Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
Election/Restrictions
Applicant's election without traverse of Group II (claims 56-58, 61, 64, 66, 79, and 82) in the reply filed on 07/01/2026 is acknowledged.
Election of the following species on the reply filed on 07/01/2026 is acknowledged:
A: HLA coordinates for genetic modification: The genomic coordinates of chr6:29942864-29942884.
B: HLA genetic modification: Indel.
C: Additional modified gene: CIITA
D: HLA-A guide RNA sequence: Seq ID NO:13
E: HLA-B allele: HLA-B*07:02
Priority
The present application is a CON of International Application No. PCT/US2021/064930, filed 12/22/2021.
Applicant' s claim for the benefit of a prior-filed parent provisional application 63288492, filed on 12/10/2021, 63254970 filed 10/12/2021, 63250996 filed on 09/30/2021 and 63130095 filed 12/23/2020, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
The effective priority date for the instant application is 12/23/2020.
Claims Status
Claims 5-11, 14-16, 19-21, 25-31, 33-35, 37, 38, 40-43, 46, 47, 51, 52, 54, 55, 59, 60, 62, 63, 65, 68-71, 73-75, 77, 78, 80, 81, 83-88, 90, 92, 95, and 96 are canceled, no claims are newly added, claims 1-4, 12, 13, 18, 22-24, 32, 36, 39, 44, 45, 48-50, 53, 67, 72, 76, 89, 91, 93, and 94 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 56-58, 61, 64, 79 and 82 have been considered on the merits.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
A hyperlinks is found on p20 [0085] of the instant specification.
Claim Objections
Claim 56 is objected to because of the following informalities:
The claim recites “contacting a cell with composition comprising”. If the claim were amended to recite “contacting a cell with a composition comprising” or “contacting a cell with the composition” the grammar would be correct and the objection would be overcome.
The claim also recites the alternatives i.-vi. using the term “or” between each alternative. While one of ordinary skill in the art would recognize that that the alternatives are selectable choices, the claim language would be more correct if the term “or” was used only between the final two options.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 56-58, 61, 64, 79 and 82 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 56: The claim is drawn to a method of making “an engineered human cell, which has reduced or eliminated surface expression of HLA-A protein relative to an unmodified cell”. The claim also recites “wherein the cell is homozygous” and requires “contacting a cell”
The claim is indefinite because it is unclear what cell is required to be the homozygous cell- the engineered human cell, the unmodified cell or the cell to be contacted with a composition.
For purposes of compact prosecution, the homozygous cell is interpreted as the engineered human cell that is the product of the method.
Note claims 57-58, 61, 64, 65, 79 and 82 depend from claim 56 and fail to cure the deficiency.
Regarding claims 56-57: The claims refers to tables within the claims. Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant' s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993). See MPEP 2173.05(s).
The Tables are recited in alternative embodiments of the claims (Claim 56a)iv,v and Claim 57a)iv, v) and are not examined regarding the art in the instant analysis.
Note claims 57-58, 61, 64, 65, 79 and 82 depend from claim 56 and fail to cure the deficiency.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 56-58, 64, 79 and 82 are rejected under 35 U.S.C. 103 as being unpatentable over Cooper et al (WO 2015/164740 A1; cited in the IDS filed 11/12/2024) in view of Neerincx et al (Molecular Immunology (2018) 1-9) and as evidenced by Shalem et al (Science (2014) 343;1-5).
Regarding claims 56-58, 79 and 82: Claim 56 is drawn to a method of making a human cell. The phrase “which has reduced or eliminated surface expression of HLA-a protein relative to an unmodified cell” is considered the result of the method and any method comprising the identical active steps and structure as required by the instant method is considered to produce the same result as the claimed method.
The claim recites “wherein the cell is homozygous for HLA-B and homozygous for HLA-C”. The instant specification defines “homozygous” as “having two identical alleles of a particular gene” (p10 [0048]).
The claim recites “an HLA-A guide RNA”. The instant specification is silent on an explicit definition of the term. Therefore, the broadest reasonable interpretation of “an HLA-A guide RNA” is a guide RNA which modifies the HLA-A gene.
Cooper teach a method to make iPSCs which do not express an HLA gene such as HLA-A (abstract).
Cooper teach engineering donor cells that are homozygous at HLA-B and HLA-C and HLA-DRB1 so that they do not express HLA-A (claim 3). Cells that do not express HLA-A read on a cell which has reduced or eliminated surface expression of HLA-A protein as required by the claim.
One of ordinary skill in the art would understand that donor cells are human cells intended for human recipients. Furthermore, Cooper teach that an HLA homozygous umbilical cord blood unit was obtained from the Cord Blood Bank at MD Anderson Cancer Center, a repository of human donor cells. Thus the engineered cells taught by Cooper are human, as required by the claim.
Cooper teach engineering the cells so that they do not express HLA-A by contacting (introducing into) the cells with the nuclease CRISPR/Cas9 (claim 5). This reads on an RNA-guided DNA binding agent as required by the claim.
Cooper are silent on a specific gRNA sequence for the CRISPR/Cas9 system.
Neerincx teach sgRNA-A1 is specific for HLA-A and used to knockout HLA-A (p2 col1 ¶3). sgRNA-A1 has an identical sequence to Seq ID NO: 13 of the instant disclosure (See below; Query is Seq ID NO: 13 and sbjct is sgRNA-A1 of Neerincx).
Query 1 ACAGCGACGCCGCGAGCCAG 20
||||||||||||||||||||
Sbjct 1 ACAGCGACGCCGCGAGCCAG 20
Neerincx further teach human (HeLa) knockout cell lines were generated using CRISPR (p2 col2 ¶1). Knockout cell lines using CRISPR reads on an RNA-guided DNA binding agent because one of ordinary skill in the art would understand generating a knockout using CRISPR requires a Cas protein, which is an RNA-guided DNA binding agent.
Neerincx teach HLA-A surface expression is reduced or eliminated in the HLA-A knockout cell (pf Fig 3A; dark solid and dashed lines).
Neerincx also teach the sgRNA-A1 is initially described by Shalem et al. As evidenced by Shalem et al, the sgRNA is incorporated into a lentiviral vector (p2 col2 ¶1). This reads on the HLA-A guide RNA is provided to the cell in a vector, as required by claim 79.
It would have been obvious to modify the method of Cooper, drawn to making an engineered human cell that is homozygous for HLA-B and HLA-C and which has reduced or eliminated HLA-A protein expression, which comprises contacting the cell with a composition comprising an RNA-guided DNA binding agent (Cas9) with teachings of Neerincx, a gRNA with the sequence of sgRNA-A1 because Neerincx teach sgRNA-A1 sequence was successful in ablating expression of the HLA-A protein (Figure 3A).
One would have been motivated to modify the method of Cooper to use the gRNA disclosed by Neerincx because Cooper are silent as to a specific gRNA sequence for the CRISPR based editing of HLA-A and one of ordinary skill in the art would understand a gRNA that has been validated for the intended purpose, such as that of Neerincx, would be an obvious choice.
One would have had a reasonable expectation of success because both disclosures are drawn to using CRISPR/Cas9 to disrupt HLA-A expression in human cells and Neerincx demonstrates the gRNA works as expected.
Regarding claim 64: The teachings of Cooper and Neerincx are discussed supra. Cooper further teach the artificial nuclease (CRISPR/Cas9) is introduced by introducing mRNA encoding the nuclease into the cells (claim 6). This reads on contacting the cell with an exogenous nucleic acid, as required by the claim.
Thus the invention is rendered obvious by the teachings of Cooper et al in view of Neerincx et al.
Claim 61 is rejected over under 35 U.S.C. 103 as being unpatentable over Cooper et al and Neerincx et al as applied to claims 56-58 and 64 above, and further in view of Han et al (PNAS (2019) 116:21;1-6; as cited in the IDS filed 11/12/2024)
Regarding claim 61: The teachings of Cooper and Neerincx are discussed supra. Cooper do not teach using CRISPR/Cas9 genome editing to eliminate the expression of HLA class II genes by targeting CIITA.
Han teach ablating HLA class Ia and class II molecules is necessary to prevent the activation of cytotoxic CD8+ T and CD4+T helper cells for cell therapy with allogeneic cells (p1 col1 ¶1). Han further teach using CRISPR/Cas9 to selectively excise the genes encoding CIITA to ablate HLA class II expression (p1 col2 ¶2).
It would have been obvious to modify the method of Cooper, drawn to making an engineered human cell that is homozygous for HLA-B and HLA-C and which has reduced or eliminated HLA-A protein expression which comprises contacting the cell with a composition comprising an RNA-guided DNA binding agent (Cas9) with the teachings of Han, to also selectively excise the genes encoding CIITA to ablate HLA class II expression.
One would have been motivated to target CIITA to ablate HLA class II expression, as taught by Han, in addition to targeting HLA-A, because Han teach both HLA class Ia and HLA class II molecules contribute to the activation of cytotoxic T cells and CD4+ T helper cells, and thus one of ordinary skill in the art would understand that ablating HLA class II expression by targeting CIITA in engineered cells would generate cells that were less likely to be rejected by the recipient’s immune system (Han p1 col1 ¶1).
One would have had a reasonable expectation of success because the inventions are drawn to using CRISPR/Cas9 to modify HLA molecules in human cells.
Thus the invention is rendered obvious by the teachings of Cooper et al in view of Neerincx et al. and Han et al.
Art of relevance but not relied upon:
Long et al (Journal of Molecular Cell Biology (2018) 10:2;1-14; PHF20 collaborates with PARP1 to promote stemness and aggressiveness of neuroblastoma cells through activation of SOX2 and OCT4); Long also teach an sgRNA with the identical sequence to the instant Seq ID NO:13 which is used to target CRISPR/Cas9 to delete HLA-A.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571)272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631
/TAEYOON KIM/Primary Examiner, Art Unit 1631