DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Application/Amendments/Claims
This office action is in response to the communications filed on 07/23/2026.
Claims 88 and 124-128 are canceled in response to the Office Action mailed 04/23/2026.
Claims 1, 2, 23, 62, 69, 76, 78, 86, 89, and 129 are amended in response to the Office Action mailed 04/23/2026.
Claims 131-154 are newly added in response to the Office Action mailed 04/23/2026.
Claims 1-2, 19, 23, 62, 69, 76, 78, 86, 89, 91-92, and 129-154 are pending and are under examination.
Claim Interpretation
Claims 2, 19, 23, 62, 69, 78, 124, and 129 recite alternative claim limitations using “or” or “and/or;” the examiner has considered only one from the lists in the alternative as being required, However, for compact prosecution and customer service, the examiner considered more than one alternative limitations as applicable to cited prior art rejections.
Claim 2 recites “optionally wherein” for alternative limitation “c)” and “f).” The examiner is not considering limitation that follow “optionally wherein” as being required; thus, such limitations will not be considered to further limit the claim and the broadest reasonable interpretation will be afforded based on the preceding limitation listed in the alternative. However, for compact prosecution and customer service, the examiner will consider as many of the optional limitations as possible with respect to the prior art.
Response to Arguments and Amendments
Withdrawn Objections and/or Rejections
Any objections and/or rejections not repeated in this Office Action are hereby withdrawn.
Maintained Rejections
Double Patenting
STATUTORY (35 USC 101)
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claims 86, 89, and 91 provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 85, 87-88, and 90 of copending Application No. 18/626,784 (reference application). This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented.
Instant claim 86 is identical in scope to claim 85 of the reference application, as both claims recite an rAAV particle comprising an rAAV vector having the same ordered nucleic acid elements (AAV2 ITR, serpinA1 stuffer, Byrne desmin enhancer, Paulin desmin enhancer, desmin promoter, 5′ arm of rabbit β-globin intron, 5′ miR155 scaffold, DMPK204 guide, miR155 loop, DMPK204 passenger, 3′ miR155 scaffold, 3′ arm of rabbit β-globin intron, minimal BGH polyA, serpinA1 stuffer, AAV2 ITR) and further reciting the same AAVrh74 N502I capsid. Accordingly, instant claim 86 and reference claim 85 are drawn to identical subject matter.
Instant claim 89 is identical in scope to reference claim 88, as both claims recite the same rAAV vector architecture and further recite that the capsid is an AAVrh74 W505R capsid. Therefore, instant claim 89 and reference claim 88 are drawn to identical subject matter.
Instant claim 91 depends from claim 89 and recites that the AAVrh74 W505R capsid comprises capsid proteins comprising the amino acid sequence of SEQ ID NO:52. Reference claim 90 depends from claim 88 and recites the identical limitation. Accordingly, instant claim 91 and reference claim 90 are drawn to identical subject matter.
NON-STATUTORY
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 86 and 89 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 86 and 89 of copending Application No. 18/626,784 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because:
Claims 86 and 89 of the refence application recite an rAAV particle comprising the same ordered nucleic acid elements defined by SEQ ID NOs, including the same ordered nucleic acid elements (AAV2 ITR, serpinA1 stuffer, Byrne desmin enhancer, Paulin desmin enhancer, desmin promoter, 5′ arm of rabbit β-globin intron, 5′ miR155 scaffold, DMPK204 guide, miR155 loop, DMPK204 passenger, 3′ miR155 scaffold, 3′ arm of rabbit β-globin intron, minimal BGH polyA, serpinA1 stuffer, AAV2 ITR) and further reciting the same AAVrh74 N502I and AAVrh74 W505R capsids, respectively. The reference claims are narrower in that they explicitly recite the specific SEQ ID NOs for each element, whereas instant claims 86 and 89 generally recite the same structural components. Thus, the subject matter of the instant claims 86 and 89 are anticipated by claims 86 and 89 of the reference application, and the differences between the claims do not render the instant claims patentably distinct.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Regarding applicant arguments concerning Claim Rejections under Double Patenting:
Applicant's arguments filed 07/23/2026 have been fully considered but they are not persuasive.
Applicant canceled claim 88 so the rejection is now moot and withdrawn.
Applicant argues that the amendment to claims 86 and 89 to recites the SEQ ID NOs for the Bryne and Paulin enhancers overcomes the double patenting rejections. However, the SEQ ID NOs for the Bryne and Paulin enhancers were previously claimed, so it is not a matter of having the SEQ ID Nos assigned. Furthermore, the copending application claims, 86 and 89, relied upon for the double patenting rejections herein already recite the SERQ ID NOs for the Byrne and Paulin enhancers, so if anything, the double patenting is now even more so.
New Rejections Necessitated by Amendment
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 19, and 131-145 are rejected under 35 U.S.C. 103 as being unpatentable over Geall et. al., (US 20190298847 A1, in IDS) in view of Khvorova et al., (US20200385737A1) and Hou et. al., (US 20200377887 A1, already of record).
Amended claim 1 is now directed to an RNAi comprising a first strand and a second strand forming a duplex, wherein the first strand (guide) comprises nucleic acid with the sequence SEQ ID NO: 1 or with a sequence with at least about 90% identical to SEQ ID NO: 1 and the second strand comprises a non-guide region comprising nucleic acid with the sequence SEQ ID NO: 2 or with a sequence with at least about 90% identical to SEQ ID NO: 2. Amended claim 2 now recites the first and second strands as in claim 1; however without the at least about 90% identical clause. The examiner notes that the use of the open-ended transition “comprising” means the claim is to include any molecule that contains the recited 21-mer sequence, even if additional nucleotides are present.
Regarding claims 1-2 and 19, Geall teaches “polynucleic acid molecules, pharmaceutical compositions, and methods for treating muscle atrophy or myotonic dystrophy,” see abstract. Geall teaches a systematic “walking” library of polynucleic acid molecules designed to target the DMPK gene via RNA interference (RNAi). Geall teaches that the RNAi polynucleic acid molecules target sequences set forth in SEQ ID NOs: 28-141, 370-480, or 703-3406, of which SEQ ID NOs: 2646-2648 are of particular relevance to the claimed SEQ ID NO: 1 in the instant case. SEQ ID NOs: 2646-2648 are 23-mer “target RNA” sequences, see claims 1 and 8 and [0118-0120]. In the field of RNAi and as taught by Geall, “the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof” (see [0186]). Therefore, a disclosure of a “target RNA” sequence is a disclosure of the sense/passenger/non-guide strand of an RNAi.
Further regarding claim 1, Geall explicitly teaches that the RNAi polynucleic acid comprises a sense strand (passenger) and an antisense (guide) strand, see [0126]. Geall further teaches that sense and antisense strands are complementary to one another and form a duplex (see [0186-0189]), and considering the well-established principle of Watson-Crick base pairing, the disclosure of a sense/non-guide strand inherently discloses a complementary antisense/guide strand. The antisense/guide complement of Geall’s SEQ ID NOs: 2646-2648 is a 23-mer that contains the 21-nucleotide sequence of the claimed SEQ ID NO: 1 with 100% identity. See alignment below:
PNG
media_image1.png
158
730
media_image1.png
Greyscale
Thus, under the “comprising” construction of the claim, the 23-mer antisense/guide strand (i.e., the complement of sense strand 5’ – acccuagaacugucuucgacucc – 3’) of Geall teaches the claimed 21-mer antisense/guide sequence.
While the specific sequences cited above (2646-2648) are 23-mers, Geall provided a robust framework of overlapping length ranges that encompass the claimed 21-mer. Geall teaches, for example, that the molecules can be: “about 18 to about 25 nucleotides…about 19 to about 23 nucleotides…about 20 to about 22 nucleotides,” see [0124-0130]. A 21-mer falls squarely within these narrowly defined, nested ranges.
Furthermore, Geall teaches SEQ ID NO: 13,462, which is a 19-mer specifically categorized as an antisense/guide strand, see [0121]. This 19-mer is 100% identical to the first 19 nucleotide bases of the claimed SEQ ID NO: 1. Having 19 bases identical to the 21-mer sequence claimed provides a 90.4% identity, which falls within the claimed about 90% identity structural limitation.
Geall does not merely disclose a random list of sequences, rather Geall teaches: (1) the specific DMPK genetic targets; (2) the specific sequences (e.g., SEQ ID NOs: 2646-2648); and (3) the specific architecture and length (i.e., duplex comprising a 20-22 nucleotide antisense strand). Because Geall provides a 100% sequence match within a disclosed range of “about 20 to about 22” nucleotides for the purpose of targeting the same gene (DMPK), the prior art is in possession of the claimed antisense/guide strand.
Further regarding claims 1 and 2 with respect to the non-guide strand, Geall teaches “an asymmetric hairpin is a linear polynucleic acid molecule comprising an antisense region, a loop portion that comprises nucleotides or non-nucleotides, and a sense region that comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complimentary nucleotides to base pair with the antisense region and form a duplex with loop. For example, an asymmetric hairpin polynucleic acid molecule comprises an antisense region having length sufficient to mediate RNAi in a cell or in vitro system (e.g. about 19 to about 22 nucleotides) and a loop region comprising about 4 to about 8 nucleotides, and a sense region having about 3 to about 18 nucleotides that are complementary to the antisense region.” See [0188]. Thus, Geall and coworkers contemplate non-guide strands that are not perfectly complementary to the guide strand.
Further regarding claim 19, Geall teaches “a polynucleic acid molecule that hybridizes to a target sequence of human DMPK and mediates RNA interference against the human DMPK” see claim 1, and that “mediation of RNA interference against the human DMPK modulates muscle atrophy or myotonic dystrophy in a subject” see claim 3. Geall further teaches “the myotonic dystrophy is DM1” see [0008], and that “DM1 is caused by a dominantly inherited “CTG” repeat expansion in the gene DM protein kinase (DMPK),” see [0310].
Regarding claims 131-137, Geall teaches the first strand and the second strand are linked by means of an RNA linker capable of forming a loop structure ([0167]: “the sense strand is connected to the antisense strand via a linker molecule, which … is a polynucleotide linker”). As stated above, Geall teaches hairpins with loop regions that are between 4-50 and 4-20 nucleotides, see [0188]. The nature of a hairpin allows for both configuration as recited in claims 135-136.
Regarding claim 138, Geall teaches the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA) ([0123]: “the polynucleic acid molecule comprises RNA…RNA comprises short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA)…”).
Geall does not teach that the non-guide strand has a nucleic acid sequence of SEQ ID NO: 2, that the linker/loop sequence has a nucleic acid sequence of SEQ ID NO: 3, that the hairpin sequence of has a nucleic acid sequence of SEQ ID NO: 7, or that the hairpin is flanked at its 5’ end with SEQ ID NO: 9 and at its 3’ end with SEQ ID NO: 10.
Khvorova teaches asymmetric RNA silencing agents such that the guide stand and the passenger strand are not perfect complement to one another. Khvorova teaches that “the capacity of a siRNA-like duplex to mediate RNAi or translational repression may be predicted by the distribution of non-identical nucleotides between the target gene sequence and the nucleotide sequence of the silencing agent at the site of complementarity,” and that “where gene silencing by translational repression is desired, at least one non-identical nucleotide is present in the central portion of the complementarity site so that duplex formed by the miRNA guide strand and the target mRNA contains a central “bulge”. Khvorova further teaches that “ the “bulge” is centered at nucleotide positions 12 and 13 from the 5′ end of the miRNA molecule.” See [0306]. Khvorova teaches that the bulge is formed by “extra nucleotides that create a single nucleotide “loop” in one portion of the stem, and/or one or more unpaired nucleotides that create a gap in the hybridization of the two portions of the stem to each other,” see [0309]. Khvorova further teaches “to facilitate entry of the antisense strand into RISC (and thus increase or improve the efficiency of target cleavage and silencing), the base pair strength between the 5′ end of the sense strand and 3′ end of the antisense strand can be altered;” for example, where there “is at least one wobble base pair, e.g., G:U, between the 5′ end of the first or antisense strand and the 3′ end of the sense strand portion,” which enhances “entry into RISC,” see [0316][0340]. Khvorova teaches that applying these “asymmetry design rules” to RNAi silencing agents facilitates “enhanced efficacy and specificity in mediating RNAi,” because such alterations “facilitate entry of the antisense strand of the siRNA… into RISC in favor of the sense strand, such that the antisense strand preferentially guides cleavage or translational repression of a target mRNA, and thus increasing or improving the efficiency of target cleavage and silencing,” see [0339].
Hou teaches that “a “modulatory polynucleotide” is any nucleic acid sequence(s) which functions to modulate (either increase or decrease) the level or amount of a target gene, e.g., mRNA or protein levels,” see [0205]. Hou further teaches that “at least one siRNA, miRNA or other RNAi agent described herein, may be encoded by a modulatory polynucleotide which may also comprise at least one molecular seq ID No,” see [0300]. Hou further teaches methods of designing the modulatory polynucleotides encoding novel double stranded RNAi constructs, see [0008]. Hou further teaches that a “modulatory polynucleotide comprises in the 5′ to 3′ direction, a 5′ flanking sequence, a 5′ arm, a loop motif, a 3′ arm and a 3′ flanking sequence,” and that “ the 5′ arm may comprise a nucleic acid sequence encoding a sense sequence and the 3′ arm comprises a nucleic acid sequence encoding the antisense sequence” or “the 5′ arm comprises a nucleic acid sequence encoding the antisense sequence and the 3′ arm comprises a nucleic acid sequence encoding the sense sequence,” see [0314]. Hou further teaches that Hou further teaches “separating the sense and antisense sequence of the stem loop structure of the modulatory polynucleotide is a loop sequence (also known as a loop motif, linker or linker motif). The loop sequence may be of any length, between 4-30 nucleotides, between 4-20 nucleotides, between 4-15 nucleotides, between 5-15 nucleotides, between 6-12 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, and/or 15 nucleotides,” see [0307]. Hou further teaches the use miR155 scaffold, see [0209][0211][0342]. Hou further teaches that “ the 5′ arm, sense and/or antisense sequence, loop motif and/or 3′ arm sequence may be altered (e.g., substituting 1 or more nucleotides, adding nucleotides and/or deleting nucleotides). The alteration may cause a beneficial change in the function of the construct (e.g., increase knock-down of the target sequence, reduce degradation of the construct, reduce off target effect, increase efficiency of the payload, and reduce degradation of the payload),” see [0315]. Hou further teaches SEQ ID NO: 12 corresponding to a 5’ miR155 scaffold portion, which aligns with 100% identity to SEQ ID NO: 9 of the instant case. Hou further teaches SEQ ID NO: 21 corresponding to a 3’ miR155 scaffold portion, which aligns with 100% identity to SEQ ID NO: 10 of the instant case. Hou further teaches SEQ ID NO: 17 corresponding to a miR155 loop structure, which aligns with 100% identity to SEQ ID NO: 3 of the instant case. Regarding SEQ ID NO: 11 recited in newly added claim 140, the claim recites in the alternative “wherein the scaffold comprises all or a portion of the nucleic acid SEQ ID NO: 11,” and since Hou teaches both the 5’ (SEQ ID NO: 9) and 3’ (SEQ ID NO: 10) portions of the miR-155 scaffold, which both align with 100% identity to SEQ ID NO: 11 as the respective 5’ and 3’ portions, Hou therefore teaches the use of SEQ ID NO: 11 as claimed in the alternative, “or a portion of.” Alignments if SEQ ID NO: 9 and SEQ ID NO: to SEQ ID NO: 11 are provided below for convenience as well as Hou aligned to each of SEQ ID NO: 9, 3, and 10 :
SEQ ID NO: 9 aligned to SEQ ID NO: 11
PNG
media_image2.png
204
612
media_image2.png
Greyscale
SEQ ID NO: 10 aligned to SEQ ID NO: 11
PNG
media_image3.png
206
622
media_image3.png
Greyscale
Hou SEQ ID NO: 12 to SEQ ID NO: 19
PNG
media_image4.png
208
618
media_image4.png
Greyscale
Hou SEQ ID NO: 21 to SEQ ID NO: 10
PNG
media_image5.png
204
629
media_image5.png
Greyscale
Hou SEQ ID NO: 21 to SEQ ID NO: 10
PNG
media_image6.png
214
621
media_image6.png
Greyscale
Hou further teaches that “the modulatory polynucleotide is designed using at least one of the following properties: loop variant, seed mismatch/bulge/wobble variant, stem mismatch, loop variant and vassal stem mismatch variant, seed mismatch and basal stem mismatch variant, stem mismatch and basal stem mismatch variant, seed wobble and basal stem wobble variant, or a stem sequence variant,” see [0216].
It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to modify the passenger/non-guide strand of the DMPK targeting RNAi of Geall consistent with the structure modifications taught by Khvorova arriving at SEQ ID NO: 2 and incorporate the modified RNAi duplex into the microRNA scaffold of Hou such that there is a 5’ miR-155 handle, a miR-155 loop region, and a 3’ miR-155 handle, thereby arriving at a hairpin miRNA of SEQ ID NO: 7 flanked by the miR-155 5’ and 3’ scaffold handles, SEQ ID NO: 9 and SEQ ID: 10, respectively.
Regarding the passenger strand, SEQ ID NO: 2, of instant claims 1 and 2, Geal’s disclosed sense strand, SEQ ID NO: 2647, which is the direct complement of the instantly claimed guide/antisense strand of SEQ ID NO: 1, does not, without modification satisfy the claimed limitation that the passenger/sense strand comprise nucleic acid with sequence of SEQ ID NO: 2 or a sequence with about 90% identity thereto. However, applying Khvorova’s teachings to the passenger strand of Geall, a PHOSITA would have: (1) introduced a two-nucleotide deletion into Geall’s passenger strand at the position corresponding to a bulge centered at positions 12-13 of the guide strand, per Khvorova’s teaching regarding RNAi repression and (2) substituted a nucleotide at the 3′ end of the sense strand portion to form a G:U wobble, per Khvorova’s teaching regarding enhanced asymmetry. The resulting modified passenger strand aligns to the claimed SEQ ID NO: 2 with 100% identity, see sequence alignment:
PNG
media_image7.png
202
622
media_image7.png
Greyscale
Regarding the SEQ ID NO: 7 of claim 137, assembling (a) the guide strand of Geall corresponding to instant SEQ ID NO: 1, (b) the loop/linker sequence of Hou corresponding to instant SEQ ID NO: 3, and (c) the modified passenger stand corresponding to instant SEQ ID NO: 2 arrived at by applying Khvorova’s bulge and wobble teachings to Geall’s passenger strand results in an assembled RNAi duplex aligning to the claimed SEQ ID NO: 7 with 100% identity, see sequence alignment:
PNG
media_image8.png
210
621
media_image8.png
Greyscale
A PHOSITA would have been motivated to modify Geall’s passenger strand according to Khvorova’s bulge and wobble teachings because asymmetric modifications bias RISC loading towards the intended guide strand and away from the passenger strand, thereby improving the efficiency of target cleavage and silencing. A PHOSITA seeking to optimize the DMPK-silencing efficacy and strand selection fidelity of Geall’s RNAi construct would have looked to Khvorova’s asymmetry enhancing design principles as routine, art-recognized tools and would have been motivated to apply one or more such features (i.e., bulges ad wobbles) because Khvorova teaches both embodiments enhance duplex asymmetry to bias stand selection, such that combining them represents the predictable stacking of complementary modifications rather than the combination of unrelated or competing teachings. A PHOSITA would have further been motivated to incorporated this asymmetric RNAi molecule into the miR155 scaffold and loop architecture to promote efficient Drosha/Dicer processing and reliable liberation of a guide strand for target transcript silencing.
A PHOSITA would have had a reasonable expectation of success in arriving at the claimed passenger strand (SEQ ID NO: 2) and assembled duplex (SEQ ID NO: 7) because Khvorova demonstrated that RNA silencing agents bearing a central bulge at positions 12-13 and/or a terminal wobble pair retain silencing function relative to a perfectly complementary duplex indicating that such modifications are compatible with RNAi activity and because Hou demonstrated the successful use of the miR155 scaffold elements with asymmetric RNAi molecules comprising bulges and/or wobbles without loss of function and in fact cause a beneficial change in the function of the construct.
Claims 23, 62, 69, 76, 78, 92, 130, and 146-153 are rejected under 35 U.S.C. 103 as being unpatentable over Geall et. al., (US 20190298847 A1, in IDS), Khvorova et al., (US 20200385737 A1), and Hou et. al., (US 20200377887 A1, already of record) as applied to claims 1-2, 19, and 131-145 above, and further in view of Williams (WO 2022056291 A1, already of record) and Souza et. al., (US 20030100526 A1, already of record).
The teaching of Geall, Khvorova, and Hou are incorporated herein by reference to the 103-preceding rejection.
Regarding claims 23, 62, and 129-130 Geall teaches the use of expression vectors, which is comprise expression cassettes, see [0191][0245-0247].
Regarding claims 69 and 78, Geall teaches the polynucleic acid molecules comprising the RNAi may be delivered by a recombinant vector, which may be a viral vector “derived from adeno-associated virus, retrovirus, adenovirus, or alphavirus,” see [0345].
Regarding claim 76, Geall teaches the “polynucleic acid molecule is a single stranded polynucleic acid molecule that mediates RNAi activity in a cell,” see [0180]. Geall further teaches that the expression vector is transferred to a host cell by conventional techniques, see [0245].
Regarding claim 92, Geall further teaches “a pharmaceutical composition comprising: a molecule described above or a polynucleic acid molecule conjugate described above; and a pharmaceutically acceptable excipient,” see [0007].
Regarding claims 69, 76, and 78, Khorvova teaches generating AAV vectors and particles and cells comprising the AAV vector, see claims 38, 40, 42, and [0426-0434].
Regarding claim 23, hou teaches “[n]on-limiting examples of muscle-specific promoters include…mammalian desmin (DES) promoter…,” and “[n]on-limiting examples of skeletal muscle promoters include Desmin,” see [0095].
Regarding claims 62 and 149-153, Hou teaches that filler sequences are viral genome components, which are synonymous with the claimed term “stuffer sequence.” Hou teaches “the viral genome comprises one or more filler sequences in order to have the length of the viral genome be the optimal size for packaging,” and that “ in order to have the length of the viral genome be about 4.6 kb.,” see [0178]. Hou further teaches “the viral genome comprises two filler sequences, and the first filler sequence is located 3′ to the 5′ ITR sequence and the second filler sequence is located 3′ to the polyadenylation signal sequence,” see [0183]; “the filler sequence is located 5′ to the 3′ ITR sequence,” see [0184]; and “a filler sequence may be located between two regions, such as …the polyadenylation signal sequence region and the 3′ ITR,” see [0196]. Hou further teaches that “ the vectors with a 5′ or 3′ filler sequence vectors presented the highest titers,” see [0665]. Hou further teaches SEQ ID NOs: 45, 62, and 64, which are defined as respectively: (45) construct HT106 ITR to ITR sequence (see [0351]); (62) Filler002 (see [0357]); and (64) Filler004 (see [0357]). Each of these three sequences align to SEQ ID NO: 18 of the instant case with 92.4% identity score, thereby salifying the claimed “with about 90% identity to the sequence of SEQ ID NO: 18” optional limitation. Hou further teaches SEQ ID NOs: 45, 49, 62, and 66, which are defined as respectively: (45) construct HT106 ITR to ITR sequence (see [0351]); (49) construct HT110 ITR to ITR sequence (see [0351]); (62) Filler002 (see [0357]); and (65) Filler005 (see [0357]). Each of these four sequences align to SEQ ID NO: 19 of the instant case with 96.7% identity score, thereby satisfying the claimed “with about 90% identity to the sequence of SEQ ID NO: 19” optional limitation. Furthermore, Hou teaches SEQ ID NOs: 46 and 63, which are defined as respectively: (46) construct HT107 ITR to ITR sequence (see [0351]) and (63) Filler003 (see [0357]). Each of these two sequences align to SEQ ID NO: 19 of the instant case with 95.5% identity score, thereby salifying the claimed “with about 90% identity to the sequence of SEQ ID NO: 19” optional limitation. Hou teaches “the AAV particle viral genome comprises at least one filler sequence region,” see [0360].
Regarding claims 69 and 78, Hou teaches gene therapy tools for Huntington’s disease using adeno-associated virus (AAV) particles to deliver RNA molecules that silence the huntingtin (HTT) gene, see entire claim set. In particle Hou teaches using rAAV particles comprising an AAV capsid comprising an amino acid sequence with about 90% identity to a wildtype AAVrh74 capsid, see claim 10. Hou further teaches administering the rAAV particles at a dose of about 1 x 108 to about 2 x 1013 genome copies/mL and/or a dose of about 1 x 108 to about 2 x 1014 genome copies/kg of body weight, see [0528]-[0531]. Hou further teaches that the “…modulatory polynucleotides encoding the RNAi molecules may be inserted into recombinant AAV vectors,” see [0003]. Hou further teaches “the AAV particles…comprise a viral genome with at least one ITR region and a payload region,” or that “the viral genome has two ITRs,” wherein “these two ITRs flank the payload region at the 5′ and 3′ ends,” see [0081]. Hou further teaches that “the AAV serotype may be, but is not limited to” AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, etc., see [0058]. Hou further teaches self-complementary AAV viral genomes (scAAVs)…contain DNA strands which anneal together to form double stranded DNA.,” and “by skipping second strand synthesis, scAAVs allow for rapid expression in the cell,” see [0051].
Regarding claim 76, Hou teaches “[a] target cell transduced with a viral particle comprising a modulatory polynucleotide may express the encoded sense and/or antisense sequences in a single cell,” see [0347].
Regarding claim 92, Hou teaches compositions comprising the AAV particles housing the RNAi transgene, see claim 11.
Geall, Khvorova, and Hou, do not teach: a) that the desmin promoter comprises two enhancers; b) that the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence with at least about 90% identity to the sequence of SEQ ID NO:21 and/or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO:22 or a nucleotide sequence with at least about 90% identity to the sequence of SEQ ID NO:22; and c) that the desmin promoter comprises the nucleotide sequence of SEQ ID NO:12 or a sequence with at least about 90% identity to the nucleotide sequence of SEQ ID NO:12.
Williams teaches expression cassettes comprising “novel combinations of muscle-specific enhancers and promoters useful for achieving high and persistent expression in muscle tissue or myocytes,” see abstract. Williams further teaches “combining desmin muscle-specific promoters and desmin muscle-specific enhancers and MCK muscle-specific enhancers to provide hybrid promoters that drive transgene expression in muscle cells and tissues,” and that “the resulting hybrid promoters are useful for muscle cell and gene therapy,” see [0012]. Williams further teaches “a mammalian desmin promoter, a mammalian desmin enhancer, and one or more mammalian muscle creatine kinase (MCK) enhancers that are operably linked,” see [0013] and as in claim 1. Williams further teaches that “the mammalian desmin promoter is human, the mammalian desmin promoter can include a nucleic acid sequence having 80% or more identity to any of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10,” see claims 1-4 and [0066].
Williams further teaches “the mammalian desmin enhancer comprises a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 6,” see claims 9-10, which aligns with a 100% identity score to claimed SEQ ID NO: 22 of the instant case. Williams further teaches SEQ ID NO: 50, as the “Human Desmin Enhancer (hdesmin (-1008 to -558) enhancer),” which comprises the claimed SEQ ID NO: 21 with a 99.6% identity score (see Table 2 [0120] and sequence search results attached to the file wrapper). Wilson further teaches that “it should also be understood that there can be multiple mammalian desmin enhancers and that any combination of the mammalian desmin enhancer(s)…can be made in terms of the order of the elements,” see [0098], and that the Desmin enhancers can be 5’ to the Desmin promoter, see [0134]. Thus, when assembling the Desmin enhancer elements defined as SEQ ID NOs: 50 and 6 with the Desmin promoter element defined by SEQ ID NO: 9 taught by Williams, in the following order, SEQ ID NO: 50, SEQ ID NO: 6, and SEQ ID NO: 9, a Desmin enhancer/promoter sequence is assembled with a 97.4% identity score to claimed SEQ ID NO: 12 in the instant case, which meets the about 90% identity requirement claimed. See sequence alignment below:
PNG
media_image9.png
881
424
media_image9.png
Greyscale
Williams further teaches that “the various muscle-specific hybrid promoters … may be used for muscle-specific transgene expression in cultured cells or tissues from, by way of example but not limitation, episomal or integrated plasmid, Nanoplasmid, minicircle, Doggybone, MIDGE, adenoviral, adeno-associated viral (AAV), retroviral, and lentiviral vectors, see [0012][0101][0126].
Souza teaches “a regulatory element comprises at least two desmin (DES) enhancers linked to a DES promoter,” see [0014]. Souza further teaches “A 280-bp enhancer located between nt −973 and −693 of the human sequence contains several sequences homologous to other muscle-specific enhancers. Unlike other muscle-specific enhancers, the desmin (DES) enhancer can function in myoblasts as well as myotubes. The DES enhancer contains two different regions, one is active in differentiated myotubes, between nt −973 and −848, the other is active in undifferentiated myoblasts, between nt −847 and −693. Deletion of the region between nt −1738 and −693 results in a more than 20-fold decrease in expression of a linked CAT gene in differentiated muscle cells and 8-fold decrease in undifferentiated myoblasts. This 280-bp enhancer is independent of orientation, position, and distance, and can activate either the desmin promoter or heterologous promoters, such as HSV tk and human vimentin, at about 14- to 50-fold in C2.7 myotubes, and 9- to 16-fold in C2.7 myoblasts,” see [0040]. Souza further teaches “the sequence of human muscle-specific 243 bp DES enhancer (-973 to −731) is provided in SEQ ID NO:21,” see [0041] and claim 9.
Souza further teaches that “a regulatory element comprises at least two DES enhancers linked to a DES promoter” see [0014], and that a regulatory element/sequence is defined as “promoters, enhancers, and other expression control elements, or any combination of such elements,” see [0028].
Souza further teaches that “a human desmin (DES) promoter was obtained by cloning of the 5′ flanking region from nt −2194 to +1 into pCR-Blunt II-TOPO” see [0038], and that “the sequence of the truncated DES promoter is provided in SEQ ID NO:19,” see [0039].
Souza further teaches that the regulatory elements may be “ incorporated into a viral vector such as one derived from adenoviruses, adeno-associated viruses (AAV), or retroviruses, including lentiviruses such as the human immunodeficiency (HIV) virus,” which are useful for “ transfecting muscle tissue,” see [0015]. Souza further teaches “a transfected host cell comprising the vector,” see claims 27-30.
It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to create an expression cassette wherein the modified RNAi of Geall according to the teaching of Khvorova is operably linked to the desmin enhancer(s)/promoter(s) taught by Williams, as further supported by Souza.
Geall teaches RNAi molecules targeting DMPK for modulation of myotonic dystrophy but does not specify a particular promoter and enhancer elements for expression, rather Geall uses antibody conjugate for targeting. Williams teaches muscle-specific regulatory nucleic acid sequences comprising a mammalian/human desmin promoter and desmin enhancer elements operably linked to drive transgene expression in muscle cells. Williams further teaches that combinations of desmin enhancer elements may be used and arranged in various configurations. Souza teaches that regulatory elements comprising at least two desmin enhancers linked to a desmin promoter provide robust transcriptional activation in muscle cells/tissue, and that the desmin enhancer contains two different functional regions active in either differentiated myotubes or undifferentiated myoblasts.
A PHOSITA would have been motivated to place the RNAi of Geall under transcriptional control of the desmin enhancer/promoter combinations of Williams and Souza in order to achieve muscle-specific expression of the RNAi construct. The combination merely involves linking a known RNAi payload to a known muscle-specific regulatory element for expression in muscle cells/tissue, representing the predictable use of prior art elements according to their established functions. A PHOSITA would have had a reasonable expectation of success because the references teach modular expression constructs in which promoters and enhancers are operably linked to heterologous nucleic acids sequences, and the desmin regulatory elements of Williams and Souza are explicitly taught to drive expression of downstream transgenes.
Claims 86, 89, 91, and 129 are rejected under 35 U.S.C. 103 as being unpatentable over Geall et. al., (US 20190298847 A1, in IDS), Khvorova et al., (US 20200385737 A1), Hou et. al., (US 20200377887 A1, already of record), Williams (WO 2022056291 A1, already of record), and Souza et. al., (US 20030100526 A1, already of record) as applied to claims 1-2, 19, 23, 62, 69, 76, 78, 92, and 130-153 above, and further in view of O'Riordan (US 20170173183 A1, already of record), Yao (US 20200172928 A1, already of record), Loiler (WO 2020047472 A1, already of record) and Wahbi et. al., (Trends Cardiovasc Med. 2020 May; 30(4):232-238, already of record).
The teachings of Geall, Khvorova, Hou, Williams, and Souza are incorporated herein by reference to the two 103 rejections above.
It is noted that, in the instant specification, the DMPK204 guide sequence is defined by a polynucleotide sequence of SEQ ID NO: 4 and a DMPK204 passenger sequence is defined by a polynucleotide sequence of SEQ ID NO: 5.
The teachings of Geall, Khvorova, and Hou regarding the DMPK guide and passenger sequences and scaffolds are incorporated herein by refence to the respective 103 rejection above. SEQ ID NOs: 4 and 5 of the instant application are identical nucleic acid sequences to SEQ ID NOs 1 and 2, respectively, of the instant application, the difference being mere presentation as either the DNA form (SEQ ID NOs: 4 and 5) vs the transcribed RNA form (SEQ ID NOs: 1 and 2).
Regarding claims 86, 89, and 129, Hou teaches using promoters, enhancers, introns, and polyA signals to improve expression. Hou teaches “the nucleic acid sequence comprising the payload region may comprise one or more of a promoter region, an intron, a Kozak sequence, an enhancer or a polyadenylation sequence,” see [0039][0067-0069]. Hou further teaches “elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns,” see [0086]. Hou further teaches “the viral genome comprises an enhancer element, a promoter and/or a 5′UTR intron,” see [0121]. Hou further teaches “the payload region comprises at least one element to enhance the expression such as one or more introns or portions thereof,” see [0166]. Hou further teaches the use of introns such as MVM (67-97 bps), FIX truncated intron 1 (300 bps), 0-globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps),” see [0166], or “others known in the art,” see [0179]. Hou also teaches the use of “a chimeric intron,” see [0174]. Hou further teaches the use of an “SV40…a human beta globin intron in an expression vector,” or “or others known in the art,” see [0161 and 0175].
Further regarding claims 86, 89, and 129, Hou teaches an AAV viral genome comprising, in general 5’ to 3’ arrangement, “a) a 5’ inverted terminal repeat (ITR) sequence region…; b) an enhancer sequence region…; c) a promoter sequence region…; d) a modulatory polynucleotide sequence region…; e) a polyadenylation (polyA) signal sequence region…; and f) a 3’ ITR sequence region,” see claim 1. O’Riordan independently teaches the same general skeleton with additional resolution as to filler placement and intron embedding, teaching a construct comprising, 5’ to 3’, “an AAV ITR, a stuffer fragment…, an RK promoter, a chimeric intron…, a human rhodopsin, a β-globin intron, a miR-708 embedded in a β-globin intron, a bovine growth hormone polyadenylation sequence, a stuffer fragment, and an AAV ITR,” see [0121].
Neither Geall, Khvorova, Hou, Williams, or Souza independently teach: a) the expression cassette housing the DMPK targeting RNAi having a nucleotide sequence of SEQ ID NO: 17 or a sequence with at least about 90% identity to sequence of SEQ ID NO: 17; b) each and every element in specific the order as recited in claims 86 and 89, or c) the AAVrh74 W505R capsid and its corresponding SEQ ID NO: 52.
O'Riordan teaches embedding nucleic acid sequences encoding miRNA constructs “in an intron,” see claim 24. O'Riordan further teaches miRNA “sequence embedded in the beta globin intron,” such that there is a 5’ arm of the beta globin intron located 5’ to the miR-708 transgene and a 3’ arm of the beta globin intron located 3’ to the miR-708 transgene, see [0184] and FIG. 23A. O'Riordan further teaches that “FIG. 24 shows the evaluation of candidate vectors harboring the miR-708 sequence, either in the miR-155 or the miR-708 scaffold (embedded in the beta-globin intron),” see [0059]. O'Riordan further teaches that such vectors comprising miRNA embedded in the beta globin intron “resulted in…expression in human cells in vivo, as compared to vectors driving expression of a control miR from either the opsin or the rhodopsin kinase promoter (Ops miR-Cont and RK miR-Cont, respectively),” and that “these results demonstrate the successful validation of several vectors that may be used for suppression/replacement strategies (such as those described above) in human cells,” see [0185].
O'Riordan teaches rAAV vectors wherein “the AAV vector comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITR,” see [0014]. O'Riordan further teaches and claims the AAV ITRs are AAV2 ITRs, see [0015] and claims 46 and 49-50. O'Riordan further teaches “self-Complementary AAV Viral Genomes,” see [0123].
O'Riordan teaches rAAV vectors with two stuffer sequences, one positioned 3’ to the 5’ ITR and the other positioned 3’ to the BGH PolyA and 5’ to the 3’ ATR. For example, O'Riordan teaches “the nucleic acid in the AAV comprises 5′ to 3′ nucleic acid encoding the following: an AAV ITR, a stuffer fragment (e.g., SEQ ID NO:11), an RK promoter, a chimeric intron (e.g., SEQ ID NO:10), a human rhodopsin, a β-globin intron, a miR-708 embedded in a β-globin intron, a bovine growth hormone polyadenylation sequence, a stuffer fragment, and an AAV ITR,” see [0121].
Thus, regarding the ordered arrangement of claims 86 and 89, both Hou and O’Riordan, independently, teach that a functional rAAV vector genome is conventionally assembled in the order: 5’ ITR → stuffer/filler sequence → enhancer/promoter → intron (optionally with an embedded modulatory polynucleotide/miRNA scaffold flanked by intron arms) → polyadenylation signal → stuffer/filler sequence → 3’ ITR.
Yao teaches the “beta-globin intron (SEQ ID NO: 10),” see [0099], which aligns to the rabbit β-globin intron sequences, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15, of the instant case, with 89.3%, 89.5% and 100% identity score, respectively.
Loiler teaches “Non- limiting examples of recombinant AAV backbones to create the vector include AAV vector serotypes from the group of AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV PHP.B, or AAV rh74. In a further aspect, the vector backbone is an AAV9 serotype, an AAVrh74 serotype, or a modified AAVrh74 serotype. Also provided is a polynucleotide encoding a modified AAVrh74 VP1 capsid protein comprising one or more modifications selected from the group of a substitution of isoleucine for asparagine at amino acid position 502, and an optional substitution of tryptophan to arginine at amino acid 505 of the VP1 of AAVrh74…” see [0008].
Loiler teaches that “one of the mutants (AAVmut4, asparagine to lsoleucine at amino acid 502 of VP1 capsid) increases gene delivery globally to all tissues tested up to 56-fold (between 3 and 56-fold increase depending on tissue) higher transduction efficiency,” see [0135][0137]. Loiler further teaches “AAV rh74 Consensus Sequence Alignment vs. AAVrh74 vs. AAVrh74-N502I-capsid vs. Rh74 YIG591 cap protein,” see “AAV rh74 Consensus Sequence Alignment” pages 55-56. Loiler further teaches SEQ ID NO: 11, which when aligning SEQ ID NO:50 of the instant case to SEQ ID NO: 11 of Loiter, there is 100% homology. See pages 55-56, [0135][0137], and sequence search results attached to the file wrapper.
Loiler teaches that “another mutant (AAVmut5, tryptophan to arginine at amino acid 505 of VP1 capsid) increases gene delivery to the heart almost 50-fold over AAVrh74,” see [0135]. Loiler teaches “AAV rh74 Consensus Sequence Alignment vs. AAVrh74 vs. AAVrh74-N502I-capsid vs. Rh74 YIG591 cap protein” see paged 55-56. When comparing SEQ ID NO:52 to the alignment of wild-type AAVrh74 taught by Loiter, there is a single amino acid difference, tryptophan to arginine substitution at position 505, which Loiler explicitly teaches as another mutant that exemplified enhanced gene delivery to the heart. SEQ ID NO: 52 is arrived at with 100% identity by applying the tryptophan to arginine substitution to the wild-type AAVrh74. See pages 55-56 and [0135][1037]. Loiler teaches that “the sequence of the AAV rh.74 genome is provided in U.S. Patent 9,434,928…” [0086].
Wahbi teaches “patients with myotonic dystrophy, the most common neuromuscular dystrophy in adults, have a high prevalence of arrhythmic complications with increased cardiovascular mortality and high risk for sudden death,” see abstract.
It would have been obvious to a person having ordinary skill in the art (PHOSITA) to further modify the DMPK-silencing expression cassette of Geall in view of Khvorova, Hou, Williams and Souza to include a 5′ and 3′ portion of a rabbit β-globin intron, and a BGH polyadenylation signal as taught by Hou, O’Riordan, and Yao, thereby arriving at a sequence having at least about 90% identity to SEQ ID NO: 17.
Hou teaches miR-155 scaffolded RNAi constructs comprising a 5′ scaffold sequence, a guide strand, a loop sequence, a passenger strand, and a 3′ scaffold sequence, and further teaches that these elements may be modified while maintaining function. O’Riordan teaches embedding miRNA constructs within a beta-globin intron, thereby generating a 5′ intron arm upstream of the embedded miRNA and a 3′ intron arm downstream of the embedded miRNA. Yao teaches the rabbit β-globin intron sequence, which aligns with the claimed 5′ and 3′ arms of the rabbit β-globin intron with 89.5% and 100% identity, respectively. Accordingly, embedding the miR-155 scaffolded DMPK-targeting RNAi of Geall modified according to Khvorova’s RNAi asymmetric architecture within the rabbit β-globin intron taught by Yao, as taught by O’Riordan, results in a construct comprising a 5′ rabbit β-globin intron arm, the miR-155 scaffolded RNAi sequence, and a 3′ rabbit β-globin intron arm, driven by a desmin promoter with desmin enhancers and terminated by a BGH PolyA signal as recited. Specifically, Williams and Souza teach the desmin promoter/enhancer regulatory elements, Hou teaches the miR-155 scaffold and loop sequence portions, Geall and Khvorova teaches the DMPK-targeting guide and passenger sequence, Yao teaches the rabbit β-globin intron arms, and Hou further teaches the BGH polyadenylation signal. These elements collectively account for approximately 1,755 nucleotides of the 1,913 nucleotide SEQ ID NO: 17, corresponding to approximately 91.7% sequence identity. Because the claimed SEQ ID NO: 17 represents an assembly of known functional elements taught in the prior art, and it is largely in the identical configuration of rAAV miRNA vectors taught by O’Riordan, a PHOSITA would have found it obvious to combine these elements in the configuration of SEQ ID NO: 17 with a reasonable expectation of success.
It would have further been obvious to modify the expression cassette to include SERPINA1 stuffer sequences and recombinant AAV architecture elements (i.e., ITRs and Capsids) for rAAV vector and rAAV particle generation because such elements were well-known interchangeable components routinely used in rAAV vector design. Hou teaches the use of filler/stuffer sequences to increase vector genome size toward optimal AAV packaging capacity and to improve production of stable, high-titer rAAV particles. O’Riordan further teaches rAAV constructs comprising 5′ and 3′ stuffer sequences flanking an expression cassette, and ITR sequences capping off both the 5’ and 3’ ends of the vector, thereby teaching the claimed arrangement. It would have further been obvious to package the resulting rAAV vector into rAAV particles, and include the rAAV particles in a pharmaceutical composition because Hou and O’Riordan both teach compositions comprising rAAV particles packaged with rAAV vectors encoding RNAi constructs.
A PHOSITA would have been motivated to use the miR-155 scaffold and loop/linker sequence taught by Hou and O’Riordan because such scaffolds were taught to promote efficient Drosha/Dicer processing and reliable liberation of the guide strand for target transcript silencing. A PHOSITA would have further been motivated to incorporate the rabbit β-globin intron and BGH PolyA signal into the expression cassette design because such regulatory elements were conventionally included in rAAV expression cassettes to enhance transcript processing and expression efficiency. Furthermore, regarding the rabbit β-globin intron, a PHOSITA would have been motivated to embed the miR155 scaffold comprising the miRNA within the rabbit β-globin intron, generating a 5’ arm and 3’ arm, in order to ensure robust expression in human cells as demonstrated by O’Riordan. A PHOSITA would have further been be motivated to include the SERPINA1 (A1AT) stuffer taught by Hou to increase the vector genome size toward the optimal packaging capacity for rAAV vectors, as Hou teaches that such filler sequences are used to increase vector genome size and improve production of stable, high-titer rAAV particles. A PHOSITA would have further been motivated to utilize the self-complementary (scAAV) format taught by Hou and O'Riordan to bypass the rate-limiting step of second-strand synthesis and thereby achieve more rapid transgene expression.
A PHOSITA would have had a reasonable expectation of success because rAAV vectors are assembled using modular, functionally independent components, including AAV ITRs, stuffer sequences, miRNA scaffolds, introns, and polyadenylation signals, which were known to function predictably when combined with different RNAi payloads. Because Hou, O’Riordan, and Yao demonstrate successful use of these same elements in AAV-mediated RNAi constructs, a PHOSITA would have expected similar structural and functional results when applying these known components to the DMPK-targeting system of Geall in view of Williams and Souza. A PHOSITA would therefore have had a reasonable expectation of success in generating the claimed rAAV vector and a composition comprising rAAV particles packaged with the DMPK-targeting RNAi construct.
It would have further been obvious to a person of ordinary skill in the art before the effective filing date to generate an rAAV particle comprising an rAAV vector with the combined elements and in the recited order of claims 86 and 89, which is consistent with the art-recognized skeleton taught by Hou and O’Roirdan. Mapping the specific elements taught by the combined references onto this art-recognized skeleton: Williams teaches the Byrne and Paulin desmin enhancer elements positioned 5’ to the desmin promoter, see [0098], [0134] (applied above to claims 44-45); O’Riordan and Yao together teach a 5’ arm and 3’ arm of a rabbit β-globin intron flanking an embedded miRNA construct, see O’Riordan [0184], FIG. 23A and Yao [0099] (applied above to claims 49, 53); Hou and O’Riordan together teach a 5’ and 3’ miR-155 scaffold sequence flanking a guide-loop-passenger miRNA cassette, see Hou [0209], [0211], [0342] and O’Riordan [0038], [0058], [0118] (applied above to claim 12); Geall teaches the DMPK204 guide sequence and, as modified per Khvorova’s bulge and wobble teachings, the DMPK204 passenger sequence (applied above to claims 1, 2, and 10); Hou teaches the miR-155 loop sequence (SEQ ID NO:17, aligning to claimed SEQ ID NO:3 with 100% identity) positioned between the guide and passenger sequences, see [0307] (applied above to claim 2); Hou further teaches a BGH polyadenylation sequence (SEQ ID NO:67, aligning to claimed SEQ ID NO:16 with 100% identity) positioned 3’ to the modulatory polynucleotide region, see claim 1; and Hou further teaches 5’ and 3’ filler/stuffer sequences flanking the expression cassette and positioned adjacent to the ITRs, see [0178], [0183]-[0184], [0196] (applied above to claim 63). Assembling each of these individually-taught elements into the single conventional vector skeleton taught by both Hou and O’Riordan, in the specific 5’ to 3’ positions each reference assigns to its corresponding element type, results in the identical ordered arrangement recited in claims 86 and 89: AAV2 ITR, SerpinA1 stuffer, Byrne desmin enhancer, Paulin desmin enhancer, desmin promoter, 5’ arm of rabbit β-globin intron, 5’ miR155 scaffold, DMPK204 guide, miR155 loop, DMPK204 passenger, 3’ miR155 scaffold, 3’ arm of rabbit β-globin intron, BGH polyA, SerpinA1 stuffer, and AAV2 ITR. A PHOSITA would have been motivated to do so in order to optimize the rAAV vector packaging and efficiency for the target tissue. A PHOSITA would have been motivated to do so because each element’s function was known and previously employed and the combination of the elements would merely represent combining known elements according to their known functions with a reasonable expectation that they would retain their known function when combined together.
It would have further been obvious to a person of ordinary skill in the art before the effective filing date to modify the rAAV particle comprising the DMPK-targeting expression cassette of Geall in view of Williams, Khvorova, Hou, O'Riordan, and Yao to utilize a modified AAVrh74 capsid comprising the W505R substitution, as taught by Loiler, including capsids corresponding to S SEQ ID NO: 52. One of ordinary skill in the art would have been motivated because Loiler explicitly teaches that substitution of tryptophan to arginine at position 505 increases gene delivery to the heart by nearly 50-fold, thereby identifying this mutation as advantageous capsid modifications for enhancing in vivo transduction efficiency, particularly in muscle and cardiac tissues relevant to treatment of DMPK-associated myotonic dystrophy as further supported by Wahbi describing the cardiac involvement in DM1. One would have had a reasonable expectation of success because Loiler demonstrates successful generation and functional use of these specific AAVrh74 mutant capsids and teaches that such modified capsids can be used with conventional rAAV vector genomes, and Hou and O'Riordan teach that rAAV genomes may be packaged into a variety of interchangeable AAV capsid serotypes, indicating that substitution of one known functional capsid variant for another would have predictably resulted in an rAAV particle capable of delivering the DMPK-targeting expression cassette.
Regarding applicant arguments concerning Claim Rejections under 35 USC § 103:
Applicant’s arguments with respect to claims [1, 2, 19, 23, and 76], [62, 69, 78, 92, and 124-130], and [86, 88, 89, and 92] have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim 154 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 74 of copending Application No. 18/626,784 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because they both claim the same SEQ ID NO: 20, in the same contect of an rAAV vector, the only difference is that the instant claim 154 transgene is specifically the DMPK targeting RNAi transgene species, whereas the reference application is broader claiming the transgene genus.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowed.
SEQ ID NO: 20 is free of the prior art.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to COREY LANE BRETZ whose telephone number is (571)272-7299. The examiner can normally be reached M-F 7:30am - 6:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/COREY LANE BRETZ/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights