Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Applicant's election without traverse of Group I, nucleotides 619-640 of SEQ ID No. 1 and duplexes AD-67629, AD-67638, and AD-67648 corresponding to SEQ ID NOs. 46 and 47 (unmodified) in the reply filed on 07/18/2025 is acknowledged.
Applicants reference to duplexes AD-67629, AD-67638, and AD-67648 is unclear because the amended claims filed 07/18/2025 have lined thru limitations referencing duplexes such as AD-67629, AD-67638, and AD-67648. The Examiner will examine the claims as filed on 07/18/2025 that do not have a reference to AD-67629, AD-67638, and AD-67648.
Status of the Application
Claims 1-3, 5, 8, 14, 16-20, 43, 45, 78, 79, 88, 92 and 107-109 are pending. Claims 1-3, 5, 8, 14, 16-20, 43, 45, 78, 79 and 107-109 are currently under examination. Claims 88 and 92 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Information Disclosure Statement
The submission of the Information Disclosure Statements on 10/23/2024 and 07/18/2025 is in compliance with 37 CFR 1.97. The information disclosure statements have been considered by the examiner and signed copies have been placed in the file.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 5, 8, 14-20, 43, 45, 78 and 79 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US Patent No. 8,507,663 (hereinafter Patent ‘663).
Patent ‘663 teach a dsRNAi for inhibiting the expression of a CD274/PD-L1 gene wherein the dsRNAi comprises at least 19 nucleotides targeted to nucleotides 619-640 of SEQ ID No. 1
Query Match 86.4%; Score 19; Length 19;
Score over Length 100.0%;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ 1 3 ACATTTGGAGGAGACGTAA 21
SEQ 452 19 ACATTTGGAGGAGACGTAA 1
TGTAAACCTCCTCTGGATT
Patent ‘663 further teach the dsRNAi can comprise modifications such as modified backbones or substituted sugar moieties or phosphorothioate linkages (col. 3, 22, 23) and teach pharmaceutical compositions and an isolated cell comprising the dsRNAi (col. 4-5) and teach the dsRNAi can be fully modified (col. 13). This meets the limitations of claims 1, 5, 8, 14, 43, 78, 79.
Patent ‘663 teach the dsRNAi can comprise nucleotide overhang on the 3’ end (col. 13-14) and teach ligands such as GalNAc structures attached via branched linkers (col. 25, 31, 32) and teach conjugation can be at the 3’ end. This meets the limitations of claims 16-20 and 45.
Thus Patent ‘663 anticipates the claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2, 3 and 107 is/are rejected under 35 U.S.C. 103 as being unpatentable over US Patent No. 8,507,663 (hereinafter Patent ‘663) and Allerson, et al. ("Fully 2 ‘-modified oligonucleotide duplexes with improved in vitro potency and stability compared to unmodified small interfering RNA." Journal of medicinal chemistry 48.4 (2005): 901-904).
Patent ‘663 further teach a dsRNA comprising at least 15 nucleotides (SEQ ID No. 772) of SEQ ID No. 47 that is targeted within nucleotides 619-640 of PD-L1 gene having SEQ ID No. 1.
Query Match 84.3%; Score 19.4; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 6; Mismatches 1; Indels 0; Gaps 0;
SEQ 47 3 ACGTCTCCTCCAAATGTGTAT 23
SEQ 772 1 ACGUCUCCUCCAAAUGUGUTT 21
Patent ‘663 teach the dsRNA can comprise modifications such as modified backbones or substituted sugar moieties or phosphorothioate linkages (col. 3, 22, 23) and teach ligands such as GalNAc (col.25). Patent ‘663 does not teach the dsRNA is fully modified on each strand.
Allerson et al. teach dsRNA consisting entirely of modified nucleotides displayed enhanced stability and increased vitro potency (see abstract, pages 902-903 and Fig. 1 and 2). It would have been obvious to one of ordinary skill in the art to fully modify the dsRNA in Patent ‘663 to enhance stability and increase potency. One of skill in the art would have been motivated to combine the teachings of each improve the dsRNA’s stability and function with predictable results. “The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” See KSR v. Teleflex, 550 U.S. 398, 127 S. Ct. 1727 (2007).
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 2, 3 and 107-109 is/are rejected under 35 U.S.C. 103 as being unpatentable over US Patent No. 9,181,525 (hereinafter Patent ‘525) and Allerson, et al. ("Fully 2 ‘-modified oligonucleotide duplexes with improved in vitro potency and stability compared to unmodified small interfering RNA." Journal of medicinal chemistry 48.4 (2005): 901-904).
Patent ‘525 teach a dsRNA comprising all 23 nucleotides (SEQ ID No. 19) of SEQ ID No. 47 that is targeted to the PD-L1 gene. Only one strand is shown in the alignment below but the complementary strand of SEQ ID No. 46 is taught because it is a dsRNA consisting of a sense and antisense strand.
Query Match 100.0%; Score 23; Length 25;
Best Local Similarity 60.9%;
Matches 14; Conservative 9; Mismatches 0; Indels 0; Gaps 0;
SEQ 47 1 TTACGTCTCCTCCAAATGTGTAT 23
SEQ 19 1 UUACGUCUCCUCCAAAUGUGUAU 23
Patent ‘525 teach the dsRNA can comprise a ligand (see col. 8 lines 35-39) however does not teach the dsRNA is fully modified. Allerson et al. teach dsRNA consisting entirely of modified nucleotides displayed enhanced stability and increased vitro potency (see abstract, pages 902-903 and Fig. 1 and 2). It would have been obvious to one of ordinary skill in the art to fully modify the dsRNA in Patent ‘663 to enhance stability and increase potency. One of skill in the art would have been motivated to combine the teachings of each improve the dsRNA’s stability and function with predictable results. “The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” See KSR v. Teleflex, 550 U.S. 398, 127 S. Ct. 1727 (2007).
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1-3, 5, 8, 14, 16-20, 43, 45, 78, 79 and 107-109 are rejected under the judicially created doctrine of obviousness-type double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 10,982,215 (Patent ‘215). Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter
Claims of Patent ‘215 are drawn to a single stranded antisense oligonucleotide targeted to SEQ ID No. 1 of PD-L1, wherein the oligonucleotide is modified, comprises a ligand such as GalNAc and methods of inhibiting expression of PD-L1.
The instant claims are drawn to a dsRNA targeted to SEQ ID No. 1 of PD-L1, wherein the dsRNA is modified, comprises a ligand such as GalNAc. The prior art teach ASO and siRNA are functionally equivalent. Miyagishi et al. (Antisense and Nucleic Acid Drug Development, 2003, 13:1-7) teach that ASO and siRNAs can be designed to be targeted to the same target sites with a reasonable expectation to observe reduced target expression levels with both molecules (see siRNAs and antisense ASOs targeted to target sites 3, 4, 5, and 6 in Figure 1, wherein the ASO comprise all first 19 nucleotides of the antisense strand sequence of the siRNAs). Miyagishi et al. observed that “both an siRNA and ASO were most effective when directed against site 4.” See page 6. Vickers et al. (The Journal of Biological Chemistry, 2003, 278:7108-7118) teach, consistent with Miyagishi et al., that target sites between ASO and siRNAs are shared with reasonable correlation. See the entire reference. Lastly Dean et al. (Oncogene, 2003, 22:9087-9096) corroborate the teachings of the Vickers et al. reference by stating that “As an example in comparing RNase H-dependent oligonucleotides to siRNA oligonucleotides, we found that they exhibited similar potency, duration of action, target selectivity and efficiency (Vickers et al., 2003).” See page 9089, right column. Dean et al. also teach that one can incorporate LNAs into antisense oligonucleotides for increased target binding affinity and nuclease resistance. See page 9090.
It would have been obvious to one of ordinary skill in the art at the time the invention was made to substitute the siRNA of Patent ‘215 with the ASO of the instant claims to target the PD-L1 because making both ASO compounds and siRNAs targeted to the same target sites of a gene was a known methodology in the art as taught by Miyagishi et al., Vickers et al., and Dean et al., and because substituting art-recognized equivalents known for the same purpose is a well-established rationale in support of an obviousness rejection. See MPEP 2144.06.
It would have further been obvious to use the dsRNA of the instant claims in methods of Patent ‘215. The Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001 at page 1008 (March 2008), indicated that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application. Thus, the co-pending product could be used in the method of the instant claims.
Claims 1, 3, 5, 8, 14, 16-20, 43, 45, 78, 79 and 107-109 are provisionally rejected under the judicially created doctrine of double patenting over claims 1, 2, 7-9, 17, 18, 22, 23, 25-28, 44-48, 54, 57 and 61of copending Application No. 18,202,328 (App ‘328). This is a provisional double patenting rejection since the conflicting claims have not yet been patented. Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter.
Claims of Application ‘328 are drawn to a single stranded antisense oligonucleotide targeted to SEQ ID No. 1 of PD-L1, wherein the oligonucleotide is modified, comprises a ligand such as GalNAc and methods of inhibiting expression of PD-L1.
The instant claims are drawn to a dsRNA targeted to SEQ ID No. 1 of PD-L1, wherein the dsRNA is modified, comprises a ligand such as GalNAc. The prior art teach ASO and siRNA are functionally equivalent. Miyagishi et al. (Antisense and Nucleic Acid Drug Development, 2003, 13:1-7) teach that ASO and siRNAs can be designed to be targeted to the same target sites with a reasonable expectation to observe reduced target expression levels with both molecules (see siRNAs and antisense ASOs targeted to target sites 3, 4, 5, and 6 in Figure 1, wherein the ASO comprise all first 19 nucleotides of the antisense strand sequence of the siRNAs). Miyagishi et al. observed that “both an siRNA and ASO were most effective when directed against site 4.” See page 6. Vickers et al. (The Journal of Biological Chemistry, 2003, 278:7108-7118) teach, consistent with Miyagishi et al., that target sites between ASO and siRNAs are shared with reasonable correlation. See the entire reference. Lastly Dean et al. (Oncogene, 2003, 22:9087-9096) corroborate the teachings of the Vickers et al. reference by stating that “As an example in comparing RNase H-dependent oligonucleotides to siRNA oligonucleotides, we found that they exhibited similar potency, duration of action, target selectivity and efficiency (Vickers et al., 2003).” See page 9089, right column. Dean et al. also teach that one can incorporate LNAs into antisense oligonucleotides for increased target binding affinity and nuclease resistance. See page 9090.
It would have been obvious to one of ordinary skill in the art at the time the invention was made to substitute the siRNA of APP ‘328 with the ASO of the instant claims to target the PD-L1 because making both ASO compounds and siRNAs targeted to the same target sites of a gene was a known methodology in the art as taught by Miyagishi et al., Vickers et al., and Dean et al., and because substituting art-recognized equivalents known for the same purpose is a well-established rationale in support of an obviousness rejection. See MPEP 2144.06.
It would have further been obvious to use the dsRNA of the instant claims in methods of Patent ‘215. The Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001 at page 1008 (March 2008), indicated that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application. Thus, the co-pending product could be used in the method of the instant claims.
This is a provisional obviousness-type double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636