a gene product, and therefore are most predictive of a possible clinical phenotype. One such class includes SNPs falling within regions of genes encoding a polypeptide product, i.e. cSNPs. These SNPs may result in an alteration of the amino acid sequence of the polypeptide product (i.e., non-synonymous codon changes) and give rise to the expression of a defective or other variant protein. Furthermore, in the case of nonsense mutations, a SNP may lead to premature termination of a polypeptide product. Such variant products can result in a pathological condition, e.g., genetic disease. Examples of genes in which a polymorphism within a coding sequence gives rise to genetic disease include sickle cell anemia and cystic fibrosis. Causative SNPs do not necessarily have to occur in coding regions; causative SNPs can occur in any region that can ultimately affect the expression and/or activity of the protein encoded by the nucleic acid. Such gene areas include those involved in transcription, such as SNPs in promoter regions, in gene areas involved in transcript processing, such as SNPs at intron-exon boundaries that may cause defective splicing, or SNPs in mRNA processing signal sequences such as polyadenylation signal regions. For example, a SNP may inhibit splicing of an intron and result in mRNA containing a premature stop codon, leading to a defective protein. Consequently, SNPs in regulatory regions can have substantial phenotypic impact. [0118] The regulatory sequence may provide constitutive expression in one or more host cells (i.e. tissue specific) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor such as a hormone or other ligand. A variety of vectors that provide constitutive and inducible expression in prokaryotic and eukaryotic hosts are well known to those of ordinary skill in the art. [0127] The invention also encompasses vectors in which the SNP-containing nucleic acid sequences described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to the SNP-containing nucleic acid molecule sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression). [0212] Genetically engineered host cells can be further used to produce non-human transgenic animals. A transgenic animal is preferably a mammal, for example a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA containing a SNP of the present invention which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more cell types or tissues of the transgenic animal. These animals are useful for studying the function of a variant protein and identifying and evaluating modulators of variant protein activity. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. [0213] A transgenic animal can be produced by introducing SNP-containing nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Any protein nucleotide sequences that contain a SNP of the present invention can be introduced as a transgene into the genome of a non-human animal, such as a mouse. [0214] Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the variant protein to particular cells. [0215] Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes animals in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein. [0216] In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1. For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. PNAS 89:6232-6236 (1992). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251:1351-1355 (1991). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein is required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase. Dai et al (USPN 7,514,209) teach SEQ ID No. 38 and its relationship with breast cancer (See the alignment between instantly claimed SEQ ID No. 38 and SEQ ID No. 1017 of Dai). RESULT 8 US-10-172-118-1017 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 1017, US/10172118 Patent No . 7514209 GENERAL INFORMATION APPLICANT: Dai, Hongyue APPLICANT: He, Yudong APPLICANT: Linsley, Peter APPLICANT: Mao, Mao APPLICANT: Roberts, Chris APPLICANT: Van 't Veer, Laura APPLICANT: Van de Vijver, Marc APPLICANT: Bernards, Rene TITLE OF INVENTION: Diagnosis and Prognosis of Breast Cancer Patients FILE REFERENCE: 9301-175-999 CURRENT APPLICATION NUMBER: US/10/172,118 CURRENT FILING DATE: 2002-06-14 PRIOR APPLICATION NUMBER: 60/380,770 PRIOR FILING DATE: 2002-05-14 NUMBER OF SEQ ID NOS: 2699 SEQ ID NO 1017 LENGTH: 1921 TYPE: DNA ORGANISM: Homo sapiens Query Match 95.7%; Score 44; Length 1921; Best Local Similarity 100.0%; Matches 44; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAAGAAAAGTAAACTGTTTTCGCGGCTGCGCAGAAAGAAGAACA 44 |||||||||||||||||||||||||||||||||||||||||||| Db 811 AAAGAAAAGTAAACTGTTTTCGCGGCTGCGCAGAAAGAAGAACA 854 The National Cancer Institute, Cancer Genome Anatomy Project Tumor Gene Index (teaches SEQ ID No. 38 (See the alignment below between instantly claimed SEQ ID No. 38 and Accession A1277169 of The National Cancer Institute, Cancer Genome Anatomy Project Tumor Gene Index. RESULT 2 AI277169/c LOCUS AI277169 356 bp mRNA linear EST 07-JAN-2011 DEFINITION qm65d12.x1 Soares_placenta_8to9weeks_2NbHP8to9W Homo sapiens cDNA clone IMAGE:1893623 3' similar to TR:Q92944 Q92944 BOX-DEPENDENT MYC-INTERACTING PROTEIN-1, mRNA sequence. ACCESSION AI277169 VERSION AI277169.1 DBLINK BioSample: SAMN00154980 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 356) CONSRTM NCI-CGAP http://www.ncbi.nlm.nih.gov/ncicgap TITLE National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index JOURNAL Unpublished COMMENT Contact: Robert Strausberg, Ph.D. Email: cgapbs-r\@mail.nih.gov This clone is available royalty-free through LLNL ; contact the IMAGE Consortium (info\@image.llnl.gov) for further information. Insert Length: 856 Std Error: 0.00 Seq primer: -40UP from Gibco High quality sequence stop: 248. FEATURES Location/Qualifiers source 1..356 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /clone="IMAGE:1893623" /clone_lib="SAMN00154980 Soares_placenta_8to9weeks_2NbHP8to9W" /dev_stage="two placentae: one from 8 weeks and another from 9 weeks post conception" /lab_host="DH10B (ampicillin resistant)" /note="Organ: placenta; Vector: pT7T3D (Pharmacia) with a modified polylinker; Site_1: Not I; Site_2: Eco RI; 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was size selected, ligated to Eco RI adapters (Pharmacia), digested with Not I and cloned into the Not I and Eco RI sites of a modified pT7T3 vector (Pharmacia). Library constructed by Bento Soares and M.Fatima Bonaldo." ORIGIN Query Match 95.7%; Score 44; Length 356; Best Local Similarity 100.0%; Matches 44; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAAGAAAAGTAAACTGTTTTCGCGGCTGCGCAGAAAGAAGAACA 44 |||||||||||||||||||||||||||||||||||||||||||| Db 237 AAAGAAAAGTAAACTGTTTTCGCGGCTGCGCAGAAAGAAGAACA 194 Liu et al (WO 2018/204764) teach compositions for treating signaling pathway aberrations. Liu teaches SEQ ID No. 15, a human chromosome 2-derived occupancy dependent signaling center CAN for altering and/or optimizing gene signaling pathways of a cell and for treating gene expression related diseases in a subject (See the alignment below between instantly claimed SEQ ID No. 15 and SEQ ID BFV38055 of Liu). ESULT 2 BFV38055/c ID BFV38055 standard; DNA; 494 BP. XX AC BFV38055; XX DT 10-JAN-2019 (first entry) XX DE Human Chr2-derived occupancy-dependent signaling center DNA, SEQ:38018. XX KW Chromosome-2; cell signaling; ds; gene expression; genetic disorder; KW genetic-disease-gen.; therapeutic. XX OS Homo sapiens. XX CC PN WO2018204764-A1. XX CC PD 08-NOV-2018. XX CC PF 04-MAY-2018; 2018WO-US031056. XX PR 05-MAY-2017; 2017US-0501795P. XX CC PA (CAMP-) CAMP4 THERAPEUTICS CORP. XX CC PI Liu Y, Sigova A, Odonnell CW, Smith C, Whissell G, Chevalier B; CC PI Bryan JF, Ward DT; XX DR WPI; 2018-87972C/78. XX CC PT Altering signaling of primary neighborhood gene encoded within insulated CC PT neighborhood, by disrupting primary upstream or downstream boundary of CC PT insulated neighborhood, altering, and inhibiting or activating expression CC PT of signal molecules. XX CC PS Claim 25; SEQ ID NO 38018; 1377pp; English. XX CC The present invention relates to the identification and targeted CC modulation of gene signaling networks. The invention provides methods and CC compositions for the evaluation, alteration and/or optimization of gene CC signalling, including methods and systems which exploit the information CC generated in the identification of new targets and non-canonical CC signalling pathways. The methods and compositions can be used in treating CC a disease where an occupancy-dependent signalling center controls CC expression of at least one gene associated with the disease. The present CC sequence is a human chromosome 2-derived occupancy-dependent signaling CC center (ODSC) DNA, which is useful for evaluation, alteration and/or CC optimization of gene signaling pathway of a cell, and for treating gene CC expression-related disease in a subject. XX SQ Sequence 494 BP; 89 A; 152 C; 164 G; 89 T; 0 U; 0 Other; Query Match 100.0%; Score 243; Length 494; Best Local Similarity 100.0%; Matches 243; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAGCCTCCTGCCCCTCACCAGGCCCTGTTAGCATCACCTCGGGCACCTGGCCACAGCAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 406 GAGCCTCCTGCCCCTCACCAGGCCCTGTTAGCATCACCTCGGGCACCTGGCCACAGCAGG 347 Qy 61 GGCCAGTCAGGGCACCCCGGGATAGCACGCCCAGGCCCTGTGCAAGGCCTCTGGCACTTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 346 GGCCAGTCAGGGCACCCCGGGATAGCACGCCCAGGCCCTGTGCAAGGCCTCTGGCACTTA 287 Qy 121 GGAGAGGCTTTTGCCCCTTTGTCCTCTGAGCAGAAGGGTTGGCAAAGAGGGAAGGGGACA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 286 GGAGAGGCTTTTGCCCCTTTGTCCTCTGAGCAGAAGGGTTGGCAAAGAGGGAAGGGGACA 227 Qy 181 GGCCAGTTCTGCACCTGGCCTTTCTCCAGAATGAAGGCCTCCACCTCCCGTCCGTCCCCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 226 GGCCAGTTCTGCACCTGGCCTTTCTCCAGAATGAAGGCCTCCACCTCCCGTCCGTCCCCA 167 Qy 241 CAG 243 ||| Db 166 CAG 164 Wu et al (WO 2004/030615) teach instantly claimed SEQ ID No. 1882, cDNA encoding tumour associated antigenic target (TAT) cDNA 227559. Wu teaches compositions for treating proliferative disorders using compositions comprising TAT (See the alignment below between instantly claimed SEQ ID No. 1882 and Accession ACN39797 of Wu). RESULT 2 ACN39797 (NOTE: this sequence has 6 duplicates in the database searched. See complete list at the end of this report) ID ACN39797 standard; cDNA; 2466 BP. XX AC ACN39797; XX DT 11-JUN-2007 (revised) DT 18-NOV-2004 (first entry) XX DE Tumour-associated antigenic target (TAT) cDNA DNA227559, SEQ ID NO:4161. XX KW Tumour-associated antigenic target; TAT; human; overexpression; cancer; KW tumour; diagnosis; cell proliferative disorder; breast cancer; KW colorectal cancer; lung cancer; ovarian cancer; liver cancer; KW central nervous system cancer; bladder cancer; pancreatic cancer; KW cervical cancer; melanoma; leukaemia; hybridisation probe; KW chromosome identification; chromosome mapping; gene mapping; KW gene therapy; cytostatic; gene; ss. XX OS Homo sapiens. XX CC PN WO2004030615 -A2. XX CC PD 15-APR-2004. XX CC PF 29-SEP-2003; 2003WO-US028547. XX PR 02-OCT-2002; 2002US-0414971P. XX CC PA (GETH ) GENENTECH INC. XX CC PI Wu TD, Zhang Z, Zhou Y; XX DR WPI; 2004-347921/32. DR P-PSDB; ABM81608. DR PC:NCBI; gi791039. DR PC_ENCPRO:NCBI; gi791040. XX CC PT New tumor-associated antigenic target polypeptides and nucleic acids, CC PT useful in preparing a medicament for treating or detecting a CC PT proliferative disorder, e.g. breast, lung, colorectal, ovarian or CC PT prostate cancer or tumor. XX CC PS Claim 1; SEQ ID NO 4161; 7273pp; English. XX CC The invention relates to human tumour-associated antigenic target (TAT) CC polypeptides, and their related nucleic acids. The TAT polypeptides are CC overexpressed in cancer tissues compared to normal tissues, and may thus CC serve as effective targets for the diagnosis and treatment of cancer in CC mammals. The invention also relates to nucleic acid and polypeptide CC sequences at least 80\% identical to the TAT nucleic acids and CC polypeptides; expression vectors and host cells comprising a TAT nucleic CC acid; an antibody specific for a TAT polypeptide; a peptide or organic CC molecule which binds to a TAT polypeptide; fusion proteins comprising a CC TAT polypeptide; and methods and compositions for the treatment or CC diagnosis of cancer in mammals. TAT polypeptides, nucleic acids, CC antibodies, antagonists, binding molecules and compositions are useful CC for diagnosing or treating a cell proliferative disorder associated with CC increased TAT expression, particularly cancers such as breast cancer, CC colorectal cancer, lung cancer, ovarian cancer, liver cancer, bladder CC cancer, pancreatic cancer, cervical cancer, cancers of the central CC nervous system, melanoma and leukaemia. TAT nucleic acids may further be CC used as hybridisation probes, in chromosome and gene mapping, in CC chromosome identification and in gene therapy. The present sequence CC represents a TAT nucleic acid of the invention CC CC Revised record issued on 11-JUN-2007 : Enhanced with precomputed CC information from BOND. XX SQ Sequence 2466 BP; 657 A; 636 C; 662 G; 511 T; 0 U; 0 Other; Query Match 97.7%; Score 2433.6; Length 2466; Best Local Similarity 99.4%; Matches 2456; Conservative 0; Mismatches 5; Indels 10; Gaps 1; Qy 1 CCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4 CCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGG 63 Qy 61 CCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 64 CCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGC 123 Qy 121 ATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 124 ATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTC 183 Qy 181 GAGCAACTTCACAAGAAATGTCTTGAAAAGAAAGTTCTTTATGTANNNNNNNNNNGACCC 240 ||||||||||||||||||||||| |||||||||||||||||||| ||||| Db 184 GAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGT----------GGACCC 233 Qy 241 TGAGTTCCCACCGGACGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGT 300 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Db 234 TGAGTTCCCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGT 293 Qy 301 CTGGAAGAGACCTCCGGAAATATGTGAGAATCCCCGATTTATCATTGATGGAGCCAACAG 360 ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| Db 294 CTGGAAGAGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAG 353 Qy 361 AACTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 354 AACTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCT 413 Qy 421 GACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 414 GACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAA 473 Qy 481 CTACGCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 474 CTACGCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTAT 533 Qy 541 AGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 534 AGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAA 593 Qy 601 TGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 594 TGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGC 653 Qy 661 TCTGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 654 TCTGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTT 713 Qy 721 TTTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 714 TTTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAG 773 Qy 781 AGGCTCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 774 AGGCTCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCC 833 Qy 841 TTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 834 TTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACT 893 Qy 901 GCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCAT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 894 GCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCAT 953 Qy 961 TCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 954 TCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGT 1013 Qy 1021 CACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1014 CACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAA 1073 Qy 1081 TCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1074 TCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTT 1133 Qy 1141 TGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1134 TGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTG 1193 Qy 1201 GATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1194 GATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGC 1253 Qy 1261 CGATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1254 CGATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTG 1313 Qy 1321 GGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1314 GGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCC 1373 Qy 1381 TCAGTACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1374 TCAGTACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTG 1433 Qy 1441 CAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1434 CAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAG 1493 Qy 1501 TCTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1494 TCTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCA 1553 Qy 1561 GCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1554 GCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACAT 1613 Qy 1621 CAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1614 CAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCC 1673 Qy 1681 CTCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1674 CTCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAG 1733 Qy 1741 GAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1734 GAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAA 1793 Qy 1801 AACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1794 AACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGA 1853 Qy 1861 CCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1854 CCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACA 1913 Qy 1921 GCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1914 GCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTT 1973 Qy 1981 CAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1974 CAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAA 2033 Qy 2041 CACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2034 CACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCG 2093 Qy 2101 TAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2094 TAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCA 2153 Qy 2161 CCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2154 CCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCA 2213 Qy 2221 GTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCT 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2214 GTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCT 2273 Qy 2281 CAACAACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2274 CAACAACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGA 2333 Qy 2341 CTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2334 CTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGC 2393 Qy 2401 ATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2394 ATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCAC 2453 Qy 2461 CATGTATGCCT 2471 ||||||||||| Db 2454 CATGTATGCCT 2464 Esteves et al (WO 2019/210269) teach the MHCK7 promoter and AAV vectors (See esp. page 4 and claim 28). It would have been obvious to construct and optimize the transgenes instantly claimed because transgenes and nucleic acid constructs and vectors comprising all of the components claimed were taught and routinely optimized in the prior art. All of the introns, exons, alternatively spliced exons and sequences claimed were previously disclosed, and methods of assaying the effectiveness of splicing, tissue targeting, and expression of genes of interest were well known in the art and routinely used, as disclosed in the teachings of Daines, Rentero, Paushkin, Dreyfuss, Sarepta Therapeutics, Inc., Venter et al, National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index, Liu, Wu and Esteves. For these and the aforementioned reasons, the instant rejection would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention . Double Patenting 08-33 AIA The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 08-35 Claim s 1, 30, 32, 35, 37, 40-42, 44 BS 50 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-16 of copending Application No. 19/105,597 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both sets of claims recite transgenes comprising constitutive exons, intronic sequences, alternatively spliced exon cassettes and coding regions of interest . This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300 . NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). Jane Zara 6-15-26 /JANE J ZARA/Primary Examiner, Art Unit 1637 Application/Control Number: 18/277,969 Page 2 Art Unit: 1637 Application/Control Number: 18/277,969 Page 3 Art Unit: 1637 Application/Control Number: 18/277,969 Page 4 Art Unit: 1637 Application/Control Number: 18/277,969 Page 5 Art Unit: 1637 Application/Control Number: 18/277,969 Page 6 Art Unit: 1637 Application/Control Number: 18/277,969 Page 7 Art Unit: 1637 Application/Control Number: 18/277,969 Page 8 Art Unit: 1637 Application/Control Number: 18/277,969 Page 9 Art Unit: 1637 Application/Control Number: 18/277,969 Page 10 Art Unit: 1637 Application/Control Number: 18/277,969 Page 11 Art Unit: 1637 Application/Control Number: 18/277,969 Page 12 Art Unit: 1637 Application/Control Number: 18/277,969 Page 13 Art Unit: 1637 Application/Control Number: 18/277,969 Page 14 Art Unit: 1637 Application/Control Number: 18/277,969 Page 15 Art Unit: 1637 Application/Control Number: 18/277,969 Page 16 Art Unit: 1637 Application/Control Number: 18/277,969 Page 17 Art Unit: 1637 Application/Control Number: 18/277,969 Page 18 Art Unit: 1637 Application/Control Number: 18/277,969 Page 19 Art Unit: 1637 Application/Control Number: 18/277,969 Page 20 Art Unit: 1637 Application/Control Number: 18/277,969 Page 21 Art Unit: 1637 Application/Control Number: 18/277,969 Page 22 Art Unit: 1637 Application/Control Number: 18/277,969 Page 23 Art Unit: 1637 Application/Control Number: 18/277,969 Page 24 Art Unit: 1637 Application/Control Number: 18/277,969 Page 25 Art Unit: 1637 Application/Control Number: 18/277,969 Page 26 Art Unit: 1637 Application/Control Number: 18/277,969 Page 27 Art Unit: 1637 Application/Control Number: 18/277,969 Page 28 Art Unit: 1637
Prosecution Insights