DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of group III in the reply filed on 11/25/2025 is acknowledged.
The amendments to the claims cancel the claims of the other groups and adds new claims that are the subject matter of group III.
As such, claims 1, 3-12, and 29-34 are under consideration in this office action.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 10 and 34 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 10 recites, “H2-Ab1g7”. This recitation appears to be an abbreviation for an engineered H2-Ab1 allele produced by genetic modification of wildtype H2-Ab1. It does not inherently impart any particular structure; it merely acts as a name of a mutation in H2-Ab1 gene. As such, the metes and bound of this allele are not apparent because the abbreviation does not provide impart any limitations on its own.
For purposes of interpretation at this point any mutation to the H2-A will be interpreted as meeting the limitations of claim 10.
Claim 34 recites, “HLA-DR3/4”. This recitation is an abbreviation for the HLA-DR being introduced into the NOD mouse. However, it is not apparent if “DR-3/4” is intended to means that the mouse is required to have both HLA-DR3 and HLA-DR4 or if the mouse DR3 and DR4 are alternatives and therefore the mouse only requires one of DR3 or DR4. For purposes of interpretation and finding relevant art, the claim will be interpreted as HLA-DR3 or HLA-DR4.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
(1) Claim(s) 1, 7, and 10 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Anderson (Anderson and Bluestone. Annu. Rev. Immunol. 23:447-485, 2005).
Regarding claim 1, the claim is directed to a genetically modified NOD mouse comprising in its genome a mutation in a gene encoding H2-K and a mutation in a gene encoding H2-D. The claim does not definite the structural limitations of the genetic modification. Thus the breadth of the claimed mutation can be any type of genetic change/difference present by any means. This includes known polymorphisms in the H2-D and H2-K genes. Further NOD mice are considered genetically modified mice because of their deliberate inbreeding to arrive a particular genome that imparts the NOD mice diabetic phenotype. Further, the claim does not recite any particular phenotypic effect associated with the mutations of H2-D and H2-K. As such, the NOD phenotype already present is all that would be required in the claimed genetically modified NOD mouse. Thus the breadth of claim 1 encompasses any NOD mice because NOD mice are known to carry polymorphisms in the H2-D and H2-K genes.
Anderson discloses that NOD mice harbor a unique MHC haplotype, termed H-2g7, which is essential and is the highest genetic contributor for disease susceptibility (p. 449, last paragraph). This disclosure of NOD mice discloses all the required structural and phenotypic limitations for the NOD mouse of claim 1. Thus Anderson expressly discloses the mouse of claim 1.
Regarding claims 7 and 10, the interpretation of the claim is as discussed above. The NOD mouse of Anderson also comprises a H2-A polymorphism. As such, it comprises a mutation in in the genes encoding H2-A.
In conclusion, the prior art of Anderson anticipates the claims because it expressly or inherently discloses the generic nature of the claims.
(2) Claim(s) 1 and 3-10 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Brehm (US 2020/0060245 A1 effectively filed 5/12/2017; of record in IDS 8/29/2023).
Regarding claim 1, Brehm discloses an NSG (NOD-scid-IL2r.gamma-/-) mouse lacks functional MHC I due to a homozygous null mutation of H2-K and H2-D MHC I .alpha. protein subclasses (p. 11-12, {0147] and [0148)]. Thus Brehm expressly discloses the limitations of claim 1.
Regarding claims 3 and 4, as discussed above, Brehm discloses that the mutations are homozygous mutations of the H2-K and H2-D genes. Thus Brehm expressly discloses the limitations of claims 3 and 4.
Regarding claim 5, Brehm states that the mutations of H2-K and H2-D are null mutations meaning that neither H2-K nor H2-D genes are expressed. Thus Brehm expressly discloses the limitations of claim 5.
Regarding claim 6, Brehm discloses that the gene encoding the H2-D is H2-D1b ([0147] and [0148]).
Regarding claim 7-10, Brehm discloses The NSG-(K.sup.b D.sup.b).sup.null (IA.sup.null) mouse lacks functional MHC II due to a homozygous null mutation of H-2A subclass of MHC II (abbreviated as IA.sup.null). See p. 11-12, [00149].
In conclusion, the prior art of Brehm anticipates the claims because it expressly discloses all the requisite limitations of the claims.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
(1) Claim(s) 11 and 12 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brehm (US 2020/0060245 A1 effectively filed 5/12/2017) as applied to claims 1 and 3-10 above, and further in view of Takaki (Takaki et al. The Journal of Immunology 176:3257-3265, 2006).
Brehm teaches the NOD mouse that develops the type I diabetes as discussed above. Brehm does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-A as recited in claim 11. Brehm also does not teach that the nucleic acid encoding human HLA-A is HLA-A*02:01 as recited in claim 12.
However, before the time of effective filing, Takaki introducing a HLA-A*02:01transgene into type I diabetic NOD mouse (p. 3258, col 1, Mice section, and abstract). Introducing expression of HLA-A*02:01 into the NOD mouse provided a humanized NOD mouse model that allows for identification of T cells and autoantigens of relevance to type 1 diabetes (abstract).
As such, it would have been obvious to an artisan of ordinary skill before the time of effectively filing to introduce a transgene encoding human HLA-A*02:01, taught by Takaki, into the NOD mouse of Brehm using the methods of Takaki to predictably arrive at the limitations of claims 11 and 12. The artisan would have a reasonable expectation of success of making the mouse of claims 11 and 12 because Takaki teaches a predictable means of introducing a HLA-A*02:01 transgene into a NOD mouse. Further, the artisan would be motivated to introduce the HLA-A*02:01 transgene into NOD mouse because Takaki teaches introducing expression of HLA-A*02:01 into the NOD mouse provided a humanized NOD mouse model that allows for identification of T cells and autoantigens of relevance to type 1 diabetes. As such, Brehm in view of Takaki renders claims 11 and 12 obvious.
(2) Claim(s) 11 and 29 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brehm (US 2020/0060245 A1 effectively filed 5/12/2017) as applied to claims 1 and 3-10 above, and further in view of Antal (Antal et al. J Immunol 2012 June 1; 188(11): 5766–5775. doi:10.4049/jimmunol.1102930. pp. 1-24).
Regarding claim 11, Brehm teaches the NOD mouse that develops the type I diabetes as discussed above. Brehm does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-A as recited in claim 11.
However, before effective filing Antal teaches introducing a transgene encoding HLA-A*1101 into a NOD mouse background having a diabetic type I phenotype by backcrossing a C57BL/6 mouse expressing HLA-A*1101 to a NOD mouse to introducing the HLA-A*1101 transgene into the NOD mouse (p. 3, paragraph 1 under materials and methods). Antal teaches NOD mice transgenic for human class I MHC molecules have previously been employed to identify T cell epitopes having important relevance to the human disease. However, most studies have focused exclusively on HLA-A*0201. To broaden the reach of epitope-based monitoring and therapeutic strategies we have looked beyond this allele and developed NOD mice expressing human β2-microglobulin and HLA-A*1101 or HLA-B*0702, which are representative members of the A3 and B7 HLA (abstract).
As such, it would have been obvious to an artisan of ordinary skill before effectively filing to introduce the HLA-A*1101 transgene, taught by Antal, into the diabetic NOD mouse model of Brehm, using the methods of Antal, to predictably arrive at the limitations of claim 11. The artisan would have a reasonable expectation of success because Antal teaches that introducing other HLA transgenes onto the diabetic NOD mouse background was successful. Further the artisan would be motivated to introduce the HLA-A*1101 transgene into the NOD mouse because Antal teaches it broadens the reach of epitope-based monitoring and therapeutic strategies beyond HLA-A*0201. Thus Brehm in view of Antal render claim 11 obvious.
Regarding claim 29, Brehm teaches the NOD mouse that develops type I diabetes as described above. Brehm also does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-B as recited in claim 29.
However, before effective filing Antal teaches introducing a transgene encoding HLA-B*0702 into a NOD mouse background having a diabetic type I phenotype by backcrossing a C57BL/6 mouse expressing HLA-B*0702 to a NOD mouse to introducing the HLA-B*0702 transgene into the NOD mouse (p. 3, paragraph 1 under materials and methods). Antal teaches NOD mice transgenic for human class I MHC molecules have previously been employed to identify T cell epitopes having important relevance to the human disease. However, most studies have focused exclusively on HLA-A*0201. To broaden the reach of epitope-based monitoring and therapeutic strategies we have looked beyond this allele and developed NOD mice expressing human β2-microglobulin and HLA-A*1101 or HLA-B*0702, which are representative members of the A3 and B7 HLA (abstract).
As such, it would have been obvious to an artisan of ordinary skill before effectively filing to introduce the HLA-B*0702 transgene, taught by Antal, into the diabetic NOD mouse model of Brehm, using the methods of Antal, to predictably arrive at the limitations of claim 29. The artisan would have a reasonable expectation of success because Antal teaches that introducing other HLA transgenes onto the diabetic NOD mouse background was successful. Further the artisan would be motivated to introduce the HLA-B*0702 transgene into the NOD mouse because Antal teaches it broadens the reach of epitope-based monitoring and therapeutic strategies beyond HLA-A*0201. Thus Brehm in view of Antal render claim 29 obvious.
(3) Claim(s) 31 and 32 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brehm (US 2020/0060245 A1 effectively filed 5/12/2017) as applied to claims 1 and 3-10 above, and further in view of Kudva (Kudva et al. Human Immunology 62, 1099–1105, 2001)
Brehm teaches the NOD mouse that develops the type I diabetes as discussed above. Brehm does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-DQ as recited in claim 31. Brehm also does not teach that the nucleic acid encoding human HLA-DQ is HLA-DQ8 as recited in claim 32.
However, before the time of effective filing, Kudva teaches that they used the DQ8/NOD mice in there study. The DQ8/NOD mouse comprising HLA-QR8 transgene introduced into type I diabetic NOD mouse background (p. 1100, col 1, Mice section). Kudva teaches that they identified T cell epitopes on the intracytoplasmic region of IA-2 by immunizing DQ8/NOD, DQ8/B10, and NOD mice with overlapping 18 mer peptides in CFA. We identified four peptides presented both by DQ8 and NOD, five DQ8 specific peptides, and six NOD specific peptides. (abstract).
As such, it would have been obvious to an artisan of ordinary skill before the time of effectively filing to introduce a transgene encoding human HLA-QR8, taught by Kudva, into the NOD mouse of Brehm using the methods of Kudva and Brehm to predictably arrive at the limitations of claims 31 and 32. The artisan would have a reasonable expectation of success of making the mouse of claims 31 and 32 because Kudva teaches that DQ8/NOD mice with type I diabetic phenotype were available and successfully used to for determining epitopes potentially of interest to humans. Further, the artisan would be motivated to introduce the DQ8/NOD background into the NOD mouse of Brehm because Kudva teaches addition of the DQ8 transgene in to diabetic NOD mice can identify T cell epitopes relevant to the type I diabetic phenotype. As such, Brehm in view of Kudva renders claims 31 and 32 obvious.
(4) Claim(s) 33 and 34 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brehm (US 2020/0060245 A1 effectively filed 5/12/2017) as applied to claims 1 and 3-10 above, and further in view of Abraham (Abraham et al. J Immunology 166L1370-1379, 2001).
Brehm teaches the NOD mouse that develops the type I diabetes as discussed above. Brehm does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-DR as recited in claim 33. Brehm also does not teach that the nucleic acid encoding human HLA-DR is HLA-DR3/4 as recited in claim 34.
However, before the time of effective filing, Abraham teaches that they generated the transgenic mouse by introducing a HLA-DR3 transgene into B10/M mice embryos to generate mice expressing HLA-DR3 (p. 1371, col 1, Generating Transgenic Mice section). Abraham teaches the most significant association of MHC class II molecules with susceptibility to type 1 diabetes are the HLA DQ8 (DQB1*0302) and DQ2 (DQB1*0201) alleles. HLADR3 (DRB1*0301) and DR4 (DRB1*0401) (4) are also increased in frequency in patients with type 1 diabetes as the genes encoding these proteins are in linkage disequilibrium with those encoding the predisposing DQ2 and DQ8 molecules, respectively (p. 1370, col 1). Although it is recognized that the genes of the HLA region are a major risk factor for the development of type 1 diabetes, and considerable information is currently available on MHC-peptide binding, there are significant lacunae in our understanding of autoantigen processing and presentation and its role in the pathogenesis of disease. The classification of type 1 diabetes as a T cell-mediated autoimmune disease, although valid, still requires considerable characterization in terms of understanding B cell autoantigen-specific T cell autoreactivity. We have attempted to evaluate the interactions between MHC alleles and an islet autoantigen, GAD 65, in a HLA transgenic model system, in an effort to delineate the nature of autoreactive T cell responses that drive autoimmunity in type 1 diabetes (paragraph bridging pp. 1370-1371).
As such, it would have been obvious to an artisan of ordinary skill before the time of effectively filing to introduce a transgene encoding human HLA-DL3/4, taught by Abraham, into the NOD mouse of Brehm to predictably arrive at the limitations of claims 33 and 34. The artisan would have a reasonable expectation of success of making the mouse of claims 31 and 32 because Abraham teaches that the successful introduction of HLA-DR3/4 onto a mice background with type I diabetic phenotype. Further, the artisan would be motivated to introduce the HLA-DR3/4 into the NOD mouse of Brehm because Abraham teaches that HLA-DR3/4 are present with increased frequency in patients with type I diabetes and further adding HLA-DR3/4 expression to a diabetes type I mouse model, such as the NOD mouse of Brehm, will allow the artisan to evaluate the interactions between MHC alleles and an islet autoantigen, GAD 65, in a HLA transgenic model system, in an effort to delineate the nature of autoreactive T cell responses that drive autoimmunity in type 1 diabetes. As such, Brehm in view of Abraham renders claims 33 and 34 obvious.
(5) Claim(s) 29 and 30 is/are rejected under 35 U.S.C. 103 as being unpatentable over Brehm (US 2020/0060245 A1 effectively filed 5/12/2017) as applied to claims 1 and 3-10 above, and further in view of Baschal (Baschal et al. (2011):54:1702-1709).
Brehm teaches the NOD mouse that develops the type I diabetes as discussed above. Brehm does not teach that the NOD mouse further comprises a nucleic acid encoding human HLA-B as recited in claim 29. Brehm also does not teach that the nucleic acid encoding human HLA-B is HLA-B*39:06 as recited in claim 30.
However, before the time of effective filing, Baschal teaches class
I HLA alleles have also been associated with type 1 diabetes, particularly the HLA-B*39 and HLA-A*24 alleles. The high risk of HLA-B*3906 has been documented for DRB1*0101-DQB1*0501 and DRB1*0801-DQB1*0402 chromosomes, and the B*3906 allele alone has been associated with a younger age of onset of type 1 diabetes. Baschal further teaches that the used the B*3906 and B*3901 amino acid and gene sequences provided by the international ImMunoGeneTics information system and other readily available sequences information in the prior art (p. 1703).
As such, it would have been obvious to an artisan of ordinary skill before the time of effectively filing to introduce a develop HLA-B3906 transgene using the genetic information available via , taught by Baschal, into the NOD mouse of Brehm to predictably arrive at the limitations of claims 29 and 30. The artisan would have a reasonable expectation of success of making the mouse of claims 29 and 30 because Brehm teaches that the successful introduction of HLA encoding vectors into a NOD mice genetic background with type I diabetic phenotype. Further, the artisan would be motivated to introduce the HLA-B39 into the NOD mouse of Brehm because Baschal teaches that HLA-B39 is high risk of developing type 1 diabetes, particularly in younger incidences of type 1 diabetes. As such, Brehm in view of Abraham renders claims 29 and 30.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-12, and 29-34 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for the following:
A) A genetically modified NOD/ShiLtDvs stock mouse comprising in its genome homozygous disruptions of a H2-D1b gene and a H2-K1d gene, wherein the mouse does not express H2-D1b and a H2-K1d, wherein the mouse does not express endogenous classical MHC class I molecules, and wherein the mouse is resistant to type 1 diabetes and insulitis; and
B) A genetically modified NOD/ShiLtDvs stock mouse comprising in its genome homozygous disruptions of a H2-D1b gene, a H2-K1d gene, and a H2-Ab1g7, wherein the mouse does not express H2-D1b, a H2-K1d, and H2-Ab1g7, wherein the mouse does not express endogenous classical MHC class I and MHC class II molecules, and wherein the mouse is free of insulitis; and
, does not reasonably provide enablement for:
-a genetically modified NOD of any strain comprising any type of mutations to the H2-D, the H2-K , and the H2-A genes other than a homozygous disruption in these genes that knocks out there expression and wherein the mouse can have any phenotype or no phenotype at all; and
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention, if not, whether an artisan would require undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make and use the invention based on the content of the disclosure is “undue”.
Nature of Invention: The invention described by the specification is intended to develop improved NOD mice models for type 1 diabetes (T1D). The application discloses genetically modified NOD mice that ablate MHC class I and II molecules without removal of crucial components of the FcRn complex and IgG salvage pathways by ablating H2-D and H2-K gene expression. Such models can be utilized to introduce selected combinations of HLA class I and II genes linked to diabetes development and test potential clinical interventions tailored to specific HLA combinations.
Breadth of Claims: Regarding the genetically modified mouse model claims: The claims are drawn, in their broadest embodiments, to a NOD mouse comprising in its genome mutations to genes encoding H2-K and H2-D. The claims do not specify the type of mutation. As such, the breadth of the mutations are any substitutions, deletions, disruptions, insertions, or the like to the H2-K and H2-D genes and optionally the H2-A gene. The claims also do not specify if the mutations are intended to be heterozygous or homozygous in nature; thus, both heterozygous and homozygous mutations are encompassed by claims. The claims also do not specific a sub-strain of NOD mice. As such, any sub-strain of NOD mice and haplotype of the designated H2 genes are encompassed by the claims. The claims also do not specify any phenotype. As such, the breadth of the claims encompass a genetically modified mouse with any phenotype or no phenotype at all.
Specification Guidance: The specification describes the following (Citations from the Pre-Grant Publication):
[0003] Type 1 diabetes (T1D) is a highly polygenic autoimmune disorder in which T-cells destroy insulin producing pancreatic .beta.-cells and involves complex interactions among developmental, genetic, and environmental factors. Non-obese diabetic (NOD) mice are used as an animal model for T1D, exhibiting a susceptibility to spontaneous development of autoimmune, T cell-mediated insulin-dependent diabetes mellitus. Diabetes develops in NOD mice as a result of insulitis, a leukocytic infiltrate of the pancreatic islets. Despite the NOD mouse contributing to our knowledge of T1D pathogenesis, it has not proved an ideal model for developing therapies with clinical efficacy.
[0004] Provided herein, in some aspects are improved mouse models for developing T1D therapies. In both humans and the NOD mouse, certain major histocompatibility complex (MHC; designated HLA in humans) class I and II variants are primary genetic contributors to T1D development by respectively mediating pathogenic CD8.sup.+ and CD4.sup.+ T-cell responses. The first generation NOD..beta.2m.sup.-/-.HHD model (NOD mice homozygous for the .beta.2m.sup.tm1Unc mutation and carrying the HLA-A/H2-D/B2M transgene) expresses, in the absence of murine counterparts, the human HLA-A2.1 (also referred to as HLA-A*02:01) class I variant (belonging to the HLA-A2 allele group) linked to disease in 60% of T1D patients through an ability to support pathogenic CD8.sup.+ T-cell responses.
[0005] Another strain of T1D susceptible HLA-humanized mice, NOD..beta.2m.sup.-/-.B39, was also recently developed; however, because .beta.2m (.beta.2-microglobulin) is a critical component of the FcRn complex and IgG salvage pathways, these first generation HLA-humanized NOD mice are not appropriate for testing antibody-based therapies. The present disclosure provides, in some aspects, complete murine class I ablated NOD mice (NOD-cMHCI.sup.-/-) as well as NOD-H2-D.sup.b-/- and NOD-H2-K.sup.d-/- mice, to separate the independent contributions of these common MHC I variants to diabetes. This NOD.MHCI.sup.-/- stock has been used, as provided herein, as a platform for generating improved humanized models by introducing T1D relevant HLA class I A2.1 and B39 variants. The present disclosure also provides, in some aspects a complete classical-MHC-deficient NOD stock in which H2-Ab1.sup.g7 has also been ablated (NOD-cMHCI/II.sup.-/-). Such a model can be utilized, for example, to introduce selected combinations of HLA class I and II genes linked to diabetes development and test potential clinical interventions tailored to specific HLA combinations.
[0006] Thus, some aspects of the present disclosure provide a genetically modified non-obese diabetic (NOD) mouse comprising a mutation in a gene encoding H2-K (e.g., H2-K1.sup.d) and/or a mutation of a gene encoding H2-D (e.g., H2-D1.sup.b) in the genome of the NOD mouse. In some embodiments, the genome of the NOD mouse further comprises a mutation of a gene encoding H2-A (e.g., for example, the beta chain of H2-A, i.e., H2-Ab1). A gene encoding H2-K is herein referred to as a H2-K gene. A gene encoding H2-D is herein referred to as a H2-D gene. A gene encoding H2-A is herein referred to as a H2-A gene.
[0007] Some aspects of the present disclosure provide a genetically modified non-obese diabetic (NOD) mouse comprising in the genome of the NOD mouse a homozygous mutation in H2-D1.sup.b, a homozygous mutation in H2-K1.sup.d, and a homozygous mutation in H2-Ab1.sup.g7 (e.g., designated NOD/ShiLtDvs-H2-K1.sup.em1Dvs H2-Ab1.sup.em1Dvs H2-D1.sup.em5Dvs/Dvs).
[0008] Other aspects of the present disclosure provide a genetically modified non-obese diabetic (NOD) mouse comprising in the genome of the NOD mouse a homozygous mutation in H2-D1.sup.b, a homozygous mutation in H2-K1.sup.d, and a human HLA-A2 transgene (e.g., designated NOD/ShiLtDvs-H2-K1.sup.em1Dvs H2-D1.sup.em5Dvs Tg(HLA-A/H2-D/B2M)1Dvs/Dvs).
[0009] Yet other aspects of the present disclosure provide a genetically modified non-obese diabetic (NOD) mouse comprising in the genome of the NOD mouse a homozygous mutation in H2-D1.sup.b, a homozygous mutation in H2-K1.sup.d, and a human HLA-B39 transgene (e.g., designated NOD/ShiLtDvs-H2-K1.sup.em1Dvs H2-D1.sup.em5Dvs Tg(HLA-B39/H2-D/B2M)2Dvs/Dvs).
[0010] Further, the present disclosure, in some aspects, provides methods of producing the genetically modified NOD mouse of any one of the embodiments herein using CRISPR/Cas genome editing to introduce at least one of the mutations into the genome of the NOD mouse.
[0018] FIGS. 5A-5F. Novel direct-in-NOD H2-D/H2-K double knockout mice generated by CRISPR/Cas9. (FIG. 5A) Diagram and sequencing traces showing location of guides and mutations in exon 2 of H2-D1.sup.b (top) (GTACATCTCTGTCGGCTATG; SEQ ID NO:9) and H2-K1.sup.d (bottom) (ATAATCCGAGATTTGAGCCG; SEQ ID NO:12). Guide sequence is bold, mutations are marked by subscripted nucleotides, and marked on the sequencing trace with a *. Strain officially designated NOD/ShiLtDvs-H2-K1.sup.em1Dvs H2-D1.sup.em5Dvs/Dvs. (FIG. 5B) Representative flow cytometry histogram (top) showing expression of H2-D and H2-K on the surface of splenic B-cells comparing 10-week-old female NOD, NOD..beta.2m.sup.-/- and NOD-cMHCI.sup.-/- mice. Quantification of the MFI of H2-D and H2-K antibody staining on splenic B-cells showing Mean.+-.SEM (bottom). Individual mice are plotted and are combined from two independent experiments. There are 5-10 mice per group combined from two experiments. (FIG. 5C) Representative flow cytometry showing amongst splenocytes TCR.beta. vs FSC-A (top) and amongst TCR.beta.-gated CD4 vs CD8 (bottom) from 10-week-old female mice. (FIG. 5D) Yield of splenic CD4.sup.+ and CD8.sup.+ T-cells showing Mean.+-.SEM, 5-23 mice per group combined from five experiments. (FIG. 5E) T1D incidence comparing NOD, NOD-cMHCI.sup.-/- and NOD..beta.2m.sup.-/- female mice. (FIG. 5F) Mean insulitis score at end of incidence showing 9-15 mice per group, with diabetic mice receiving a score of 4.
[0029] "Humanization" of NOD mice allowing expression of chosen HLA combinations has potential to facilitate the mechanistic analysis and development of clinically translatable T1D interventions based on individualized human genetic configurations. Towards that goal, our earlier work described NOD mice expressing the common T1D associated human HLA-A*02:01 class I allele (21; 45). We recently further advanced these resources (31) by transgenically introducing the T1D-susceptibility HLA-B*39:06 class I variant (12; 17-19) into NOD mice. While a relatively low abundance allele, the human B9 class I variant supports aggressive early onset T1D (15; 16) seemingly independent of HLA class II effects (12). The continued expansion of HLA susceptibility alleles in NOD mice is essential for improving the ability of mouse models to test therapeutics for genetically diverse T1D patient populations, as a therapy that may work with the common HLA-A2 allele in place may not be sufficient for the earlier onset disease associated with HLA-B39 (15; 16). We should note that not all HLA class I alleles are capable of supporting T1D in NOD mice, as transgenic expression of HLA-B27 actually inhibits disease development (45).
[0030] In the course of these studies, we generated NOD-H2-D.sup.-/- and NOD-H2-K.sup.-/- mice enabling assessment of the individual contributions of these two genes to T1D development. The lack of either class I variant decreased T1D development indicating a requirement for both H2-D and H2-K restricted antigens in disease pathogenesis. Initial analysis indicates islet-infiltrating CD8.sup.+ T-cells in H2-K.sup.-/- mice have a more activated phenotype than in NOD or NOD-H2-D.sup.-/- mice. It is currently unknown why while proportionally increased, islet-effector CD8.sup.+ T-cells in NOD-H2-K.sup.-/- mice appear to have dampened pathogenic activity. Work is currently underway to determine specific T-cell populations present and absent within each of these new strains, and how they lead to the seeming discordance between effector status versus insulitis levels.
Working Examples: The specification describes the following working Examples:
Example 2. Creation of NOD-cMHCI.sup.-/- Mice
[0084] We next simultaneously targeted H2-D1.sup.b and H2-K1.sup.d to generate NOD mice directly lacking expression of both classical murine MHC class I molecules. Three founders were generated carrying predicted frameshift mutations within exon 2 of H2-D1.sup.b and H2-K1.sup.d (FIG. 5A, and data not shown). Based on breeding proclivity we selected a NOD-cMHCI.sup.-/- line carrying spaced 11 and 3 bp deletions within H2-D1 and a 1 bp deletion in H2-K1 (FIG. 5A) for analyses. As expected, these NOD-cMHCI.sup.-/- mice lack H2-D and H2-K (FIG. 5B, FIG. 9). This lack of MHC I expression corresponded with a paucity of splenic CD8.sup.+TCR.beta..sup.+ cells (FIGS. 5C-5D). Due to the ability of the NOD-cMHCI.sup.-/- stock to express non-classical MHC Ib molecules, they were characterized by small, but significant increase in the yield of splenic CD8.sup.+ T-cells compared to NOD..beta.2m.sup.-/- mice (FIGS. 5C-5D). Compared to standard NOD controls, both NOD-cMHCI.sup.-/- and NOD..beta.2m.sup.-/- mice had increased CD4.sup.+ yields, with this elevation greatest in the latter stock (FIG. 5D). Similar to NOD..beta.2m.sup.-/- mice, NOD-cMHCI.sup.-/- mice were resistant to T1D (FIG. 5E, FIG. 8C) and insulitis out to thirty weeks of age (FIG. 5F).
Example 3. Second Generation NOD-cMHCI.sup.-/--A2 and NOD-cMHCI.sup.-/--B39 Mice
[0085] To test if it could be used as a new base model for HLA-"humanization" in lieu of stocks carrying the .beta.2m.sup.-/- mutation, we crossed NOD-A2 and NOD-B39 mice with the newly created NOD-cMHCI.sup.-/- line. Like their earlier NOD..beta.2m.sup.-/- counterparts, NOD-cMHCI.sup.-/- mice carrying A2- (FIG. 6A) or B39- (FIG. 6B) encoding transgenes have CD8.sup.+ T-cells. Also, similar to the earlier NOD..beta.2m.sup.-/- platform, NOD-cMHCI.sup.-/--HLA mice express their respective HLA-transgenes, but not murine H2-D and H2-K class I molecules (FIGS. 6C-6E). However, unlike their NOD..beta.2m.sup.-/- counterparts, NOD-cMHCI.sup.-/--A2 and NOD-cMHCI.sup.-/--B39 mice express non-classical CD1d and Qa-2 (although for unknown reasons at different levels in the transgenics FIG. 10) class I molecules (FIGS. 6F-6G). One functional consequence of this is that NOD-cMHCI.sup.-/--HLA class I mice have CD1d-restricted NKT cells (FIGS. 6H-6I) a population whose therapeutic expansion could provide a means for T1D inhibition (42-44). Finally, T1D development and insulitis in both NOD-cMHCI.sup.-/--A2 and NOD-cMHCI.sup.-/--B39 mice is highly penetrant (FIGS. 6J-6K).
[0086] Next, we determined whether FcRn functionality was restored in NOD-cMHCI.sup.-/--HLA class I mice. NOD, NOD..beta.2m.sup.-/--A2 and NOD-cMHCI.sup.-/--A2 were injected with mouse TNP-specific antibody 1B7.11 (FIG. 6L) or humanized Herceptin IgG1 antibody (FIG. 6M). As expected, murine 1B7.11 antibody was cleared within a week in NOD..beta.2m.sup.-/--A2 mice (FIG. 6L). NOD-cMHCI.sup.-/--A2 and NOD mice both retained detectable 1B7.11 antibody out to thirty days post-injection (FIG. 6L). Injected Herceptin was rapidly cleared in NOD..beta.2 m.sup.-/--A2 mice, but was retained at detectable levels out to 30 days in both NOD and NOD-cMHCI.sup.-/--A2 mice (FIG. 6M). These data indicate NOD-cMHCI.sup.-/--HLA mice retain FcRn functionality.
Example 4. Creation of NOD-cMHCI/II.sup.-/- Mice
[0087] Further advancement of humanized NOD models would incorporate relevant combinations of both HLA class I and II susceptibility alleles. Towards this end, we generated NOD mice completely lacking in expression of classical murine MHC molecules (NOD-cMHCI/II.sup.-/-) mice by CRISPR/Cas9 targeting exon 2 of H2-Ab1.sup.g7 in the NOD-cMHCI.sup.-/- stock (FIG. 7A). This resulted in an 181 bp deletion within exon 2 of H2-Ab1.sup.g7 (FIG. 7B). As expected, NOD-cMHCI/II.sup.-/- mice lack expression of H2-A.sup.g7, H2-K, and H2-D (FIGS. 7C-7D). Thy1.2.sup.+ cells were reduced to .about.12% of total splenocytes in NOD-cMHCI/II.sup.-/- mice (FIGS. 7E-7F). Amongst residual Thy1.2.sup.+ cells, TCR.alpha..beta..sup.+ cells were reduced to 60% with a concomitant increase in the percentage of TCR.gamma..delta. cells (FIGS. 7G-7H). Amongst residual TCR.alpha..beta..sup.+ cells, the yield of CD4.sup.+ T-cells was drastically reduced compared to both NOD and NOD-cMHCI.sup.-/- mice (FIG. 11A, FIG. 7I). The yield of CD8.sup.+ T-cells was reduced compared to NOD mice, but expanded compared to NOD-cMHCI.sup.-/- mice (FIG. 11A, FIG. 7I). CD4+ and CD8.sup.+ double negative (FIG. 11A) and NKT-cells (FIG. 11B) were both slightly expanded in NOD-cMHCI/II.sup.-/- mice in comparison to NOD and NOD-cMHCI.sup.-/- mice (FIG. 7I). Finally, when examined at nine-twelve weeks of age NOD-cMHCI/II.sup.-/- mice were virtually free of insulitis (FIG. 7J).
Thus, the specification and working examples more narrowly provide specific guidance to a means of making and using NOD stock mice of one specific strain with homozygous disruptions of specific haplotypes of the H2-D, H2-K, and H2-A genes in the genome of said NOD stock mice that ablate the expression of classic MHC class I molecules and MHC II class molecules when H2-A is knocked-out, and wherein the mice are resistant to T1D and insulitis. The specification and working examples do not provide specific guidance to any NOD mouse strain with any type of mutations, any type with any phenotype or no phenotype.
State of the Art: While methods of making transgenic mice with NOD mouse strains have been long established in the prior art, the state of the art teaches that phenotype in genetically modified and even between different strains of NOD mice is unpredictable. Simecek (Simecek et al. Genes Genomes Genetics 5:771-775, 2015; of record in IDS 8/29/2023) reports, “In the 34 years since the original report of the NOD/Shi strain in Japan, the genomes of the derivative colonies are clearly exhibiting genetic drift….One of the major phenotypic differences distinguishing various colonies of NOD mice worldwide has been the penetrance of diabetes, particularly in males. With the exception of the low diabetes-incidence NOD/Wehi substrain, where a single recessive mutation may explain this now extinct substrain;s diabetes resistence...the genetic basis for differential diabetes penetrance in the currently distributed NOD substains, if any, is unknown. Although our study shows that each substrain carries unique indels or missense mutations that distinguish them from one another, no single one of these mutations have a known effect on diabetes penetrance or an immunophenotype related to it. The Chr. 3 deletion in a gene poor region in LtJ and Dvs is at lease 1Mb proximal to the Idd3/l2 locus known to be a major determinant of diabetes susceptibility in NOD mice…we have documented genetic drift amoung NOD substains that allows for distinguishing them genetically when necessary. The extent to which the polymorphisms identified potentially contribute to phenotypic differences among substrains remain unclear. This study only focused on variants fixed to homozygousity; additional heterozygous mutation likes are continues to be fixed to homozygousity with successive in generations of inbreeding. That such may affect phenotype is unclear. For example, a cohort of COS/Jos mice received by other investigators in 1988 had diverged into high and low diabetes incidence.” See p.774, col 2 to p. 775, col 1.
Thus Simecek teaches that genetic background and genetic divergence in the NOD strains have led to differences in phenotype between the different substrains, regardless of any additional genetic modification place upon the NOD genetic background.
Regarding genetic background and its impact of phenotype associated with genetic modification, Sellers (Sellers et al. Veterinary Pathology 49(1):32-43, 2012; IDS 8/29/2023) submits, “Recognition of these immune variations among commonly used inbred mouse strains is essential for the accurate interpretation of expected phenotypes or those that may arise unexpectedly. IN GEM [genetically engineered mice] developed to study specific components of the immune system, accurate evaluation of immune responses must take into consideration not only the gene of interest but also the genetic background strain and microbial milieu contribution to the manifestation of finding in these mice.” See abstract. Thus Sellers teaches that it is not always clear how the genetic background of a mouse strain is going to contribute to a phenotype in a genetically modified mouse and thus introduces unpredictability into the phenotype of a genetically modified mouse.
Regarding phenotype due to transgenesis, Dolatshad (Dolatshad et al. Mammalian Genome 26:598-608, 2015; IDS 8/29/2023) states, “The traditional approach, pronuclear injection, results in the random integration of the transgenic construct at varying copy number…. This uncontrolled event can lead to mutagenesis…, and frequently, transgene expression is influenced by sequences flanking the integration site….. Multiple independent lines must be characterized to causally link phenotype with transgene expression, resulting in a high animal and financial cost. Although independent lines expressing the transgene at differing levels can allow phenotype severity to be correlated with the level of transgene expression, this fortuitous outcome is infrequently obtained.” See paragraph bridging pp. 598 and 599. Dolatshad further states, “Traditionally, random integration approaches have been adopted with simple promoter cDNA or Bacterial Artificial Chromosome-based constructs which lead to multiple lines of mice, each with a unique copy number and site of integration. This method is sometimes able to yield different lines with different levels of expression with which the consequences of gene dosage can be explored; however, this fortuitous outcome is infrequently obtained as high copy number transgene arrays are frequently associated with variegation and silencing….” See p. 605, col 2, lines 7-17.
Thus, as exemplified by Dolatshad, genetic modification is associated with unpredictable phenotype, with the site of integration, varying copy number, confounding mutagenesis, and silencing of the transgene leading to unpredictable levels of transgene expression and unpredictable outcome, as Dolatshad describe it (abstract), or more generally unpredictable phenotype.
Thus overall, the art teaches that phenotype in genetically modified NOD and inbred mouse strains and substrains is highly unpredictable due to the uncharacterized impact the genetic background and differences among inbred mouse strains and well as those introduced by position effect, copy number, confounding mutagenesis, and silencing.
Undue Experimentation:
Thus the breath of the claims to any substrain of NOD mouse comprising any mutations to any H2-D, H2-K, and H2-A gene variant resulting in any phenotype or no phenotype at all lacks enablement because the specification solely provide specific guidance to one specific NOD mouse strain with one specific combination of genetic disrupts to one species of H2-D, H2-K, and H2-A genes that result in one specific phenotype of diabetes resistant and a lack of insulitis. The specification does not provide any guidance to making any other mutations that predictably lead to any other phenotypes and the art teaches a high degree of unpredictability in the impact of genetic background and gene mutation introduced by genetic modification, of which the specification fails to provide guidance to overcome.
Further, as discussed above, the specification teaches that the intended use of the claimed mouse is to make better T1D models with NOD mice that do not express the mouse MHC I and II class molecules so they can introduce human HLA molecules that are known to be associated with/responsible for symptoms of T1D. This intended use could only be carried out with a genetically modified NOD mouse that has a full disruption of MHC I and II class molecules. Otherwise, the mouse would not predictably serve as a humanized mouse model for T1D due to confounding effects of endogenous MHC I and II molecules. Further, a mouse with no phenotype or any other phenotype would not have an enabled use because such a mouse would not predictive of the roles that human MHC molecules in T1D.
Therefore at the time of filing the skilled artisan would need to perform an undue amount of experimentation without a predictable degree of success to implement the invention as claimed.
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARCIA STEPHENS NOBLE whose telephone number is (571)272-5545. The examiner can normally be reached M-F 9-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at 571-272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MARCIA S. NOBLE
Primary Examiner
Art Unit 1632
/MARCIA S NOBLE/Primary Examiner, Art Unit 1632