Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's preliminary amendment filed on September 8, 2023 is acknowledged. Claims 1-19, 21, 22, 24-26, 28-30, 32-38, 40, 41, 43-45, 47-49, 53-85, 89, 91, 95-117, and 122-130 have been canceled. Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86-88, 90, 92-94, and 118-120 were amended. Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86-88, 90, 92-94, and 118-121 are pending and are examined on the merits herein.
Priority
PNG
media_image1.png
66
450
media_image1.png
Greyscale
Information Disclosure Statement
There is no information disclosure statement provided with the instant application.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings were received on May 26, 2023.
The drawings are objected to because it is difficult to decipher the difference in the “monthly” and “quarterly” solid lines in FIGS. 19 and 20. In addition, the brief description of the drawings section for FIG. 20 refers to a dotted light line and a dotted dark line; however, it is difficult to distinguish between the light line and the dark line that is referred to.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because of the use of legal phraseology ("e.g." stands for "exempli gratia", and should be removed or replaced with a non-Latin version, such as "for example"). In addition, the abstract is less than 50 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
The disclosure is objected to because of the following informalities:
The brief description of the drawings section for FIG. 4 on page 18 reads “single does” and should read “single dose” (emphasis added).
The brief description of the drawings section for FIG. 6 on page 18 reads “is a graph” and should read “is two graphs” because there are two (2) graphs for FIG. 6.
There are two (2) graphs for FIG. 8A; however, the brief description of the drawings section for FIG. 8A reads “is a graph” and only provides a description for one of the graphs.
The brief description of the drawings section for FIG. 19 and FIG. 20 on page 19 reads “PH1 patents”. It appears that this is a typographical error and Applicant may have intended “PH1 patients” instead (emphasis added).
The brief description of the drawings section for FIG. 21A and FIG. 21B on page 19 reads “lumasirin” and should read “lumasiran”
Appropriate correction is required.
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See page 22, line 14.
Claim Objections
Claims 20 and 86 are objected to because of the following informalities:
Claim 20 recites the abbreviation HAO1. The abbreviation should be clearly written out at their first occurrence in the claim and should be followed by the abbreviation in parentheses.
Claim 86 recites “wherein the RNAi agent” and should recite “wherein the double stranded RNAi agent”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 51 and 119 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 51 recites the limitation “wherein the plasma oxalate level is reduced by about 35% or more”. This limitation is indefinite because it is not what reference level to compare the reduction of plasma oxalate level to be able to determine by about 35% or more.
Claim 119 recites the limitation "the ligand". There is insufficient antecedent basis for this limitation in the claim. Claim 119 depends on claim 20 and claim 20 does not recite a ligand.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86, 87, 94, 118, 119, and 120 are rejected under 35 U.S.C. 103 as being unpatentable over Querbes et al. (WO 2016/057893).
Regarding claims 20, 23, 27, 31, 39, 42, 46, and 50, Querbes et al. teaches double-stranded RNAi agents targeting the HAO1 gene, and methods of using such RNAi agents to inhibit expression of HAO1 and methods of treating subjects having PH1 [abstract] wherein “subject” includes a human [page 12, second full paragraph]. Querbes et al. also teaches double-stranded RNAi agents which inhibit the expression of a HAO1 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a HAO1 associated disorder, and uses of such double-stranded RNAi agents [abstract].
Querbes et al. teaches SEQ ID NO: 201, a HAO1 modified sense strand sequence, which has a match to instant SEQ ID NO: 14 as shown in the alignment below. Querbes et al. also teaches SEQ ID NO: 318, a HAO1 modified antisense strand sequence, which has a match to instant SEQ ID NO: 15 as shown in the alignment below. The abbreviations used in the nucleic acid sequences are as follows: a, c, g, and u are 2’-O-methyl A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2’-fluoro A, C, G, and U, respectively; s is a phosphorothioate linkage, and L96 is
PNG
media_image2.png
66
762
media_image2.png
Greyscale
[pages 104-105, Table B].
Duplex Name Sense strand SEQ ID Antisense strand SEQ ID
PNG
media_image3.png
38
974
media_image3.png
Greyscale
[page 113].
Query Match 100.0%; Score 21; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
Querbes et al., SEQ ID NO: 201 1 GACUUUCAUCCUGGAAAUAUA 21
Query Match 100.0%; Score 23; Length 23;
Best Local Similarity 69.6%;
Matches 16; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 15 1 TATATTTCCAGGATGAAAGTCCA 23
:|:|:::||||||:|||||:|||
Querbes et al., SEQ ID NO: 318 1 UAUAUUUCCAGGAUGAAAGUCCA 23
Querbes et al. also teaches that the pharmaceutical compositions may be administered in dosages sufficient to inhibit expression of a HAO1 gene [page 59, third paragraph]. A suitable dose of an iRNA will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally about 0.1 to 10 or 1 to 50 mg per kilogram body weight per day [page 59, fourth paragraph]. Querbes et al. also teaches that a single dose of the pharmaceutical composition can be long lasting such that subsequent doses are administered at not more than 4 week intervals. In some embodiments, a single dose of the pharmaceutical composition is administered bi-monthly [page 62, second full paragraph]. Further, certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments [page 62, last paragraph]. Querbes et al. also teaches that the RNAi agent is administered in a dosing regimen that includes a “loading phase” of closely spaced administrations that may be followed by a “maintenance phase”, in which the RNAi agent is administered at longer spaced intervals [page 100, first full paragraph].
Regarding claims 51 and 52, the outcomes recited in claims 51 and 52 are inherent in the method of claim 39 absent evidence to the contrary.
Regarding claims 86 and 94, Querbes et al. teaches pharmaceutical compositions containing an iRNA and a pharmaceutically acceptable carrier [page 58, fourth full paragraph]. Querbes et al. also teaches that the RNAi agents are administered subcutaneously [page 97, first paragraph].
Regarding claim 87, Querbes et al. teaches pharmaceutical compositions containing an iRNA and a pharmaceutically acceptable carrier [page 58, fourth full paragraph]. Suitable pharmaceutically acceptable carriers include salt solutions [page 89, second full paragraph].
Regarding claim 118, Querbes et al. teaches that the ligand is conjugated to the 3’-end of the sense strand [page 38, third full paragraph].
Regarding claim 119, Querbes et al. teaches that the ligand can be one or more GalNAc derivatives attached through a bivalent or trivalent branched linker [page 46, second full paragraph].
Regarding claim 120, Querbes et al. teaches that an example of a suitable bivalent and trivalent branched linker group conjugating GalNAc derivative includes the following compound:
PNG
media_image4.png
228
344
media_image4.png
Greyscale
[page 48].
However, Querbes et al. does not teach the double stranded RNAi agent design of instant SEQ ID NO: 15. Querbes et al. also does not teach the various ranges of doses for the loading phase and the maintenance phase as recited in the claims.
Although Querbes et al. does not explicitly teach the double stranded RNAi agent design of instant SEQ ID NO: 15, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a double stranded RNAi agent and arrive at instant SEQ ID NO: 15 using the design principles taught by Querbes et al. because it would have amounted to applying known design principles to a HAO1 nucleic acid sequence by known means to yield predictable results. One of skill in the art would have modified the double stranded RNAi agent of Querbes et al. at positions 4, 10, 18, and 20 from 2’-fluoro to 2’-O-methyl and from 2’-O-methyl to 2’-fluoro at position 9 because Querbes et al. taught that each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro [page 25, second full paragraph]. Further, introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand and/or antisense strand enhances the gene silencing activity to the target gene [page 26, last paragraph bridging to page 27]. Querbes et al. also taught alternating motif referring to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand [page 25, last paragraph]. One would have been motivated to do so for the purposes of targeting HAO1 to inhibit expression of HAO1 as taught by Querbes et al. [page 2, second paragraph].
Although Querbes et al. does not explicitly teach the various ranges of doses for the loading phase and the maintenance phase of the dosing regimen, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have arrived at the claimed dosing regimen in the process of optimizing the conditions of Querbes et al. to effectively treat a subject having PH1 or to effectively reduce plasma oxalate level in a subject having PH1 because Querbes et al. taught that the RNAi agent is administered in a dosing regimen that includes a “loading phase” followed by a “maintenance phase” and certain factors can influence the dosage and timing required to effectively treat a subject.
Claim 88 is rejected under 35 U.S.C. 103 as being unpatentable over Querbes et al. (WO 2016/057893) as applied to claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86, 87, 94, 118, 119, and 120 above, and further in view of Brown et al. (US 10,351,854).
Regarding claim 88, the teachings of Querbes et al. are discussed above.
However, Querbes et al. does not teach administering an additional therapeutic agent such as vitamin B6 (pyridoxine). The instant specification discloses that the additional therapeutic agent for the treatment of primary hyperoxaluria may be, for example, vitamin B6 (pyridoxine) [page 37, lines 25-26].
Brown et al. teaches that primary hyperoxaluria results in increased excretion of oxalate [column 40, lines 51-52]. Further, in a proportion of patients with primary hyperoxaluria type 1, pyridoxine treatment (vitamin B6) may also decrease oxalate excretion and prevent kidney stone formation [column 41, fourth paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to administer the double stranded RNAi agent of Querbes et al. and administer a therapeutic agent such as vitamin B6 (pyridoxine) as taught by Brown et al. because it would have amounted to combining prior art elements to yield predictable results.
Claims 90, 92, and 93 are rejected under 35 U.S.C. 103 as being unpatentable over Querbes et al. (WO 2016/057893) as applied to claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86, 87, 94, 118, 119, and 120 above, and further in view of Conway et al. (US 2018/0064827).
Regarding claims 90, 92, and 93, the teachings of Querbes et al. are discussed above.
However, Querbes et al. does not teach that the subject is on dialysis. Querbes et al. also does not teach end stage renal disease.
Conway et al. teaches compositions and methods for modulation of gene expression in the liver including modulation of HAO1 [abstract]. Conway et al. also teaches that primary hyperoxaluria type 1 (PH1) is a disease of glyoxylate metabolism and arises from mutations in the enzyme alanine-glyoxylate aminotransferase. The resulting deficiency in this enzyme leads to abnormally high oxalate production resulting in calcium oxalate crystal formation and deposition in the kidney and many other tissues, with systemic oxalosis and end-stage renal disease (ESRD) being a common outcome. Conway et al. also teaches that ESRD in hyperoxaluria is accompanied by calcium oxalate deposition in the skin, bone marrow, bone (causing recurrent bone fractures), myocardium, nervous system, skeletal muscle, blood vessels and retina. Treatment is best initiated in children prior to kidney damage and can involve daily dialysis. Dialysis is often able to significantly reduce the oxalate load. Further, RNAi approaches may offer some help as injection of GO-specific siRNAs decreased the expression of GO and reduced urinary oxalate excretion in a mouse disease model [0050].
Although Conway et al. does not explicitly teach administering a double stranded RNAi agent after dialysis, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to try to administer the double stranded RNAi agent of Querbes et al. after dialysis because Conway et al. taught that dialysis is able to significantly reduce oxalate load and GO-specific siRNAs can decrease GO expression and reduce urinary oxalate excretion.
Claim 121 is rejected under 35 U.S.C. 103 as being unpatentable over Querbes et al. (WO 2016/057893) as applied to claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86, 87, 94, 118, 119, and 120 above, and further in view of Borodovsky et al. (US 2016/0298124).
Regarding claim 121, the teachings of Querbes et al. are discussed above.
However, Querbes et al. does not teach that the double stranded RNAi agent is conjugated to the ligand according to the schematic shown in claim 121.
Borodovsky et al. teaches that the RNAi agent is conjugated to a ligand as shown in the following schematic
PNG
media_image5.png
456
826
media_image5.png
Greyscale
wherein X is O or S [0088] and [0089].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to conjugate the RNAi agent of Querbes et al. to a ligand according to the schematic as taught by Borodovsky et al. with a reasonable expectation of success because Querbes et al. and Borodovsky et al. both teach that it is within the skill of the art to conjugate a ligand to a RNAi agent. One would have been motivated to do so in order to achieve the predictable result of enhanced affinity for a selected target as taught by Querbes et al. [page 38, fourth full paragraph].
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86-88, 90, 92-94, and 118-121 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 and 17-19 of U.S. Patent No. 10,478,500. Although the claims at issue are not identical, they are not patentably distinct from each other because the patent claims are directed to a double stranded RNAi agent capable of inhibiting expression of HAO1 in a cell wherein the sense strand nucleotide sequence consists of SEQ ID NO: 589 and the antisense strand nucleotide sequence consists of SEQ ID NO: 706. The patent claims are also directed to a method of inhibiting HAO1 expression in a cell. Claim 19 of patent ‘500 is drawn to the double stranded RNAi agent of claim 1 wherein the sense strand consists of SEQ ID NO: 213 and the antisense strand consists of SEQ ID NO: 330. A person of ordinary skill in the art would recognize that the instant claims are an obvious variation of the patent claims because SEQ ID NO: 213 of patent ‘500 has a 100% match to instant SEQ ID NO: 14 as shown in the sequence search results below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘500 SEQ ID NO: 213 1 GACUUUCAUCCUGGAAAUAUA 21
Regarding the patent 10,478,500 claims limited only to compositions, the instant method claims are considered obvious over these claims in view of the findings of the court in Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86-88, 90, 92-94, and 118-121 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 5, and 7-16 of U.S. Patent No. 11,446,380. Although the claims at issue are not identical, they are not patentably distinct from each other because the patent claims are directed to a double stranded RNAi agent that inhibits expression of HAO1 in a cell wherein the sense strand comprises the nucleotide sequence SEQ ID NO: 213 and the antisense strand comprises the nucleotide sequence SEQ ID NO: 330. The specification of patent ‘380 indicates that the invention provides compositions comprising RNAi agents targeting HAO1 and methods of using the compositions for inhibiting HAO1 expression and for treating HAO1 associated disorders (e.g., PH1) [column 2, first paragraph]. A person of ordinary skill in the art would recognize that the instant claims are an obvious variation of the patent claims because SEQ ID NO: 213 of patent ‘380 has a 100% match to instant SEQ ID NO: 14 as shown in the sequence search results below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘380 SEQ ID NO: 213 1 GACUUUCAUCCUGGAAAUAUA 21
Regarding the 11,446,380 claims limited only to compositions comprising the recited oligonucleotides, the instant method claims are considered obvious over these claims in view of the findings of the court in Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Claims 20, 23, 27, 31, 39, 42, 46, 50-52, 86-88, 90, 92-94, and 118-121 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, and 18-41 of copending Application No. 17/579,655 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims overlap in scope.
PNG
media_image6.png
702
590
media_image6.png
Greyscale
PNG
media_image7.png
542
600
media_image7.png
Greyscale
PNG
media_image8.png
238
584
media_image8.png
Greyscale
PNG
media_image9.png
732
492
media_image9.png
Greyscale
PNG
media_image10.png
668
532
media_image10.png
Greyscale
SEQ ID NOS: 14 and 15 of ‘655 has a 100% match to instant SEQ ID NOS: 14 and 15, respectively as shown in the alignment below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘655 SEQ ID NO: 14 1 GACUUUCAUCCUGGAAAUAUA 21
Query Match 100.0%; Score 23; DB 1; Length 23;
Best Local Similarity 69.6%;
Matches 16; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 15 1 TATATTTCCAGGATGAAAGTCCA 23
:|:|:::||||||:|||||:|||
‘655 SEQ ID NO: 15 1 UAUAUUUCCAGGAUGAAAGUCCA 23
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637