DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Acknowledgment is made of applicant’s claim for priority based on a provisional application filed as 63/127,212 on 12/18/2020.
All claims are given the priority date of 12/18/2020.
Application Status
Receipt is acknowledged of amendment, filed 04/21/2026. Claims 3, 12 and 34-47 are currently pending.
Election/Restriction
Applicant’s election without traverse of Group II, drawn to claims 3 and 12 in the reply filed on 04/21/2026 is acknowledged.
Claims 1, 2, 4-11 and 13-33 were canceled in the new claim set filed on 04/21/2026.
Claims 34-47 were newly added in the claim set filed on 04/21/2026 and drawn to the restriction election of claims 3 and 12.
Therefore, claims 3, 12 and 34-47 are currently under examination.
Information Disclosure Statement
Receipt of acknowledgment of the information disclosure statements filed on 06/14/2023, 06/28/2023, 11/21/2025 and 03/25/2026 have been received and all references have been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - Sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 3, 12 and 34-47 are rejected under 35 U.S.C. 103 as being unpatentable over Antonov et al (Genes. 2020; 11(12):1483 Pgs. 1-11) in view of Evers et al (Advanced Drug Delivery Reviews 87 (2015) 90-103).
Regarding claim 3, Antonov teaches antisense oligonucleotides to Neuro2a cells for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene (Page 6, Paragraphs 1-2; Page 8, Figure 4). Antonov teaches an evolutionarily conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase (Page 1, Abstract). Antonov teaches the use of the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression via direct hybridization with the target transcripts to determine the most efficient ASOs for targeting the Chaserr lncRNA (Page 3, Paragraphs 5-6; Page 4, Last paragraph). Instant SEQ ID NOs: 7 and 9 correspond with complementarity to the CHASERR lncRNA identified as GenBank Accession Number NR_037601.1 and therefore, would have been obvious to target using the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression and thus the use of the ASO showing complementarity to the target sequence (See Appendix I and II).
It would have been obvious to one of ordinary skill in the art to modify the ASOs of Antonov to include complementary of the ASO to the conserved motif of the Chaserr lncRNA for more stable and efficient targeting because Antonov teaches it is within the ordinary skill in the art to target conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase using ASO comprising the conserved motifs and therefore, would have been obvious to target using the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression and thus the use of the ASO showing complementarity to the target sequence. Therefore, one of ordinary skill in the art would have been motivated to use ASO sequences comprising complementarity to the conserved motifs for stable and efficient targeting of the Chaserr lncRNA.
Regarding claim 12, Antonov teaches antisense oligonucleotides to Neuro2a cells for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene (Page 6, Paragraphs 1-2; Page 8, Figure 4). Antonov teaches an evolutionarily conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase (Page 1, Abstract). Antonov teaches the use of the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression via direct hybridization with the target transcripts to determine the most efficient ASOs for targeting the Chaserr lncRNA (Page 3, Paragraphs 5-6; Page 4, Last paragraph).
It would have been obvious to one of ordinary skill in the art to modify the ASOs of Antonov to include complementary of the ASO to the conserved motif of the Chaserr lncRNA for more stable and efficient targeting because Antonov teaches it is within the ordinary skill in the art to target conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase using ASO comprising the conserved motifs. Therefore, one of ordinary skill in the art would have been motivated to use ASO sequences comprising complementarity to the conserved motifs for stable and efficient targeting of the Chaserr lncRNA.
Antonov does not specifically teach that the antisense oligonucleotide has a phosphorothioate backbone or one or more 2’-O-modifications.
Evers teaches antisense oligonucleotides are a common therapeutic for severe neurological disorders (Page 90, Abstract). Evers teaches that α-exonucleases are responsible for degradation of antisense oligonucleotides within the CSF which was initially combated with phosphorothioate (PS) backbone, however this resulted in the recruitment of RNase H activity which in turn resulted in destabilized duplexes and cytotoxic effects at high concentrations (Page 92, Column 2 bridging Page 93, Column 1). Evers teaches the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity (Page 93, Column 1 bridging Column 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Antonov to include the PS backbone modification in conjunction with the 2’ position modification of the antisense oligonucleotide to remove the RNase H recruitment as taught by Evers because Antonov teaches it is within the ordinary skill in the art to administering antisense oligonucleotides for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene and Evers teach the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity.
One would have been motivated to make such a modification in order to receive the expected benefit of increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity as taught by Evers.
Regarding claims 34-40, Antonov teaches antisense oligonucleotides to Neuro2a cells for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene (Page 6, Paragraphs 1-2; Page 8, Figure 4). Antonov teaches an evolutionarily conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase (Page 1, Abstract). Antonov teaches the use of the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression via direct hybridization with the target transcripts to determine the most efficient ASOs for targeting the Chaserr lncRNA (Page 3, Paragraphs 5-6; Page 4, Last paragraph).
It would have been obvious to one of ordinary skill in the art to modify the ASOs of Antonov to include complementary of the ASO to the conserved motif of the Chaserr lncRNA for more stable and efficient targeting because Antonov teaches it is within the ordinary skill in the art to target conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase using ASO comprising the conserved motifs. Therefore, one of ordinary skill in the art would have been motivated to use ASO sequences comprising complementarity to the conserved motifs for stable and efficient targeting of the Chaserr lncRNA.
Antonov does not specifically teach that the antisense oligonucleotide has a PS backbone and/or 2’-O-modifications selected from 2’ to 4’ bridge, 2’-methoxyethyl (2’-MOE) and 2’-OMe.
Evers teaches antisense oligonucleotides are a common therapeutic for severe neurological disorders (Page 90, Abstract). Evers teaches that α-exonucleases are responsible for degradation of antisense oligonucleotides within the CSF which was initially combated with phosphorothioate (PS) backbone, however this resulted in the recruitment of RNase H activity which in turn resulted in destabilized duplexes and cytotoxic effects at high concentrations (Page 92, Column 2 bridging Page 93, Column 1). Evers teaches the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity (Page 93, Column 1 bridging Column 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Antonov to include the PS backbone modification in conjunction with the 2’ position modification of the antisense oligonucleotide to remove the RNase H recruitment as taught by Evers because Antonov teaches it is within the ordinary skill in the art to administering antisense oligonucleotides for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene and Evers teach the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity.
One would have been motivated to make such a modification in order to receive the expected benefit of increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity as taught by Evers.
Regarding claims 41-47, Antonov teaches antisense oligonucleotides to Neuro2a cells for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene (Page 6, Paragraphs 1-2; Page 8, Figure 4). Antonov teaches an evolutionarily conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase (Page 1, Abstract). Antonov teaches the use of the AntiSense Search Approach (ASSA) tool to identify lncRNAs that were likely to regulate gene expression via direct hybridization with the target transcripts to determine the most efficient ASOs for targeting the Chaserr lncRNA (Page 3, Paragraphs 5-6; Page 4, Last paragraph).
It would have been obvious to one of ordinary skill in the art to modify the ASOs of Antonov to include complementary of the ASO to the conserved motif of the Chaserr lncRNA for more stable and efficient targeting because Antonov teaches it is within the ordinary skill in the art to target conserved lncRNA CHASERR (AC013394.2 or LINC01578) that regulate target genes co-transcriptionally via interaction with a nascent transcript by directing CHD2 helicase using ASO comprising the conserved motifs. Therefore, one of ordinary skill in the art would have been motivated to use ASO sequences comprising complementarity to the conserved motifs for stable and efficient targeting of the Chaserr lncRNA.
Antonov does not specifically teach that the antisense oligonucleotide has a PS backbone and/or 2’-O-modifications selected from 2’ to 4’ bridge, 2’-methoxyethyl (2’-MOE) and 2’-OMe.
Evers teaches antisense oligonucleotides are a common therapeutic for severe neurological disorders (Page 90, Abstract). Evers teaches that α-exonucleases are responsible for degradation of antisense oligonucleotides within the CSF which was initially combated with phosphorothioate (PS) backbone, however this resulted in the recruitment of RNase H activity which in turn resulted in destabilized duplexes and cytotoxic effects at high concentrations (Page 92, Column 2 bridging Page 93, Column 1). Evers teaches the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity (Page 93, Column 1 bridging Column 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Antonov to include the PS backbone modification in conjunction with the 2’ position modification of the antisense oligonucleotide to remove the RNase H recruitment as taught by Evers because Antonov teaches it is within the ordinary skill in the art to administering antisense oligonucleotides for targeting a CHASERR (GenBank Accession Number NR_037601.1 identified as LINC01578 as a gene synonym and derived from AC013394.2) lncRNA, wherein the targeting of the CHASERR lncRNA by different ASOs resulted in the increased expression of the CHD2 gene and Evers teach the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity.
One would have been motivated to make such a modification in order to receive the expected benefit of increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity as taught by Evers.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 3, 12 and 34-47 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 34-40 and 43-48 of copending Application No. 19/310,181 (Referred to as ‘181) in view of Evers et al (Advanced Drug Delivery Reviews 87 (2015) 90-103).
Regarding the ‘181 application, although the claims at issue are not identical, they are not patentably distinct from each other because claim 34 of the ‘181 application recites “a method for increasing levels of Chromodomain Helicase DNA Binding Protein 2 (CHD2) in neuronal cells of a subject having CHD2 haploinsufficiency, the method comprising administering an RNA antisense oligonucleotide complementary to human Chaserr and including complementarity to a conserved motif of human Chaserr”; claim 35 of ‘181 recites “wherein the RNA antisense oligonucleotide targets the sequence AAGATGGCAGTCTACTATGG (SEQ ID NO: 8), with the proviso that thymine nucleobases are uracil nucleobases”; claim 36 of ‘181 recites “wherein the RNA antisense oligonucleotide has the nucleobase sequence of CCATAGTAGACTGCCATCTT (SEQ ID NO: 7), with the proviso that thymine nucleobases can optionally be replaced with uracil nucleobases and cytosine nucleobases can optionally be 5-methylcytosine”; claim 43 of ‘181 recites “wherein the RNA antisense oligonucleotide targets the sequence CACAAATGGACAGTGGAT (SEQ ID NO: 10), with the proviso that thymine nucleobases are uracil nucleobases”; claim 44 of ‘181 recites “wherein the RNA antisense oligonucleotide has the nucleobase sequence of ATCCACTGTCCATTTGTG (SEQ ID NO: 9), with the proviso that thymine nucleobases can optionally be replaced with uracil nucleobases and cytosine nucleobases can optionally be 5-methylcytosine”. Wherein compared to the instant application, claim 3 recites “a nucleic acid agent, wherein the nucleic acid agent is an antisense oligonucleotide directed at the last exon of human chaserr, and wherein the nucleic acid agent consists of the nucleobase sequence of CCATAGTAGACTGCCATCTT (SEQ ID NO: 7) or ATCCACTGTCCATTTGTG (SEQ ID NO: 9) with the proviso that thymine nucleobases can optionally be replaced with uracil nucleobases and cytosine nucleobases can optionally be replaced with 5-methylcytosine”; claim 34 recites “wherein the nucleic acid agent consists of the nucleobase sequence of CCATAGTAGACTGCCATCTT (SEQ ID NO: 7), with the proviso that thymine nucleobases can optionally be replaced with uracil nucleobases and cytosine nucleobases can optionally be replaced with 5-methylcytosine”; claim 40 recites “The nucleic acid agent of claim 34, and consisting of SEQ ID NO: 128” which is 100% identical to instant SEQ ID NO: 7 and SEQ ID NO:7 of application ‘181; claim 41 recites “wherein the nucleic acid agent consists of the nucleobase sequence of ATCCACTGTCCATTTGTG (SEQ ID NO: 9), with the proviso that thymine nucleobases can optionally be replaced with uracil nucleobases and cytosine nucleobases can optionally be replaced with 5-methylcytosine”; and claim 47 recites “The nucleic acid agent of claim 41, and consisting of SEQ ID NO: 134” which is 100% identical to instant SEQ ID NO: 9 as well as SEQ ID NO: 9 of application ‘181.
claims 35 and 42 recite “wherein the nucleic acid agent does not recruit RNaseH”
Claims 37 and 45 of ‘181 recites “wherein the RNA antisense oligonucleotide has a phosphorothioate backbone” and wherein compared to claims 36 and 43 of the instant application which recite “wherein the nucleic acid agent has a phosphorothioate backbone”. Therefore, claims 36 and 43 are not patentably distinct from claims 37 and 45 of ‘181.
Claims 38 and 46 of ‘181 recites “wherein the RNA antisense oligonucleotide has one or more 2'-O modifications” and wherein compared to claim 12 of the instant application which recites “wherein said nucleic acid agent comprises one or more nucleotides having a 2’ to 4’ bridge, and/or one or more nucleotides having a 2’-O modification” and claims 37 and 44 of the instant application which recite “wherein the nucleic acid agent has one or more 2'-O modifications”. Therefore, claims 37 and 44 are not patentably distinct from claims 38 and 46 of ‘181.
Claims 39 and 47 of ‘181 recites “wherein the 2'-O modifications are selected from a 2' to 4' bridge, 2'-methoxyethyl (2'-MOE), and 2'-OMe” and wherein compared to claims 38 and 45 of the instant application which recite “wherein the 2'-O modifications are selected from a 2' to 4' bridge, 2'-methoxyethyl (2'-MOE), and 2'OMe”. Therefore, claims 38 and 45 are not patentably distinct from claims 39 and 47 of ‘181.
Claims 40 and 48 of ‘181 recites “wherein the RNA antisense oligonucleotide comprises a phosphorothioate backbone and 2'-O modifications selected from locked nucleic acid (LNA), constrained ethyl (cEt), 2'-MOE, and 2'-OMe” and wherein compared to claims 39 and 46 of the instant application which recite “wherein the antisense oligonucleotide comprises a phosphorothioate backbone and 2'-O modifications selected from locked nucleic acid (LNA), constrained ethyl (cEt), 2'-MOE, and 2'-OMe”. Therefore, claims 39 and 46 are not patentably distinct from claims 40 and 48 of ‘181.
The claims of ‘181 do not specifically require that no RNase His used. However, Evers teaches antisense oligonucleotides are a common therapeutic for severe neurological disorders (Page 90, Abstract). Evers teaches that α-exonucleases are responsible for degradation of antisense oligonucleotides within the CSF which was initially combated with phosphorothioate (PS) backbone, however this resulted in the recruitment of RNase H activity which in turn resulted in destabilized duplexes and cytotoxic effects at high concentrations (Page 92, Column 2 bridging Page 93, Column 1). Evers teaches the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity (Page 93, Column 1 bridging Column 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of ‘181 to include the PS backbone modification in conjunction with the 2’ position modification of the antisense oligonucleotide to remove the RNase H recruitment as taught by Evers because Evers teaches it is within the ordinary skill in the art to the PS backbone modification in conjunction with the 2’ position modification, specifically the 2’-O-Methyl and 2’-O-methoxy-ethyl, showed increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity. One would have been motivated to make such a modification in order to receive the expected benefit of increased resistance towards nuclease degradation, reduced sequence independent toxicity and did not recruit RNase H activity, thus reducing cytotoxicity as taught by Evers.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA ROSE LIPPOLIS whose telephone number is (703)756-5450. The examiner can normally be reached Monday-Friday, 8:00am to 5:00pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEXANDRA ROSE LIPPOLIS/Examiner, Art Unit 1637
/CELINE X QIAN/Primary Examiner, Art Unit 1637
Prosecution Insights