Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Application/Amendment/Claims
Applicant's response filed 04/17/2026 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 10/21/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
With entry of the amendment filed on 04/17/2026, claims 2, 5, 8, 14, 17-20, 45, 78, 79, 88, 92 and 110-111 are pending. Claims 88 and 92, previously withdrawn have been rejoined in the interest of compact prosecution. Claims 2, 5, 8, 14, 17-20, 45, 78, 79, 88, 92 and 110-111 are currently under examination.
The 102 and 103 rejections are withdrawn in view of the claim amendments and new 103 rejection herein.
The Double Patenting rejections are withdrawn in view of the claim amendments.
New Claim Rejections - necessitated by claim amendments
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2, 5, 8, 14, 17-20, 45, 78, 79, 88, 92 and 110-111 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 2 recites "wherein the sense strand is 19-21 nucleotides in length and the antisense strand is 19-23 nucleotides in length, wherein the antisense strand comprises the nucleotide sequence 5'-UUACGUCUCCUCCAAAUGUGUAU-3' of SEQ ID NO:47 and the sense strand comprises the nucleotide acid sequence 5'-ACACAUUUGGAGGAGACGUAA-3' of SEQ ID NO: 46". This limitation is indefinite because the claim recites the sense strand is 19-21 nucleotides in length and also comprises SEQ ID No. 46 which is 21 nucleotides in length. It is unclear how the sense strand can be 19 and 20 nucleotides and also comprising SEQ ID No. 246 which is 21 nucleotides in length. The same holds true for the antisense strand because it is unclear how the antisense strand can be 19-22 nucleotides in length and also comprises SEQ ID No. 47 which is 23 nucleotides length.
The claims are interpreted for examination purposes as the dsRNAi comprising 19-21 and 19-23 of SEQ ID Nos. 46 and 47.
Claims 5, 8, 14, 17-20, 45, 78, 79, 88, 92 and 110-111 are rejected as they depend from rejected claim 2.
35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2, 5, 8, 14, 17-20, 45, 78, 79 and 111 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shiku et al. (US Patent No. 9181525 of record 892 10/21/2025), Nawrot et al. (Chemical and Structural Diversity of siRNA Molecules, Current Topics in Medicinal Chemistry, 2006, 913-925), US Patent No. 8,507,663 (hereinafter Patent ‘663) and Allerson, et al. ("Fully 2 ‘-modified oligonucleotide duplexes with improved in vitro potency and stability compared to unmodified small interfering RNA." Journal of medicinal chemistry 48.4 (2005): 901-904 of record 892 10/21/2025).
Regarding claim 2, Shiku et al. teach a dsRNA comprising 21 nucleotides of instant SEQ ID No. 47 and complementary strand SEQ ID No. 46 that is targeted within nucleotides PD-L1 gene (abstract). Shiku et al. teach the siRNA can be ribonucleotides or deoxyribonucleotides (col. 6 ln 42). Shiku et al. does not teach the siRNA with the claimed modifications.
Query Match 100.0%; Score 21; Length 25;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ 47 1 ACACATTTGGAGGAGACGTAA 21
SEQ 3 21 ACACATTTGGAGGAGACGTAA 1
Regarding the limitation in claim 2 of “further comprises 6-8 phosphorothioate internucleotide linkages, Nawrot et al. teach the stability of the PS-siRNA duplexes in serum is very high compare to phosphate and this modification does not interfere with their silencing activity (see page 917 second col.). Nawrot et al. teach a siRNA duplex with 8 phosphorothioate modifications has >95% siRNA activity (see Table 1). One of skill in the art would have been motivated to add 8 phosphorothioate linkages in to the Shiku et al. to increase the stability and silencing activity.
Regarding claims 88 and 92, Shiku et al. teach methods of inhibiting expression of PD-L1 in vivo or ex vivo using the dsRNAi.
Regarding claims 8, 14, 17-20, 45, 78, 79 and 111, Patent ‘663 teach dsRNA can comprise modifications such as modified backbones or substituted sugar moieties or phosphorothioate linkages, overhang regions and pharmaceutical compositions (col. 3, 4, 22, 23) and teach ligands such as GalNAc with phosphate linking groups (col.25, 43, 45 and Formulas col. 49). Pat’663 teach isolated cells comprising a siRNA for ex vivo administration (col 53-54). It would have been obvious to modify the siRNA of Shiku et al. and attach ligands such as GalNAc to enhance stability and delivery.
Regarding claim 5, Allerson et al. teach dsRNA consisting entirely of modified nucleotides displayed enhanced stability and increased vitro potency (see abstract, pages 902-903 and Fig. 1 and 2). It would have been obvious to one of ordinary skill in the art to fully modify the dsRNA in Patent ‘663 to enhance stability and increase potency. One of skill in the art would have been motivated to combine the teachings of each improve the dsRNA’s stability and function with predictable results. “The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” See KSR v. Teleflex, 550 U.S. 398, 127 S. Ct. 1727 (2007).
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Response to Applicant Arguments
The new 103 rejection above cites Allerson et al. for teaching modification of siRNA. Applicant argues Allerson et al. fails to teach or suggest a single dsRNAi that targets PD-L1. In response, Allerson et al. was not relied upon for teaching dsRNAi targeted to PD-L1. One skilled in the art would have understood that Allerson et al. teach known modifications of dsRNAi used to inhibit gene expression and would have been motivated to modify the siRNA of Shiku et al. to enhance to stability and target specificity.
Claims free of the prior art
Claim 110 reciting SEQ ID Nos. 148-153 is free of the prior art. The prior art of Shiku et al. teach siRNA sequences targeted to PD-L1 but do not teach specific target regions of the gene to make a siRNA and not teach or make obvious reasons to modify a siRNA as in the claimed sequences.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a).
706.07(a) Final Rejection, When Proper on Second Action [R-07.2015]
PNG
media_image1.png
18
19
media_image1.png
Greyscale
Second or any subsequent actions on the merits shall be final, except where the examiner introduces a new ground of rejection that is neither necessitated by applicant’s amendment of the claims, nor based on information submitted in an information disclosure statement filed during the period set forth in 37 CFR 1.97(c) with the fee set forth in 37 CFR 1.17(p). Where information is submitted in an information disclosure statement during the period set forth in 37 CFR 1.97(c) with a fee, the examiner may use the information submitted, e.g., a printed publication or evidence of public use, and make the next Office action final whether or not the claims have been amended, provided that no other new ground of rejection which was not necessitated by amendment to the claims is introduced by the examiner. See MPEP § 609.04(b).
Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KIMBERLY CHONG at 571-272-3111. The examiner can normally be reached Monday thru Friday 9-5 pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/Primary Examiner, Art Unit 1636
Prosecution Insights