Prosecution Insights
Last updated: October 04, 2026
Application No. 18/336,276

EXPRESSION OF FOXP3 IN EDITED CD34+ CELLS

Non-Final OA §103§DP
Filed
Jun 16, 2023
Priority
Apr 27, 2018 — provisional 62/663,545 +2 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children's Hospital (dba Seattle Children's Research Institute)
OA Round
3 (Non-Final)
38%
Grant Probability
At Risk
3-4
OA Rounds
9m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
285 granted / 750 resolved
-22.0% vs TC avg
Strong +53% interview lift
Without
With
+52.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
52 currently pending
Career history
813
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
38.7%
-1.3% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 750 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/20/2026 has been entered. Amended claims 2 and 4-23 are pending in the present application. Applicant elected previously without traverse the following species: (i) located in a FOXP3 gene; (ii) an MND promoter; and (iii) further comprising a nucleic acid encoding a chimeric antigen receptor. Claims 9-10, 12, 18-19 and 21 were withdrawn previously from further considerations because they are directed to non-elected species. Accordingly, amended claims 2, 4-8, 11, 13-17, 20 and 22-23 are examined on the merits herein with the above elected species. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Amended claims 2, 4-6, 8, 11, 13-15, 17, 20 and 22-23 are rejected under 35 U.S.C. 103 as being unpatentable over Marson et al (WO 2016/123578; IDS) in view of Goodwin et al (Molecular Therapy 24, S51-S52, Abstract 123, 2016; IDS), Havens et al (WO 2018/035141; IDS), Hubbard et al (Molecular Therapy 24, Supplement 1, Abstract 40, 2016; IDS), Kohn et al (US 2020/0347404 with an effective filing date of 08/22/2017; IDS) and UniProtKB/Swiss-Protein Accession No. Q9BZS1 (2001). This is a slightly modified rejection. With respect to the elected species, the instant claims are directed to a CD34+ cell comprising a constitutive promoter, preferably MND promoter (elected species), operably linked to a polynucleotide sequence lacking introns and encoding a forkhead box protein P3 (or FOXP3 cDNA) flanked by a first homology arm and a second homology arm having homology to a FOXP3 locus, wherein the promoter and the polynucleotide sequence are located in a FOXP3 locus (elected species), and wherein the encoded FOXP3 comprises at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 (1293-nucleotide sequence). Marson et al already taught a method of editing the genome of a primary hematopoietic cell (e.g., an immune cell such as a T cell, B cell, macrophage or dendritic cell) or a primary hematopoietic stem cell (e.g., human CD34+,CD59+,Thy1/CD90+, CD38lo/-, C-kit/CD117+, lin- hematopoietic stem cell), the method comprising introducing a Cas9 nuclease domain inside the cell, wherein the Cas9 nuclease domain forms a complex with a guide RNA inside the cell (e.g., the guide RNA is encoded by a DNA) or introducing a Cas9 ribonucleoprotein complex comprising a Cas9 nuclease domain and a guide RNA inside the cell, wherein the guide RNA specifically hybridizes to any target region of the genome of the cell; and wherein the method further comprises introducing the double or single-stranded oligonucleotide DNA template inside the cell (Abstract; Brief Summary of the Invention; particularly paragraphs [0003]-[0004], [0011], [0041]-[0042], [0046]-[0047], [0100], [0111], [0114]-[0115], [0121], [0131]; and Fig. 1A). Marson et al stated “In some embodiments, the primary hematopoietic cell or a primary hematopoietic stem cell is modified to express a heterologous protein either before, during, or after the genome of the cell is edited as described above or elsewhere herein. In some embodiments, the heterologous protein is encoded by a viral (e.g., a lentiviral) vector. In some embodiments, the heterologous protein is a chimeric antigen receptor (CAR) protein or a heterologous T-cell receptor (TCR), including but not limited to a rearranged TCR” (paragraph [0003]). Marson et al also taught specifically that hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof (paragraph [0037]). Marson et al disclosed that the template nucleic acid can contain from 15 bases to about 5 kilobases in length, and that longer template nucleic acids are provided in the form of a circular or linearized plasmid or as a component of a vector such as a component of a viral vector (paragraph [0100]). Marson et al also taught that template oligonucleotides can contain one or two homology arms (about 25-120 nucleotides in length) that are identical or substantially identical to a region adjacent to or flanking the target cut site (paragraph [0100]). Marson et al stated explicitly “As another example, the template nucleic acid can encode a wild-type sequence for rescuing the expression level or activity of a target endogenous gene or protein. For instance, T cells containing a mutation in the FoxP3 gene, or a promoter region thereof, can be rescued to treat X-linked IPEX or systemic lupus erythematous” (paragraph [0105]); and “Exemplary target genomic regions include genes containing mutations that are implicated in, associated with, or cause disease. For example, a target genomic region at or near the gene encoding FOXP3 can be targeted to increase or rescue FOXP3 function and thereby treat patients suffering from an autoimmune disease such as IPEX” (paragraph [0114]). Marson et al also taught that the template nucleic acid can encode an inducible promoter or repressor element unrelated to the endogenous promoter of a target gene to be inserted into the promoter region of a target gene to provide temporal and/or spatial control of the target gene expression or activity; or in another example the template nucleic acid can encode a reporter gene that can be used to monitor the number, location, and activity of cells in vitro or in vivo after introduction into a host (paragraph [0107]). In an exemplification, Marson et al demonstrated successfully the use of Cas9RNPs to target FOXP3 in stimulated human naïve T cells and Tregs to model the functional impairment of Treg differentiation in patients with IPEX (paragraphs [0144]-[0147]; and Figs. 3-4). In discussing generically a polypeptide or protein, Marson et al taught a conservatively modified variant which is altered by the substitution of an amino acid with a chemically similar amino acid, and conservative substitution tables providing functionally similar amino acids are well known in the art (paragraphs [0029] and [0031]-[0032]). Marson et al did not teach explicitly using at least a donor template comprising an MND promoter operably linked to a FOXP3 cDNA sequence encoding a FOXP3 having at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 (e.g., a wild-type human FOXP3), including a codon-optimized FOXP3 cDNA sequence, to be inserted in a FOXP3 locus in a CD34+ cell via HDR. Before the effective filing date of the present application (4/27/2018), Goodwin et al already taught a strategy to functionally correct the FOXP3 gene in immune-dysregulation polyendocrinopathy-enteropathy-X-linked (IPEX) syndrome patient cells using on-target, homology directed repair (HDR)-mediated insertion of the FOXP3 coding sequence into the gene locus (via targeting the FOXP3 gene using a CRISPR system comprised of Cas9 mRNA and chemically modified sgRNAs) due to the presence of disease causative mutations throughout the entire FOXP3 gene. Goodwin et al reported that high targeting frequencies, reaching 70-80% in human primary CD4+ T cells, was attained; and they also used this CRISPR system in combination with a repair donor DNA template delivered with AAV to demonstrate FOXP3 gene correction to human CD34+ hematopoietic stem and progenitor cells (HSPCs). Goodwin et al also stated “These results will help demonstrate the feasibility of FOXP3 gene editing, which we propose for the translational application of autologous transplant of Tregs and HSPCs as a therapy for IPEX syndrome”. Additionally, Havens et al also taught using a donor repair template for integration into the IL-10Rα gene by homology directed repair (HDR) at a DNA double stranded break (DSB) site mediated by a meganuclease variant or a megaTAL in a T cell, including in a regulatory T cell, wherein the donor repair template encodes a FOXP3 and it comprises a 5’ homology arm to a human IL-10Rα gene sequence 5’ of the DSB and a 3’ homology arm homologous to a human IL-10Rα gene sequence 3’ to the DSB, and wherein the donor repair template is introduced in the form of a viral vector such as a recombinant adeno-associated viral vector (rAAV) or a retrovirus (e.g., a lentivirus) (Brief Summary, particularly page 8, lines 9-18; page 9, lines 4-21; page 10, lines 1-3, line 18 continues to line 8 on page 11; page 17, lines 10-21; page 46, lines 1-26; page 47, lines 22-30; page 49, lines 12-14). Havens et al stated clearly “Without wishing to be bound by any particular theory, it is contemplated that T cells or Tregs that comprise an edited IL-10Rα gene comprising a polynucleotide encoding a polypeptide that enhances Treg function expressed from the IL-10Rα promoter or an exogenous promoter inserted into the IL-10Rα gene are more stable Tregs that are more therapeutically efficacious in maintaining graft-versus-leukemia (GVL) activity,…treating graft-versus-host-disease (GVHD)…autoimmune disease” (page 17, lines 13-21); and “Donor repair templates may further comprises one or more polynucleotides such as promoters and/or enhancers, untranslated regions (UTRs), Kozak sequences, polyadenylation signals, additional restriction sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals, and polynucleotides encoding self-cleaving polypeptides, epitope tags, contemplated elsewhere herein. In various embodiments, the donor repair template comprises a 5’ homology arm, an RNA polymerase II promoter, one or more polynucleotides encoding a therapeutic gene or fragment thereof, transgene or selectable marker, and a 3’ homology” (page 47, lines 22-30). Exemplary exogenous promoters include EF1a-short promoter, EF1a-long promoter, PGK promoter, CAG promoter, MND promoter among others (page 72, lines 3-17). In discussing generically a polypeptide or protein, Havens et al also taught a variant containing one or more conservative substitutions, wherein a “conservative substitution” is one in which an amino acid is substituted for another amino acid that has similar properties, such that one skilled in the art of peptide chemistry would expect the secondary structure and hydropathic nature of the polypeptide to be substantially unchanged (last paragraph at page 49; page 52, line 13 continues to line 13 at page 54). Moreover, Hubbard et al also disclosed nuclease-targeted gene-editing of FOXP3 in primary T cells using an AAV delivered donor repair templates with an MND promoter upstream of the first coding exon. Hubbard et al stated “Introduction of the MND promoter resulted in the greatest levels of cellular FOXP3 expression (MFI)….Thus, our gene modification strategy allowed us to over-ride (using the MND promoter) or modulate (by deleting CNS elements) endogenous FOXP3 regulatory mechanisms to enforce stable, long term FOXP3 expression in T cells that were not previously committed to the Treg lineage. This approach, used alone or in combination with selection for disease-relevant TCR specificity or with delivery of a chimeric antigen receptor, is likely to be broadly applicable for producing stable, functional active Tregs for a range of future clinical applications”. Additionally, Kohn et al already taught lentivirus vectors expressing FOXP3 in hematopoietic stem cells, including the use of codon-optimized FOXP3 gene or cDNA to treat genetic deficiencies of FOXP3 (e.g., IPEX disease) or other auto-immune and auto-inflammatory conditions (see at least Summary; particularly paragraphs [0007]-[0011], [0029]-[0036] and [0070]). Fig. 6 illustrates the structure of the pCCL-CNSp-FOXP3-3UTR-A2 vector (SEQ ID NO: 1) comprising the FOXP3 cDNA (1292 bp) based on human genomic NCBI reference sequence file NM_01009 (paragraph [0057]; SEQ ID NO: 1 and Fig. 6). Furthermore, before the effective filing date of the present application the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 has the amino acid sequence that is 100% identical to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 of the present application (see attached sequence search below). Accordingly, it would have been obvious to one of ordinary skill in the art at the time the invention was made to modify the teachings of Marson et al by also utilize at least a donor template comprising a constitutive promoter such as the MND promoter operably linked to a cDNA sequence (a polynucleotide lacking introns) encoding a human FOXP3 having an amino acid sequence at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 of the present application (e.g., including a codon-optimized FOXP3 cDNA sequence), to be integrated into a FOXP3 gene locus by homology directed repair at a DSB site meditated by a CRISPR-Cas9 ribonucleotide complex in a primary CD34+ human hematopoietic stem cell obtained from an IPEX patient for genome editing and rescuing expression level or activity of FOXP3, in light of the teachings of Goodwin et al, Havens et al, Hubbard et al, Kohn et al and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 as presented above. An ordinary skill in the art would have been motivated to carry out the above modifications because: (i) Goodwin et al already taught a strategy to functionally correct the FOXP3 gene in immune-dysregulation polyendocrinopathy-enteropathy-X-linked (IPEX) syndrome patient cells (e.g., human CD34+ HSPCs) using on-target, homology directed repair (HDR)-mediated insertion of the FOXP3 coding sequence in repair donor template delivered with an AAV into the gene locus (via targeting the FOXP3 gene using a CRISPR system comprised of Cas9 mRNA and chemically modified sgRNAs) due to the presence of disease causative mutations throughout the entire FOXP3 gene; (ii) Havens et al also taught using a donor repair template for integration into the IL-10Rα gene by homology directed repair (HDR) at a DNA double stranded break (DSB) site mediated by a meganuclease variant or a megaTAL in a regulatory T cell, wherein the donor repair template encodes a FOXP3, the donor repair template comprises a 5’ homology arm, an RNA polymerase II promoter, one or more polynucleotides encoding a therapeutic gene or fragment thereof, transgene or selectable marker, and a 3’ homology; along with an MND promoter as an exemplary exogenous promoter; (iii) Hubbard et al also taught the use of MND promoter in a nuclease-targeted gene-editing of FOXP3 in primary T cell resulted in the greatest levels of cellular FOXP3 expression as well as stable, long term FOXP3 expression in T cells; (iv) Kohn et al already taught successfully lentivirus vectors expressing FOXP3 in hematopoietic stem cells, including the use of codon-optimized FOXP3 gene or cDNA to treat genetic deficiencies of FoxP3 (e.g., IPEX disease) or other auto-immune and auto-inflammatory conditions; and (v) the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 in the prior art already has the amino acid sequence that is 100% identical to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 of the present application. Additionally, both Marson et al and Havens et al also taught the use of a polypeptide or protein variant containing one or more conservative substitutions; and in this instance a human FOXP3 having an amino acid sequence at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110 of the present application with a conservative amino acid substitution. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Marson et al, Goodwin et al, Havens et al, Hubbard et al, Kohn et al and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified CD34+ cell resulting from the combined teachings of Marson et al, Goodwin et al, Havens et al, Hubbard et al, Kohn et al and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 as set forth above is indistinguishable and encompassed by the presently claimed invention. Thus, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Response to Arguments Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 03/20/2026 (pages 3-7) have been fully considered, but they are respectfully not found persuasive for the following reasons. Applicant argued that the cited combination of references does not teach the limitation “a forkhead box protein P3 (FOXP3) flanked by a first homology arm and a second homology arm having homology to a FOXP3 locus, an associated virus site (AAVS1) locus, or a T cell receptor alpha (TRA) locus, wherein the promoter and the polynucleotide sequence are located between the first homology arm and the second homology arm” of currently amended claims. Specifically, with respect to Marson Applicant argued that Marson does not teach the specific architecture of the instant claims, and Mason discloses either targeted gene disruption or insertion of only a short oligonucleotide at the target site. With respect to Goodwin, Applicant argued that Goodwin generally relates to correcting mutations in the FOXP3 gene, but Goodwin does not teach or suggest at least inserting a donor template comprising a constitute promoter and a FOXP3-encoding nucleotide sequence lacking introns. With respect to Havens, Applicant argued that Havens relates to gene editing methods to target and edit human interleukin-10 receptor 1 alpha (IL10RA) gene, but does not teach or suggest the elements as recited in the present claims. With respect to Hubbard, Applicant argued that Hubbard discloses using a combination of TALEN-mediated gene disruption and adeno-associated virus (AAV) delivered donor repair templates to introduce an MND promoter upstream of the first coding exon of FOXP3, in which the donor templates were also designed to co-express FOXP3 with either GFP or EGFRt. With respect to Kohn, Applicant argued that Kohn relates to transduction of cells with lentiviral expression vectors containing a FOXP3 cDNA, and vectors containing a constitutively active promoter impaired HSPC function (paragraphs [0140]-[0141]; Fig. 8D). Finally, Applicant argued that UniProt does not remedy the foregoing deficiencies since UniPro merely provides the wild-type human FOXP3 protein sequence (Q9BZS1). Accordingly, a person of ordinary skill in the art would not be motivated to arrive at the present invention as none of the cited references provide the requisite guidance in arriving at the present invention. First, since the above rejection was made under 35 U.S.C. 103 none of the cited references individually has to teach every limitation of the instant claims. For example, none of Marson, Goodwin, and Hubbard have to teach a constitutive promoter and a polynucleotide sequence lacking introns and encoding FOXP3 (FOXP3 cDNA sequence) are located between a first homology arm and a second homology arm having homology to a FOXP3 locus/gene (elected species); nor does Havens have to teach editing FOXP3 locus of a primary hematopoietic stem cell with their disclosed donor repair template comprising a 5’ homology arm, an RNA polymerase II promoter, one or more polynucleotides encoding a therapeutic gene or fragment thereof, transgene, or selectable marker, and a 3’ homology. Moreover, it is apparent that Applicant considered each of the cited references in total isolation one from the others, without taking into considerations of the specific combined teachings of Marson, Goodwin, Havens, Hubbard, Kohn and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1. Second, the combination of Marson, Goodwin, Havens, Hubbard, Kohn and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 does teach every limitation of currently amended claims. Please refer to the above modified rejection for details, particularly the motivations provided for combining the cited references. Third, the teachings of Marson are not necessarily limited only to working examples. Marson disclosed that the template nucleic acid can contain from 15 bases to about 5 kilobases in length, and that longer template nucleic acids are provided in the form of a circular or linearized plasmid or as a component of a vector such as a component of a viral vector (paragraph [0100]). Marson also taught that template oligonucleotides can contain one or two homology arms (about 25-120 nucleotides in length) that are identical or substantially identical to a region adjacent to or flanking the target cut site (paragraph [0100]). Marson stated explicitly “As another example, the template nucleic acid can encode a wild-type sequence for rescuing the expression level or activity of a target endogenous gene or protein. For instance, T cells containing a mutation in the FoxP3 gene, or a promoter region thereof, can be rescued to treat X-linked IPEX or systemic lupus erythematous” (paragraph [0105]). Fourth, Goodwin clearly taught a strategy to functionally correct the FOXP3 gene in immune-dysregulation polyendocrinopathy-enteropathy-X-linked (IPEX) syndrome patient cells using on-target, homology directed repair (HDR)-mediated insertion of the FOXP3 coding sequence into the gene locus (via targeting the FOXP3 gene using a CRISPR system comprised of Cas9 mRNA and chemically modified sgRNAs) due to the presence of disease causative mutations throughout the entire FOXP3 gene. This is a specific teaching to insert a full-length wild-type FOXP3 coding sequence into the FOXP3 locus, rather than gene editing for each individual mutation throughout the entire FOXP3 gene. Fifth, the Havens reference was cited because Havens already disclosed a donor repair template comprising a 5’ homology arm, an RNA polymerase II promoter, one or more polynucleotides encoding a therapeutic gene or fragment thereof, transgene or selectable marker, and a 3’ homology for integration into the IL-10Rα locus by homology directed repair (HDR) at a DNA double stranded break (DSB) site mediated by a meganuclease variant or a megaTAL (page 47, lines 22-30). Exemplary exogenous promoters include EF1a-short promoter, EF1a-long promoter, PGK promoter, CAG promoter, MND promoter among others (page 72, lines 3-17); and the donor repair template can also encode a FOXP3 (lines 16-18 at page 8; lines 1-3 at page 10; and lines 12-14 at page 49). Sixth, Hubbard stated “Introduction of the MND promoter resulted in the greatest levels of cellular FOXP3 expression (MFI)….Thus, our gene modification strategy allowed us to over-ride (using the MND promoter) or modulate (by deleting CNS elements) endogenous FOXP3 regulatory mechanisms to enforce stable, long term FOXP3 expression in T cells that were not previously committed to the Treg lineage”. This provides a motivation why an ordinary skill in the art would particularly select MND promoter as an exogenous promoter to express a full-length wild-type FOXP3 cDNA to attain maximal levels of FOXP3 expression. Seventh, Kohn was cited primarily to supplement the combined teachings of Marson, Goodwin, Havens, Hubbard, and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS for the use of codon-optimized FOXP3 gene or cDNA to treat genetic deficiencies of FOXP3 (e.g., IPEX disease), including the use of FOXP3 cDNA (1292 bp) based on human genomic NCBI reference sequence file NM_01009. With respect to the suggestion that ectopic expression of FOXP3 in HSPC negatively affects hematopoiesis, it is noted that Kohn only used MNDU3 promoter which is a modified U3 region from the Myeloproliferative Sarcoma Virus (MPSV) long terminal repeat (LTR) to drive FOXP3 expression, and not the elected MND promoter (see Hubbard teachings). Additionally, the random insertion mediated by a recombinant lentiviral vector may also play a role, instead of a stable on-target, homology directed repair (HDR)-mediated insertion of a FOXP3 coding sequence into the FOXP3 gene locus at a DNA double stranded break (DSB) site mediated by a sequence-specific endonuclease. Eighth, the UniProtKB/Swiss-Protein Accession No. Q9BZS was cited to supplement the combined teachings of Marson, Goodwin, Havens, Hubbard, and Kohn for the limitation “the encoded FOXP3 comprises at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110” as required by the instant claims. Ninth, an ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Marson, Goodwin, Havens, Hubbard, Kohn and the wild-type human FOXP3 protein with the UniProtKB/Swiss-Protein Accession No. Q9BZS1 as set forth in the above 103 rejection; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. Moreover, please note that the standard under 35 U.S.C. is a “reasonable” expectation of success. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Amended claims 2, 4-8, 11, 13-17, 20 and 22-23 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 (reference application) in view of Zinigapflucker et al (WO 2010/051634) and Cooper et al (WO 2014/186469). This is a new ground of rejection. Claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 are drawn to a method of modifying a lymphocytic cell, the method comprising delivering to a lymphocytic cell: (i) a donor template comprising: a) a first homology arm having homology to a nucleotide sequence in a FOXP3 gene, AAVS1 gene, or TRAC gene in the lymphocytic cell; b) a second homology arm having homology to a nucleotide sequence in the same locus as the first homology arm; c) a heterologous constitutive promoter (e.g., an MND promoter; dependent claim 48); and d) a nucleotide sequence lacking introns and encoding a FOXP3 polypeptide, wherein the FOXP3 polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 68 having 0 to 43 amino acid substitutions, wherein a substitution in the amino acid sequence is a conservative amino acid substitution, wherein the heterologous promoter and the nucleotide sequence encoding the FOXP3 polypeptide are located between the first homology arm and second homology arm; and (ii) a DNA endonuclease or a nucleic acid encoding the DNA endonuclease. It is noted that SEQ ID NO: 68 is identical to SEQ ID NO: 110 of the present application (see attached sequence search below). The instant claims differ from claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 in reciting specifically the limitation “A CD34+ cell comprising a constitutive promoter operably linked to a polynucleotide sequence lacking introns and encoding a forkhead box protein P3 (FOXP3) flanked by a first homology arm and a second homology arm having homology to a FOXP3 locus, an adeno-associated virus site 1 (AAVS1) locus, or a T cell receptor alpha (TRA) locus, wherein the promoter and the polynucleotide sequence are located between the first homology arm and the second homology arm, wherein the promoter and the polynucleotide sequence are located in a FOXP3 locus, adeno-associated virus site 1 (AAVS1) locus, or T cell receptor alpha (TRA) locus in the CD34+ cell, and wherein the encoded FOXP3 comprises at least 90% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 110”; “wherein the polynucleotide sequence comprises at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 110” (dependent claims 7 and 16); and “wherein the CD34+ cell further comprises a nucleic acid encoding a chimeric antigen receptor” (dependent claims 11 and 20). Before the effective filing date of the present application (04/27/2018), Zunigapflucker et al already disclosed an isolated progenitor T cell having the phenotype CD34+CD7+CD1a-, and the use of human progenitor T cells in various applications that include immune reconstitution and treatment of conditions requiring an increase T cells as carriers for genes used in gene therapy (see at least Summary; particularly paragraphs [0013]-[0015]). Please note that progenitor T cells are lymphocytic cells. Additionally, Cooper et al also disclosed compositions for immunotherapy using modified T cells (e.g., T-cells or T-cell progenitors) comprising a nucleic acid encoding chimeric T-cell receptor (CAR) that is capable of integration into the genome of the cells, wherein CAR cells are used to treat a wide range of diseases and conditions (e.g., infections and cancers) (see at least Abstract; particularly paragraphs [0006], [0015], [0021] and [0023]). Accordingly, it would have been obvious for an ordinary skilled artisan to modify a method of modifying a lymphocytic cell in claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 by also selecting a progenitor T cell having the phenotype CD34+CD7+CD1a- as a lymphocytic cell for modification, as well as using the polynucleotide comprises at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 68 which is 100% identical to SEQ ID NO: 110 of the present application and/or the progenitor T cell further comprising a nucleic acid encoding a CAR; in light of the teachings of Zunigapflucker et al and Cooper et al as presented above with a reasonable expectation of success; and such modified method would result in the generation of a CD34+ cell of the present application. An ordinary skilled artisan would have been motivated to carry out the modifications because: (i) Zunigapflucker et al already disclosed an isolated progenitor T cell having the phenotype CD34+CD7+CD1a-, which is a lymphocytic cell; and (ii) Cooper et al also disclosed compositions for immunotherapy using modified T cells (e.g., T-cells or T-cell progenitors) comprising a nucleic acid encoding chimeric T-cell receptor (CAR) that is capable of integration into the genome of the cells. Please also note that claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 already encompass the use of a nucleotide sequence lacking introns and encoding a FOXP3 polypeptide, wherein FOXP3 polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 68 having 0 to 43 conservative amino acid substitutions. The genetically modified CD34+ lymphocytic cell resulting from the method of modifying a lymphocytic cell in claims 28, 30-34, 37, 48, 50, 52-55 and 57 of copending Application No. 16/981,213 along with the teachings of Zunigapflucker et al and Cooper et al is indistinguishable and encompassed by the claimed CD34+ cell of the present application. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Ebert et al (US 2010/0143359) taught that the skilled artisan would realize that conservative amino acid substitutions may be made in immunogenic FoxP3 polypeptides to provide functionally equivalent variants or homologs (see at least paragraph [0089]). Conclusions No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 FOXP3_HUMAN AC: Q9BZS1; A5HJT1; B7ZLG0; B9UN80; O60827; Q14DD8; Q4ZH51; 20-JUN-2001, integrated into UniProtKB/Swiss-Prot. Alignment Scores: Length: 431 Score: 2312.00 Matches: 431 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 96.2% Indels: 0 Gaps: 0 US-18-336-276-110 (1-1293) x FOXP3_HUMAN (1-431) Qy 1 ATGCCTAATCCTCGGCCTGGAAAGCCTAGCGCTCCTTCTCTTGCTCTGGGACCTTCTCCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 MetProAsnProArgProGlyLysProSerAlaProSerLeuAlaLeuGlyProSerPro 20 Qy 61 GGCGCCTCTCCATCTTGGAGAGCCGCTCCTAAAGCCAGCGATCTGCTGGGAGCTAGAGGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21 GlyAlaSerProSerTrpArgAlaAlaProLysAlaSerAspLeuLeuGlyAlaArgGly 40 Qy 121 CCTGGCGGCACATTTCAGGGCAGAGATCTTAGAGGCGGAGCCCACGCTAGCTCCTCCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 41 ProGlyGlyThrPheGlnGlyArgAspLeuArgGlyGlyAlaHisAlaSerSerSerSer 60 Qy 181 CTTAATCCTATGCCTCCTAGCCAGCTCCAGCTGCCTACACTGCCTCTGGTTATGGTGGCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 LeuAsnProMetProProSerGlnLeuGlnLeuProThrLeuProLeuValMetValAla 80 Qy 241 CCTAGCGGAGCTAGACTGGGCCCTCTGCCTCATCTGCAAGCTCTGCTGCAGGACAGACCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 81 ProSerGlyAlaArgLeuGlyProLeuProHisLeuGlnAlaLeuLeuGlnAspArgPro 100 Qy 301 CACTTCATGCACCAGCTGAGCACCGTGGATGCCCACGCAAGAACACCTGTGCTGCAGGTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 101 HisPheMetHisGlnLeuSerThrValAspAlaHisAlaArgThrProValLeuGlnVal 120 Qy 361 CACCCTCTGGAATCCCCAGCCATGATCAGCCTGACACCTCCAACAACAGCCACCGGCGTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 HisProLeuGluSerProAlaMetIleSerLeuThrProProThrThrAlaThrGlyVal 140 Qy 421 TTCAGCCTGAAAGCCAGACCTGGACTGCCTCCTGGCATCAATGTGGCCAGCCTGGAATGG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 141 PheSerLeuLysAlaArgProGlyLeuProProGlyIleAsnValAlaSerLeuGluTrp 160 Qy 481 GTGTCCAGAGAACCTGCTCTGCTGTGCACATTCCCCAATCCAAGCGCTCCCAGAAAGGAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 161 ValSerArgGluProAlaLeuLeuCysThrPheProAsnProSerAlaProArgLysAsp 180 Qy 541 AGCACACTGTCTGCCGTGCCTCAGAGCAGCTATCCCCTGCTTGCTAACGGCGTGTGCAAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 SerThrLeuSerAlaValProGlnSerSerTyrProLeuLeuAlaAsnGlyValCysLys 200 Qy 601 TGGCCTGGATGCGAGAAGGTGTTCGAGGAACCCGAGGACTTCCTGAAGCACTGCCAGGCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 201 TrpProGlyCysGluLysValPheGluGluProGluAspPheLeuLysHisCysGlnAla 220 Qy 661 GATCATCTGCTGGACGAGAAAGGCAGAGCCCAGTGTCTGCTCCAGCGCGAGATGGTGCAG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 221 AspHisLeuLeuAspGluLysGlyArgAlaGlnCysLeuLeuGlnArgGluMetValGln 240 Qy 721 TCTCTGGAACAGCAGCTGGTCCTGGAAAAAGAAAAGCTGAGCGCCATGCAGGCCCACCTG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 SerLeuGluGlnGlnLeuValLeuGluLysGluLysLeuSerAlaMetGlnAlaHisLeu 260 Qy 781 GCCGGAAAAATGGCCCTGACAAAGGCCAGCAGCGTGGCCTCTTCTGATAAGGGCAGCTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 261 AlaGlyLysMetAlaLeuThrLysAlaSerSerValAlaSerSerAspLysGlySerCys 280 Qy 841 TGCATTGTGGCCGCTGGATCTCAGGGACCTGTGGTTCCTGCTTGGAGCGGACCTAGAGAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 281 CysIleValAlaAlaGlySerGlnGlyProValValProAlaTrpSerGlyProArgGlu 300 Qy 901 GCCCCTGATTCTCTGTTTGCCGTGCGGAGACACCTGTGGGGCTCTCACGGCAACTCTACT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AlaProAspSerLeuPheAlaValArgArgHisLeuTrpGlySerHisGlyAsnSerThr 320 Qy 961 TTCCCCGAGTTCCTGCACAACATGGACTACTTCAAGTTCCACAACATGCGGCCTCCATTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 321 PheProGluPheLeuHisAsnMetAspTyrPheLysPheHisAsnMetArgProProPhe 340 Qy 1021 ACCTACGCCACACTGATCAGATGGGCCATTCTGGAAGCCCCTGAGAAGCAGAGAACCCTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 341 ThrTyrAlaThrLeuIleArgTrpAlaIleLeuGluAlaProGluLysGlnArgThrLeu 360 Qy 1081 AACGAGATCTACCACTGGTTTACCCGGATGTTCGCCTTCTTCCGGAATCACCCTGCCACC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AsnGluIleTyrHisTrpPheThrArgMetPheAlaPhePheArgAsnHisProAlaThr 380 Qy 1141 TGGAAGAACGCCATCCGGCACAATCTGAGCCTGCACAAGTGCTTCGTGCGCGTGGAATCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 381 TrpLysAsnAlaIleArgHisAsnLeuSerLeuHisLysCysPheValArgValGluSer 400 Qy 1201 GAGAAAGGCGCCGTGTGGACAGTGGACGAGCTGGAATTCAGAAAGAAGAGAAGCCAGCGG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 401 GluLysGlyAlaValTrpThrValAspGluLeuGluPheArgLysLysArgSerGlnArg 420 Qy 1261 CCTAGCCGGTGCAGCAATCCTACACCTGGACCT 1293 ||||||||||||||||||||||||||||||||| Db 421 ProSerArgCysSerAsnProThrProGlyPro 431 Sequence 68, US/16981213 Codon optimized human FOXP3 cDNA Without stop codon Query Match 100.0%; Score 1293; Length 1293; Best Local Similarity 100.0%; Matches 1293; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGCCTAATCCTCGGCCTGGAAAGCCTAGCGCTCCTTCTCTTGCTCTGGGACCTTCTCCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGCCTAATCCTCGGCCTGGAAAGCCTAGCGCTCCTTCTCTTGCTCTGGGACCTTCTCCT 60 Qy 61 GGCGCCTCTCCATCTTGGAGAGCCGCTCCTAAAGCCAGCGATCTGCTGGGAGCTAGAGGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGCGCCTCTCCATCTTGGAGAGCCGCTCCTAAAGCCAGCGATCTGCTGGGAGCTAGAGGA 120 Qy 121 CCTGGCGGCACATTTCAGGGCAGAGATCTTAGAGGCGGAGCCCACGCTAGCTCCTCCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CCTGGCGGCACATTTCAGGGCAGAGATCTTAGAGGCGGAGCCCACGCTAGCTCCTCCAGC 180 Qy 181 CTTAATCCTATGCCTCCTAGCCAGCTCCAGCTGCCTACACTGCCTCTGGTTATGGTGGCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTTAATCCTATGCCTCCTAGCCAGCTCCAGCTGCCTACACTGCCTCTGGTTATGGTGGCT 240 Qy 241 CCTAGCGGAGCTAGACTGGGCCCTCTGCCTCATCTGCAAGCTCTGCTGCAGGACAGACCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CCTAGCGGAGCTAGACTGGGCCCTCTGCCTCATCTGCAAGCTCTGCTGCAGGACAGACCC 300 Qy 301 CACTTCATGCACCAGCTGAGCACCGTGGATGCCCACGCAAGAACACCTGTGCTGCAGGTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CACTTCATGCACCAGCTGAGCACCGTGGATGCCCACGCAAGAACACCTGTGCTGCAGGTT 360 Qy 361 CACCCTCTGGAATCCCCAGCCATGATCAGCCTGACACCTCCAACAACAGCCACCGGCGTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CACCCTCTGGAATCCCCAGCCATGATCAGCCTGACACCTCCAACAACAGCCACCGGCGTG 420 Qy 421 TTCAGCCTGAAAGCCAGACCTGGACTGCCTCCTGGCATCAATGTGGCCAGCCTGGAATGG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TTCAGCCTGAAAGCCAGACCTGGACTGCCTCCTGGCATCAATGTGGCCAGCCTGGAATGG 480 Qy 481 GTGTCCAGAGAACCTGCTCTGCTGTGCACATTCCCCAATCCAAGCGCTCCCAGAAAGGAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GTGTCCAGAGAACCTGCTCTGCTGTGCACATTCCCCAATCCAAGCGCTCCCAGAAAGGAC 540 Qy 541 AGCACACTGTCTGCCGTGCCTCAGAGCAGCTATCCCCTGCTTGCTAACGGCGTGTGCAAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AGCACACTGTCTGCCGTGCCTCAGAGCAGCTATCCCCTGCTTGCTAACGGCGTGTGCAAG 600 Qy 601 TGGCCTGGATGCGAGAAGGTGTTCGAGGAACCCGAGGACTTCCTGAAGCACTGCCAGGCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TGGCCTGGATGCGAGAAGGTGTTCGAGGAACCCGAGGACTTCCTGAAGCACTGCCAGGCC 660 Qy 661 GATCATCTGCTGGACGAGAAAGGCAGAGCCCAGTGTCTGCTCCAGCGCGAGATGGTGCAG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GATCATCTGCTGGACGAGAAAGGCAGAGCCCAGTGTCTGCTCCAGCGCGAGATGGTGCAG 720 Qy 721 TCTCTGGAACAGCAGCTGGTCCTGGAAAAAGAAAAGCTGAGCGCCATGCAGGCCCACCTG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TCTCTGGAACAGCAGCTGGTCCTGGAAAAAGAAAAGCTGAGCGCCATGCAGGCCCACCTG 780 Qy 781 GCCGGAAAAATGGCCCTGACAAAGGCCAGCAGCGTGGCCTCTTCTGATAAGGGCAGCTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GCCGGAAAAATGGCCCTGACAAAGGCCAGCAGCGTGGCCTCTTCTGATAAGGGCAGCTGC 840 Qy 841 TGCATTGTGGCCGCTGGATCTCAGGGACCTGTGGTTCCTGCTTGGAGCGGACCTAGAGAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TGCATTGTGGCCGCTGGATCTCAGGGACCTGTGGTTCCTGCTTGGAGCGGACCTAGAGAG 900 Qy 901 GCCCCTGATTCTCTGTTTGCCGTGCGGAGACACCTGTGGGGCTCTCACGGCAACTCTACT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GCCCCTGATTCTCTGTTTGCCGTGCGGAGACACCTGTGGGGCTCTCACGGCAACTCTACT 960 Qy 961 TTCCCCGAGTTCCTGCACAACATGGACTACTTCAAGTTCCACAACATGCGGCCTCCATTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TTCCCCGAGTTCCTGCACAACATGGACTACTTCAAGTTCCACAACATGCGGCCTCCATTC 1020 Qy 1021 ACCTACGCCACACTGATCAGATGGGCCATTCTGGAAGCCCCTGAGAAGCAGAGAACCCTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 ACCTACGCCACACTGATCAGATGGGCCATTCTGGAAGCCCCTGAGAAGCAGAGAACCCTG 1080 Qy 1081 AACGAGATCTACCACTGGTTTACCCGGATGTTCGCCTTCTTCCGGAATCACCCTGCCACC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 AACGAGATCTACCACTGGTTTACCCGGATGTTCGCCTTCTTCCGGAATCACCCTGCCACC 1140 Qy 1141 TGGAAGAACGCCATCCGGCACAATCTGAGCCTGCACAAGTGCTTCGTGCGCGTGGAATCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGGAAGAACGCCATCCGGCACAATCTGAGCCTGCACAAGTGCTTCGTGCGCGTGGAATCT 1200 Qy 1201 GAGAAAGGCGCCGTGTGGACAGTGGACGAGCTGGAATTCAGAAAGAAGAGAAGCCAGCGG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GAGAAAGGCGCCGTGTGGACAGTGGACGAGCTGGAATTCAGAAAGAAGAGAAGCCAGCGG 1260 Qy 1261 CCTAGCCGGTGCAGCAATCCTACACCTGGACCT 1293 ||||||||||||||||||||||||||||||||| Db 1261 CCTAGCCGGTGCAGCAATCCTACACCTGGACCT 1293
Read full office action

Prosecution Timeline

Jun 16, 2023
Application Filed
Apr 24, 2025
Non-Final Rejection mailed — §103, §DP
Jul 24, 2025
Response Filed
Sep 22, 2025
Final Rejection mailed — §103, §DP
Mar 20, 2026
Request for Continued Examination
Mar 23, 2026
Response after Non-Final Action
May 26, 2026
Non-Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12697350
METHODS AND COMPOSITIONS FOR TREATING A PREMATURE TERMINATION CODON-MEDIATED DISORDER
4y 3m to grant Granted Aug 04, 2026
Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.6%)
4y 0m (~9m remaining)
Median Time to Grant
High
PTA Risk
Based on 750 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month