DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Specification
The use of the term “MilliQ” [0150], which is a trade names or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b) and (d):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second and fourth paragraph:
(1st) The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(4th) Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers
Claim 72 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
When read to incorporate the limitations of claim 70 from which it depends, claim 72 reads as: “…further comprising incubating the biosample or assay sample with a dye that inhibits DNA amplification, wherein the dye is selected from the group consisting of…[FAM, VIC, TAMRA, HEX, Cy3, Cy5, and JOE].”
However, FAM, VIC, TAMRA, Cy3, Cy5, and JOE are not dyes which are known to inhibit DNA amplification. Rather, the claimed dyes are ones often used to label the primers and/or probes used in DNA amplification assays. Where inhibitory effects are seen, it is due to the action of the primer/probe, rather than the dye itself (see Botezatu et al. Biotechniques. 2017 Feb 1;62(2):62-8; abstract). While intercalating dyes, such as SYBR Green, are known to occasionally have an inhibitory effect (see Gudnason et al. Nucleic acids research. 2007 Oct 1;35(19):e127; abstract), none of the dyes listed in claim 72 are intercalating dyes.
Accordingly, the claim contains a functional requirement (“a dye that inhibits DNA amplification”) that is inconsistent with the closed list provided by claim 72. Because the dyes listed do not possess the ability to perform the claimed function, a skilled artisan would be unable to ascertain which dyes are within the scope of the claim. Additionally, the specification does not provide guidance for how a skilled artisan would be able to make ascertain such information, and even provides a different closed list of dyes for use in performing the claimed function.
Therefore, a skilled artisan would be unable to ascertain the metes and bounds of the claimed scope, rendering claim 72 indefinite. For the purposes of prior art, the use of any dye for the purpose of inhibiting DNA amplification will be considered.
Claim 72 contains the trademarks/trade names: VIC, Cy3, and Cy5. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name.
In the present case, the trademarks/trade names are used to identify/describe fluorescent dyes. The generic names provided for each of these trademarks/trade names do not appear to be correct and, accordingly, the identification/description is indefinite. While additional trademarks/trade names are present (i.e., FAM, TAMRA, HEX, and JOE), they are accompanied by their generic name and thus their identification is not indefinite.
Claim 72 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 70 recites a limitation of “a dye that inhibits DNA amplification” with claim 72 providing options for said dye. However, the dyes provided by claim 72 are not ones which are known to inhibit DNA amplification. Rather, the claimed dyes are ones often used to label the primers and/or probes used in DNA amplification assays. Where inhibitory effects are seen, it is due to the action of the primer/probe, rather than the dye itself (see Botezatu et al. Biotechniques. 2017 Feb 1;62(2):62-8; abstract). While intercalating dyes are known to occasionally have an inhibitory effect (see Gudnason et al. Nucleic acids research. 2007 Oct 1;35(19):e127; abstract), none of the dyes listed are intercalating dyes. Therefore, by listing dyes that do not have an inhibitory effect, it could be interpreted that Applicant is expanding the scope of claim 70, rather than further limiting it.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 33, 34, 39, 43-46, 53, 57, 58, and 61 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Rotolo (Rotolo C et al. BioControl. 2016 Feb;61(1):91-101).
Rotolo teaches that biocontrol agents are used in agriculture as a sustainable way to protect crops that prevents resistance to traditional fungicides and reduces fungicide residue on produce while keeping to organic agriculture standards. One such agent includes Bacillus spp. strains which show great potential due to their ability to form endospores and survive in a wide range of environmental conditions. However, in order to improve their usage and effectiveness, a better understanding of colonization and survival of these agents is required (Rotolo, p91-92).
In pursuit of this goal, Rotolo teaches a method for quantitatively detecting bacterial strains present on grape berries (Rotolo, abstract). Vineyards were treated with either Serenade Max or Amylo-X (commercially available biofungicides) which contain either Bacillus subtilis strain QST713 (BS) or Bacillus amyloliquefaciens subsp. plantarum strain D747 (BA), respectively (Rotolo, p92). Per the instant specification [0139, 0143], Bacillus subtilis strain QST713 was the initial classification of Bacillus amyloliquefaciens QST713 (accession number: NRRL B-21661).
PNG
media_image1.png
247
626
media_image1.png
Greyscale
Randomly-selected grape berries from these treated vines, as well as from untreated vines, were sampled and washed with distilled water mixed with Tween 20 (Rotolo, p92-94). Aliquots of the wash liquid from the untreated grapes were inoculated with serial dilutions of both BS and BA obtained from the liquid formulations of the commercial products used to treat the vineyards. One portion of each aliquot was used in a cell culturing assay to determine the CFU of each dilution (Rotolo, p95). A second portion of the inoculated aliquots, as well as portions of the wash liquid from the treated grapes, were used for subsequent DNA extraction procedures and assessed for bacterial presence via a TaqMan-based qPCR assay using BS- and BA-specific primer-probe sets wherein the probes are labeled with FAM and TAMRA (Rotolo, p96, Table 2). Standard curves for both BS and BA were generated by plotting the cycle threshold values of the serially diluted samples (Ct values) versus the Log10 CFU from the dilutions (Rotolo, p92, 95), thus depicting the correlation between Ct value and CFU (Rotolo, Fig 1). This standard curve could then be used to calculate the CFU value of the treated grapes without needing to perform a cell culture by inputting the obtained Ct value. Using this method, as few as 3 CFU of each target Bacillus sp. could be detected (Rotolo, p99). By inputting this limit of detection into the respective standard curves, a baseline Ct value of ~39.3 (BS) and ~38.3 (BA) can be determined, in which a smaller Ct value would indicate a positive result.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 40 is rejected under 35 U.S.C. 103 as being unpatentable over Rotolo in view of Myo (Myo EM et al. Biological control. 2019 Jul 1;134:23-31) and Mendis (Mendis HC et al. PLoS One. 2018 Feb 15;13(2):e0193119, IDS reference).
The limitations of claims 33, 34, and 39, from which claim 40 depends, are taught by Rotolo has previously discussed. Combinations 1-5 of the instant application relate to primer-probe sets specific for Bacillus velezensis and combination 6 relates to a primer-probe set specific for Bacillus subtilis QST713 (instant specification, paragraphs [0138-0139, 0143, 0148-0149]). When the sequences of the instant application were searched in the prior art, combinations 2 and 3 (SEQ ID NOs: 4-9) all matched with portions of the Bacillus velezensis genome (Accession #CP058216).
While Rotolo teaches the quantitative detection of Bacillus subtilis QST713, Rotolo does not demonstrate a current need in the art to similarly detect Bacillus velezensis, nor does Rotolo teach the use of the exact primers and probes of the instant application.
Myo confirmed Rotolo’s assertion that the Bacillus species, in general, exhibits potent antifungal activity and sought to specifically interrogate the capabilities of Bacillus velezensis NGK-2. Myo found that not only did the bacterium exhibit antifungal properties, but also promoted plant growth as well, hypothesizing that Bacillus velezensis could serve as a potential biocontrol agent to protect crop plants (Myo, abstract, p30).
Therefore, one of ordinary skill in the art prior to the effective filling date of the claimed invention would have been motivated to expand the quantitative assay of Rotolo to include Bacillus velezensis in order to assess its suitability as a biocontrol agent. As the DNA sequence of Bacillus velezensis is well characterized within the art, standard primer design principles (i.e., primer length, melting temperature, GC content) would provide clear and predictable guidance for generating suitable primers. Accordingly, the design of primers and probes specific for this bacterium is well within the skill of the ordinary artisan, akin to choosing from a finite number of predicable primer candidates and, therefore, obvious to try.
The Supreme Court decided that a claim can be proved obvious merely by showing that the combination of known elements was obvious to try. In this regard, the Supreme Court explained that, “[w]hen there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill in the art has a good reason to pursue the known options within his or her technical grasp.” An obviousness determination is not the result of a rigid formula disassociated from the consideration of the facts of the case. Indeed, the common sense of those skilled in the art demonstrates why some combinations would have been obvious where others would not. Therefore, choosing from a finite number of identified, predictable solutions, with a reasonable expectation for success, is likely to be obvious to a person if ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, E.).
Additionally, Mendis also describes a method for quantitatively assessing root colonization of biocontrol agents through qPCR, specifically Bacillus amyloliquefaciens QST713 (Serenade®) and B. firmus I-1582 (VOTiVO®), developing strain-specific primer-probe sets (Mendis, abstract). As can be seen below, the Mendis primer-probe set for Bacillus amyloliquefaciens QST713 (Mendis, Table 1) is identical to the primers-probe of Combination 6 of the instant application. As the primer-probe set of Mendis was already developed and proven to work for the purpose of quantitatively assessing Bacillus amyloliquefaciens QST713, a skilled artisan looking to implement the method of Rotolo would have been motivated to use Mendis’s set in order to save time and resources.
Forward
Mendis
GACGTATGGATACACCTCTTTAAT
Instant
gacgtatggatacacctctttaat
Reverse
Mendis
CCAAATTCCTCAGAAGAGAGAG
Instant
ccaaattcctcagaagagagag
Probe
Mendis
TTCCCATTAATATACTCAATTAGAGAACCT
Instant
ttcccattaatatactcaattagagaacct
Claim 47 is rejected under 35 U.S.C. 103 as being unpatentable over Rotolo in view of Xie (Xie S et al. Journal of applied microbiology. 2020 Feb 1;128(2):518-27).
The limitations of claims 33 and 34, from which claim 47 depend, are taught by Rotolo as previously discussed. However, Rotolo performs quantification via TaqMan PCR, not by digital qPCR.
PNG
media_image2.png
506
327
media_image2.png
Greyscale
Xie describes two methods, TaqMan qPCR and droplet digital PCR (ddPCR), for quantitatively detecting the colonization of Bacillus subtilis in the soil surrounding Arabidopsis plants (Xie, abstract). While Rotolo directly correlated Ct value with CFU value, the standard curves developed by Xie depict the correlation between DNA content and CFU value for both the TaqMan assay (Xie, Figure 4d) and the ddPCR assay (Xie, Figure 4f). Xie found that both methods were specific, effective, and reliable, showing a consistent trend when compared to traditional cultivation-based methods (Xie, abstract). Xie does admit, however, that ddPCR is more tolerant to inhibitors and more sensitive than TaqMan assays (Xie, p525).
Therefore, a person of ordinary skill in the art prior to the effective filing date of the claimed invention, looking to improve the specificity of Rotolo’s assay and its ability to withstand the effects of inhibitors, would have been motivated to modify the method of Rotolo to be conducted via ddPCR as opposed to a TaqMan assay. To further support this assertion of obviousness, Xie used the same primers and probe in both their TaqMan assay and their ddPCR assay, showing the functional interchangeability of the methods (Xie, p519). Applying a known technique to a known device (method or product) ready for improvement to yield predictable results is likely to be obvious. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, D.).
Claims 35, 36, 48, and 70-71 are rejected under 35 U.S.C. 103 as being unpatentable over Rotolo in view of Meng (Meng X et al. Canadian Journal of Plant Pathology. 2016 Jul 2;38(3):296-306) as evidenced by Nocker (Nocker A et al. Journal of microbiological methods. 2006 Nov 1;67(2):310-20).
The limitations of claims 33 and 34, from which claims 35, 36, 48, and 70-72 depend from in some manner, are taught by Rotolo as previously discussed. Rotolo describes their assay as being a “reliable method to detect and quantify the BCAs on grape bunches, and likely on other matrices,” while simultaneously describing how the assay slightly overestimates the number of bacterial cells present. According to Rotolo, one possible explanation for this is that the intact DNA from dead cells may be inflating the estimated CFU as the Ct value is determined by the amount of DNA present, not the amount of DNA from live cells capable of forming colonies (Rotolo, p99).
Rotolo does not teach performing their method on a crude extract from a seed or seed wash sample, nor the addition of a dye that inhibits DNA amplification.
However, Meng teaches a similar method in which cucumber seeds are assessed for bacterial contamination using a propidium monoazide (PMA) treatment in combination with quantitative real-time PCR (Meng, abstract). Nocker teaches that PMA is a dye which selectively penetrates the membranes of dead cells, intercalating into double stranded DNA once inside. Upon binding and exposure to light, cross-linkage occurs, thus inhibiting amplification of the DNA from the dead cells (Nocker, p316). Therefore, as Meng and Nocker both suggest, the inclusion of PMA in a quantitative assay limits analysis to the DNA of viable cells.
As Rotolo admits that their method overestimates the number of bacterial cells present in a sample, likely due to quantification of DNA from dead cells, the inclusion of a PMA treatment would address this issue. Therefore, a person of ordinary skill in the art prior to the effective filing date of the claimed invention would have been motivated to modify the method of Rotolo to include a PMA treatment step to obtain more accurate quantification results in regards to the number of viable cells present in a sample. Applying a known technique to a known device (method or product) ready for improvement to yield predictable results is likely to be obvious. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, D.).
Regarding claims 35 and 48, in order to assess collected cucumber seeds for bacterial contamination, Meng washed seed aliquots with a solution of sterile water and Tween 20 before grinding the seeds to obtain a homogeneous suspension. This suspension was subsequently filtered, treated with PMA, and subjected to qPCR without DNA extraction (Meng, p300).
Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Rotolo in view of Meng (Meng X et al. Canadian Journal of Plant Pathology. 2016 Jul 2;38(3):296-306) as evidenced by Nocker (Nocker A et al. Journal of microbiological methods. 2006 Nov 1;67(2):310-20), as applied to claims 36, 36, 48, and 70-71 above, and further in view of Mendis.
The limitations of claims 33-36, from which claim 37 depends, are taught by Rotolo and Meng as previously discussed. Neither Rotolo or Meng teach the use of the specific primer-probe sets claimed in the instant application. However, as discussed in the rejection of claim 40, Mendis teaches a primer-probe set for Bacillus amyloliquefaciens QST713 (Mendis, Table 1) that is identical to the primers-probe of combination 6 of the instant application. As the primer-probe set of Mendis was already developed and proven to work for the purpose of quantitatively assessing Bacillus amyloliquefaciens QST713, a skilled artisan looking to implement the combined method of Rotolo and Meng would have been motivated to use Mendis’s primer-probe set in order to save time and resources.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kara N Kovach whose telephone number is (571)272-8134. The examiner can normally be reached Monday - Friday, 9am - 3pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.K./Examiner, Art Unit 1681
/SAMUEL C WOOLWINE/Primary Examiner, Art Unit 1681
Prosecution Insights