DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of the following invention:
Group I. Claims 1-21, 25-26, and 28, drawn to an oligonucleotide with a 5'-wing-gap- wing-3' structure comprising at least one modified sugar, wherein the gap comprises one or more 5-methylcytosine, and comprising a modified internucleotidic linkage, in a pharmaceutically acceptable carrier, and one or more diastereomers of the oligonucleotide with respect to chiral linkage phosphorus in the reply filed on 2nd Feb, 2026 is acknowledged.
Claims 29, 32-33, 45, 50-51, 53, and 56, are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 2nd Feb, 2026.
In addition, in the same reply, Applicants elected species SEQ ID NO:1 and SEQ ID NO:116. It is noted that SEQ ID NO: 8 and SEQ ID NO:116 have the same base sequence as SEQ ID NO:1 and Applicants state that claims 1-21, 25-26, and 28 read on the elected species. Therefore, claims 2-16 will be included in the elected species group: claims 1-21, 25-26, and 28.
Therefore, no claims are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 2nd Feb, 2026.
Status of Claims
Claims 1-21, 25-26, and 28 are under consideration.
Priority
This application claims priority to at least provisional application 63/340,365. Therefore, it is entitled to the 10th May 2022 priority date of the parent application.
Specification
The abstract of the disclosure is objected to because:
The abstract is less than 50 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text.
Applicant is reminded of the proper content of an abstract of the disclosure.
A patent abstract is a concise statement of the technical disclosure of the patent and should include that which is new in the art to which the invention pertains. The abstract should not refer to purported merits or speculative applications of the invention and should not compare the invention with the prior art.
If the patent is of a basic nature, the entire technical disclosure may be new in the art, and the abstract should be directed to the entire disclosure. If the patent is in the nature of an improvement in an old apparatus, process, product, or composition, the abstract should include the technical disclosure of the improvement. The abstract should also mention by way of example any preferred modifications or alternatives.
Where applicable, the abstract should include the following: (1) if a machine or apparatus, its organization and operation; (2) if an article, its method of making; (3) if a chemical compound, its identity and use; (4) if a mixture, its ingredients; (5) if a process, the steps.
Extensive mechanical and design details of an apparatus should not be included in the abstract. The abstract should be in narrative form and generally limited to a single paragraph within the range of 50 to 150 words in length.
In the instant case, Applicants begin abstract with, “Among other things”. Such phraseology is not appropriate in an abstract.
See MPEP § 608.01(b) for guidelines for the preparation of patent abstracts.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(u)(1) because C.F.R. 1.84(u)(1) requires that “partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” See MPEP 608.02.
In the instant case:
the partial views for Figure 1, 3, 5, and 7 which appear on several sheets, are preceded by letters instead of the number followed by a capital letter such as FIG. 5A, FIG. 5B, etc. AND
the partial views for Figure 1, 3, 5, and 7, which appears on several sheets, are followed by "Continued" instead of the same number followed by a capital letter such as FIG. 5A, FIG. 5B, etc.; i.e., "Continued" must be deleted.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 21 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 21, claim 21 is indefinite in the recitation of about followed by a range. A range typically indicates a minimum / maximum point; however, the range is controverted by the term “about,” which implies that values above and below the indicated amount are permitted. Therefore, the juxtaposition of these two terms makes it unclear what min / maximum values are encompassed by the claim.
See MPEP 2173.05(b) III.
Claim Interpretation
Attention is directed to MPEP 2111. As stated therein:
During patent examination, the pending claims must be "given their broadest reasonable interpretation consistent with the specification." The Federal Circuit’s en banc decision in Phillips v. AWH Corp., 415 F.3d 1303, 1316, 75 USPQ2d 1321, 1329 (Fed. Cir. 2005) expressly recognized that the USPTO employs the "broadest reasonable interpretation" standard:
The Patent and Trademark Office ("PTO") determines the scope of claims in patent applications not solely on the basis of the claim language, but upon giving claims their broadest reasonable construction "in light of the specification as it would be interpreted by one of ordinary skill in the art." In re Am. Acad. of Sci. Tech. Ctr., 367 F.3d 1359, 1364[, 70 USPQ2d 1827, 1830] (Fed. Cir. 2004). Indeed, the rules of the PTO require that application claims must "conform to the invention as set forth in the remainder of the specification and the terms and phrases used in the claims must find clear support or antecedent basis in the description so that the meaning of the terms in the claims may be ascertainable by reference to the description." 37 CFR 1.75(d)(1). (Emphasis added).
The BRI will be used for the following because the specification does not describe these terms:
Oligonucleotide: Therefore, this term will be interpreted as nucleic acid as provided in [0041]; i.e., a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof, and include double- and single-stranded DNA, and double- and single-stranded RNA.
MOE: A 2'-modification which is 2'-deoxy-2'-methoxyethoxy (2-O- CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE ribosyl) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504).
---O--P (O)(SH)---O--: phosphorothioate.
Finally, it is noted that no target is recited in the elected claims.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kabadi (US 20190374655 A1).
Kabadi teach spacer ribonucleic acids (oligonucleotides) ([0082] SEQ ID NOs: 1-467,030 is a list of gRNA 20 bp spacer sequences). As seen in the sequence alignment below, one oligonucleotide taught by Kabadi comprises 10 or more contiguous nucleobases of ATCAGTTTCTGTAGGCTTCC (SEQ ID NO: 1)
RESULT 7
US-17-748-495A-569296
Sequence 569296, US/17748495A
Patent No. 12053531
GENERAL INFORMATION
APPLICANT: Vertex Pharmaceuticals Incorporated
TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF DUCHENNE MUSCULAR
TITLE OF INVENTION: DYSTROPHY (DMD)
FILE REFERENCE: 01245-0021-01US
CURRENT APPLICATION NUMBER: US/17/748,495A
CURRENT FILING DATE: 2022-05-19
PRIOR APPLICATION NUMBER: US 15/763,328
PRIOR FILING DATE: 2016-03-26
PRIOR APPLICATION NUMBER: PCT/US2016/059386
PRIOR FILING DATE: 2016-10-28
PRIOR APPLICATION NUMBER: US 62/247,484
PRIOR FILING DATE: 2015-10-28
PRIOR APPLICATION NUMBER: US 62/324,064
PRIOR FILING DATE: 2016-04-18
NUMBER OF SEQ ID NOS: 1410475
SEQ ID NO 569296
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: chemically synthesized
Query Match 70.0%; Score 14; Length 20;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 5 GTTTCTGTAGGCTT 18
||||||||||||||
Db 1 GTTTCTGTAGGCTT 14
Kabadi teach modifications on the oligonucleotide ([0185]; [0306]-[0311]; [0314]-[0318]; sugar modifications [0319]; internucleotide modifications [0320]; base modifications [0321]-[0324])
Thus, Kabadi anticipates instant claim 1.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1 is/are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova I (Khvorova et al., US 20050246794 A1).
Regarding claim 1, Khvorova I teaches rationale design of siRNAs to generate effective gene silencing reagents (abstract). Khvorova I follows the design rules by exemplary demonstration of effectiveness in vitro of silencing of several genes (Example II – Example VI; pgs. 24-30). Khvorova I teaches an algorithm to use in a method for designing siRNAs for optimizing RNA interference [0014]. Regarding the design rules, Khvorova I teach siRNA molecules can be vary in length (generally between 18-30 base pairs and contain varying degrees of complementarity to their target mRNA in the antisense strand. For all given siRNAs, reference is made to the sense strand, because most databases contain information regarding the mRNA [0167]. Further, Khvorova I teaches rationally designed siRNA can be identified by maximizing one or more of 10 well-described criteria [0151] – [0166]. Some of these criteria are described as minor criteria, but are nonetheless desirable. Khvorova I teach several rationally designed siRNAs. Regarding chemical modifications, Khvorova I teach, “for instance, at position 12, a chemical modification of the 2' position of the sugar backbone could be added that increases the average internal stability at that position” [0278]. In [0298] Khvorova I teaches that the most common substitutions are at the 2' position of the ribose sugar, where moieties such as H (hydrogen) F, NH3, OC and other 0- alkyl, alkenyl, alkynyl, and orthoesters, may be substituted, or in the phosphorous backbone, where sulfur, amines or hydrocarbons may be substituted for the bridging of non-bridging atoms in the phosphodiester bond. In [0136] Khvorova I teaches that with respect to 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine etc., non-natural phosphodiester linkages such as methylphosphonates, phosphorothioates and peptides, [0137] 5-methylcytidine are included. Khvorova I teaches making more than one siRNA to the target ([0291] By increasing the number of siRNAs directed to a particular target using a pool or kit, one is able both to increase the likelihood that at least one siRNA with satisfactory functionality will be included, as well as to benefit from additive or synergistic effects.).
One example of rationally designed siRNA with the modifications described is in Khvorova I’s parent application, and identified as SEQ ID NO 68687:
RESULT 8
US-10-714-333C-68687/c
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
Sequence 68687, US/10714333C
Patent No. 8090542
GENERAL INFORMATION
APPLICANT: Dharmacon, Inc.
APPLICANT: Khvorova, Anastasia
APPLICANT: Reynolds, Angela
APPLICANT: Leake, Devin
APPLICANT: Marshall, William
APPLICANT: Scaringe, Stephen
TITLE OF INVENTION: Functional and Hyperfunctional siRNA
FILE REFERENCE: 13499US
CURRENT APPLICATION NUMBER: US/10/714,333C
CURRENT FILING DATE: 2003-11-14
PRIOR APPLICATION NUMBER: 60/502,050
PRIOR FILING DATE: 2003-09-10
PRIOR APPLICATION NUMBER: 60/426,137
PRIOR FILING DATE: 2002-11-14
NUMBER OF SEQ ID NOS: 1591911
SEQ ID NO 68687
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
SEQ ID NO 68687: uaacggaagc cuacagaaa
Query Match 75.0%; Score 15; Length 19;
Best Local Similarity 100.0%;
Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Instant SEQ ID NO: 1 6 TTTCTGTAGGCTTCC 20
|||||||||||||||
SEQ ID NO 68687 19 TTTCTGTAGGCTTCC 5
Khvorova I does not teach SEQ ID NO 68687 is a particularly designed siRNA, rather one of thousands of rationally designed siRNA.
However, Khvorova I’s disclosure had taught that certain examples of the above rationally designed siRNAs were validated in vitro and were effectively functional in inhibiting target mRNA expression.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have adapted SEQ ID NO 68687 of Khvorova I using the advantageous modifications also disclosed by Khvorova I (e.g., each T is optionally and independently replaced with U; and the oligonucleotide comprises a modified nucleobase, a modified sugar or a modified internucleotidic linkage), so that the oligonucleotide comprised a specific chemical modification pattern that would be more efficacious and avoid toxicity. It would have amounted to adapting a known oligonucleotide effective for inhibiting a target gene expression, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in adapting Khvorova I’s SEQ ID NO 68687 to comprise one of Khvorova I’s chemical modification patterns, because by way of in vitro tested examples, Khvorova I teaches their oligonucleotide that are rationally designed are functionally effective. The skilled artisan would have recognized that Khvorova I’s designs would be useful in enhancing a target gene inhibition in cells as taught by Khvorova I, and therefore, would have been motivated to apply Khvorova I’s designs to the chosen oligonucleotide of Khvorova I; i.e, SEQ ID NO 68687. In addition, one of skill in the art could have designed more siRNA to the same target even in the absence of a template provided because Khvorova I provides rules for design and advocates for designing more than one siRNA. See MPEP 2143 I A.
Thus, Khvorova I makes obvious instant claim 1.
Claim(s) 2-17 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova I (Khvorova et al., US 20050246794 A1) as applied to claim 1 above, and further in view of Khvorova II (Khvorova and Watts, Nat Biotechnol. 2017 March ; 35(3): 238–248).
Regarding claim 17, the oligonucleotide of claim 1 is discussed above. Khvorova I had not taught a 20-nt long oligonucleotide having a gapmer structure; i.e., ntds 1-5 are RNA, ntds 6-15 are DNA, ntds 16-20 are RNA, and the modified structure wherein all internal nucleotides are phosphorothioate modified and all external nucleotides are MOE modified and all C are further 5-methyl-2'-deoxycytidine; i.e., SEQ ID NO: 116.
With respect to a 20nt long oligonucleotide, Khvorova I had not taught a sequence of exact length as SEQ ID NO: 116 (20 ntds.) rather only 15 ntds of this sequence. However, Khvorova I had taught:
1. siRNA molecules can vary in length (generally between 18-30 bp) and contain varying degrees of complementarity to their target mRNA in the antisense strand [0109].
2. that bases can be added to the 5’end of a rationally designed oligonucleotide.
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Further, with respect to the length of the oligonucleotides (20-mer), this is a matter of design choice. See MPEP 2144.05 II and In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions.").
With respect to modifications, Khvorova I had taught modifications increase the stability of the oligonucleotide as discussed for claim 1. Khvorova I had specifically taught the modifications: 5-methylcytidine [0137], 2' position of the ribose sugar or in the phosphorous backbone, sulfur, amines or hydrocarbons may be substituted [0298].
Khvorova I had not taught the exact modified SEQ ID NO 116.
However, before the effective filing date of instant invention, Khvorova II reviewed the state of the art with respect to oligonucleotide therapies of clinical utility (title). Khvorova II taught, “most common solution, called a ‘gapmer’ ASO, consists of a central window (i.e., a gap) of PS (phosphorothioate) DNA, which recruits RNase H, flanked by modified RNA-like nucleotides (Fig. 2)”. Khvorova II taught the modifications include 2'-methoxyethyl (MOE) nucleosides (see middle paragraph on page 3). Khvorova II taught all oligonucleotides require chemical modifications to be sufficiently active in vivo (see first line on page 3). Khvorova II taught the most common configurations included modification of terminal nucleotides, of every second sugar with 2′OMe or 2′MOE, or of all pyrimidines (see 3rd paragraph on page 7; Fig. 3). Khvorova II taught a 5’ methyl modification on C and combination of modifications for enhanced oligonucleotide activity and stability. See recitation middle paragraph on page 3:
PNG
media_image2.png
200
400
media_image2.png
Greyscale
It would have been obvious to one of ordinary skill in the art to include 2'-methoxyethyl (MOE) modification taught by Khvorova II into SEQ ID NO 68687 taught by Khvorova I and further to modify all nucleosides with 2’MOE along with 5'-methyl modifications into the oligonucleotide taught by Khvorova I. One of the ordinary skill in the art would be motivated to do so, because Khvorova II teaches 2'-methoxyethyl and 5'-methyl modifications as one of possible modifications to include to improve oligomeric compounds targeted to RNAs for the advantage of enhanced ASO activity and stability of such compounds. See MPEP 2144 II and 2143 I.(A).
Regarding claims 2-16, the oligonucleotide of claim 1 and claim 17 (SEQ ID NO:116) is discussed above. Khvorova I had not taught a 20-nt long oligonucleotide with base sequence of SEQ ID NO: 8, which as noted above is the same as base sequence of SEQ ID NO:1, which also noted above is the same as base sequence of SEQ ID NO:116. Therefore, the teachings of Khvorova II applied in the rejection of claim 17 render obvious the base sequence of SEQ ID NO:8 as recited in claim 2, and render obvious the modifications on this sequence as recited in claims 3-16.
Thus, Khvorova I in view of Khvorova II make obvious instant claim 2-17.
Claim(s) 19-21 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova I (Khvorova et al., US 20050246794 A1) and Khvorova II (Khvorova and Watts, Nat Biotechnol. 2017 March ; 35(3): 238–248) as applied to claim 17 above, and further in view of Ravikumar (Ravikumar and Cole, Organic Process Research & Development 2002, 6, 798-806.).
Regarding claim 19, neither Khvorova I nor Khvorova II had taught diastereomers of the oligonucleotide with respect to chiral linkage phosphorus.
However, before the effective filing date of instant invention, Ravikumar had taught a stereoreproducible method of 2’-O-methoxyethylribonucleoside phosphoramidite-based phosphorothioate oligonucleotide synthesis (abstract). Ravikumar taught O,O-linked phosphorothioate diester linkage is chiral, further indicating the vast number of diasteroisomers possible. Separation and analytical control of this number of diastereomers is not feasible. (pg. 799). Thus, the limitation of and one or more diastereomers is met in Ravikumar’s teachings. Ravikumar further teach that differences in toxicity profile of different diastereomeric proportions exist (a batch of drug (active pharmaceutical ingredient) for clinical trial use, potential effects (i.e., toxicological profile or therapeutic outcome) resulting from a different pool of diastereomers should be considered, pg. 806, l col, 1st para).
Regarding claims 20 and 21, Khvorova I and Khvorova II’s teachings with respect to modified SEQ ID NO: 116 were discussed above and apply.
Neither Khvorova I nor Khvorova II had taught Rp configuration.
However, before the effective filing date of instant invention, Ravikumar had taught a stereoreproducible method of 2’-O-methoxyethylribonucleoside phosphoramidite-based phosphorothioate oligonucleotide synthesis. Ravikumar taught that activators used in the synthesis (see Table 10) have much greater influence on the stereochemical ratio of phosphorothioate linkages than any other variable. Therefore, the choice of activator and consistency in maintaining the activator between batches of production will determine the racemic mix. See other pertinent recitations:
PNG
media_image3.png
200
400
media_image3.png
Greyscale
PNG
media_image4.png
200
400
media_image4.png
Greyscale
Ravikumar‘s method resulted in a 1:1 ratio of Rp and Sp phosphorothioate diesters containing MOE modified oligonucleotides (last line of conclusion). Thus, the limitation of wherein for each chiral linkage phosphorus, the percentage of the Rp configuration is about 50% of claim 21 is met in Ravikumar’s teachings.
Therefore, it would be prima facie obvious to make a composition comprising the oligonucleotide of the invention as rendered obvious by Khvorova I and Khvorova II comprising diastereomers and particularly one with an Rp configuration of about 50% as taught by Ravikumar for the advantage of using the compound in administering to a subject. Ravikumar had taught that innumerable diastereomeric ratios occur during the process of manufacturing MOE and phosphoramidite modified oligonucleotides but consistency (in ratios of Rp and Sp configurations) are needed for clinical reproducibility. One skilled in the art would have a reasonable expectation of success because Ravikumar had provided details on making the required diastereomeric ratio of P in MOE and phosphoramidite modified oligonucleotides. Generally, it is prima facie obvious to carry out a process, based on its recognized suitability for its intended use, and to utilize the provided TSM to improve a product. See MPEP 2144.07 and 2143 G.
Thus, Khvorova I and Khvorova II in view of Ravikumar make obvious instant claims 19-21.
Claim(s) 18, 25-26, and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova I (Khvorova et al., US 20050246794 A1) and Khvorova II (Khvorova and Watts, Nat Biotechnol. 2017 March ; 35(3): 238–248) as applied to claim 17 above, and further in view of Prince (US 20110117106 A1)
Regarding claim 18, 25-26, and 28, neither Khvorova I nor Khvorova II had taught a pharmaceutical composition.
However, before the effective filing date of instant invention, Prince had taught pharmaceutical compositions comprising small interfering RNA calpain 2 inhibitors ([0171], [0199], claims 7-9). The calpain 2 inhibitors include modified oligonucleotides that inhibit mRNA of calpain 2 [0032].
Regarding claims 18 and 26, Prince taught a salt of the inhibitor. See [0212]: In a further aspect, the invention also provides a pharmaceutical composition comprising a calpain inhibitor in free or pharmaceutically acceptable salt form, optionally together with a pharmaceutically acceptable diluent or carrier therefor. Prince taught the composition can be provided for administration to humans and animals in unit dosage forms, such as the pharmaceutically acceptable salts, and the sodium salts, thereof [0321]
Regarding claims 25 and 28, with respect to nucleic acid inhibitors, Prince taught, one or more additional components, such as a pharmaceutically acceptable carrier, diluent, excipient, adjuvant, emulsifier, buffer, stabilizer, preservative, and the like may be included in the composition [0216]. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution [0323].
As such, it would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the modified oligonucleotide taught by Khvorova I and Khvorova II into a pharmaceutical composition as taught by Prince for the advantage of using the compound in administering to a subject. The selection of a known material based on its suitability for its intended use supports a prima facie obviousness determination as taught in MPEP 2144.07. One would have done so with predictability and a reasonable expectation of success because Prince had similarly done so with another nucleic acid inhibitor of calpain-2. See also MPEP 2143 A.
Thus, Khvorova I and Khvorova II in view of Prince make obvious instant claims 18, 25-26, and 28.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Relevant Prior Art Not relied Upon
The following art is made note of and not currently relied on, but is relevant to applicants invention. Tapia (J. Biol. Chem. (2019) 294(21) 8325–8335) had taught the inhibition of calpain-2 in vitro using commercially procured siRNAs to calpain-2. The closest prior art is applied above.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635