DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Amendment of claims entered in 08/27/2025 is acknowledged. Applicant has cancelled claims 1, 3-4 and 9. Therefore claims 2 and 5-8 are pending and the claims are examined in this office action.
For following analysis substitute specification submitted on 09/12/2023 is used for referencing to page numbers.
Improper incorporation by reference to a foreign application
The incorporation of essential material in the specification by reference to an unpublished U.S. application, foreign application or patent, or to a publication is improper, see amended specification filed on 08/27/2025. Applicant is required to amend the disclosure to include the material incorporated by reference, if the material is relied upon to overcome any objection, rejection, or other requirement imposed by the Office. The amendment must be accompanied by a statement executed by the applicant, or a practitioner representing the applicant, stating that the material being inserted is the material previously incorporated by reference and that the amendment contains no new matter. 37 CFR 1.57(g).
Claim Objections
Claim 8 is objected to because of the following informalities:
In claim 8, line 2, Applicant are advised to add the term “wherein” following the phrase “claim 2” in line 1.
Appropriate correction is required.
Claim Interpretation
In claims 5-7 applicant recites the transgressive photosensitivity (TPS) to be positive and negative, since applicant has not specifically defined what does the term positive and negative means, it is interpreted as in the art Zong et al. (Published: 2021, Journal: New Phytologist, 229: 1635–1649, doi: 10.1111/nph.16946) which teaches a strong photoperiod sensitivity (PS) completely inhibits heading under long day (LD) conditions (i.e. in the early in the season) and induces heading only under short day (SD) conditions (i.e. in the late season in the tropical and subtropical regions). Thus, it is interpreted that in the positive response the flowering is influenced by day length and in negative response the flowering is negatively affected by day length. Therefore, negatively sensitive or insensitive varieties may flower regardless of day length.
Claim Rejections - 35 USC § 112 - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2 and 5-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim.
Regarding claim 2, the recitation of “the marker set can be identified by using Polymerase Chain Reaction (PCR) with primers” renders claim indefinite since there is ambiguity of whether the claim require the marker to be identified by PCR or any other method other than PCR would also are comprised in the claim. For example, single nucleotide polymorphisms (SNPs) can be identified by sequencing and other physiological and biochemical markers can be identified using lab tests.
Regarding claim 2, the recitation of “marker set” renders claim indefinite since it is not clear what does a set of markers in the regions of 8,665,233-9,600,319 bp in chromosome 7 and 8,556,052- 11,072,552 bp interval in chromosome 7 would mean, since there are many markers located in the region with ~1 Mbp long intervals of two chromosomes in the IRGSP reference genome of rice. Without describing location of the marker it would encompass any kind of markers for example any of the molecular markers such as RFLP, SSR, SNPs etc., any of the physiological effects and phenotypic effects markers and their combinations. For example, the rice genome database on Rice Genome Annotation project (https://rice.uga.edu/, accessed 05/14/2025) showed that there are many SSR markers, ESTs and DNAs in the region of 665,233-9,600,319 bp in chromosome 7 (see snippet below). For this reason, it is not clear how many different combinations of marker sets of the marker in chromosome 6 and 7 of the recited regions are encompassed in the recited marker set. For this reason, the metes and bound of the “marker set” cannot be determined since it could by any of the sets of molecular markers as RFLP, SSR, SNPs etc. or any physiological markers or phenotypic markers or biochemical markers combinations as set of markers.
PNG
media_image1.png
1006
1907
media_image1.png
Greyscale
Furthermore, applicant states molecular marker set [M80410+ZLM7-1] (Spec, page 10, second paragraph) and claim 2 recites M80410 and ZLM7-1 are primers. For this reason, it is not clear what is a marker set means, is this set of primers or markers since it is known in the art that the PCR primers represent the flanking sequences fore initiation of DNA replication in PCR wherein a marker would be a fragment of known sizes. Therefore, it is unclear what is a marker set would mean?
Furthermore, applicant has added in the claim that the marker set can be identified by using Polymerase Chain Reaction (PCR) with primers and applicant recites “PCR primer named M80410” and “PCR primer named ZLM7-1”. Providing primers that can identify marker set would not limit the numbers of markers present in the qHd6 located in 8, 665,233-9,600,319 bp interval on chromosome 6 and qHd7 located at 8,556,052-11,072,552 bp interval on chromosome 7, therefore the rejection has been maintained.
Regarding claims 5 and 6, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 1 recites the broad recitation “photosensitivity module”, and the claim also recites “[qHd6+qHd7]” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Regarding claim 6, the claim recites “marker genotype of [M80410 + ZLM7-1]” renders claim indefinite since it is not clear how two PCR primers M80410 and ZLM7-1 are related to make a marker genotype of [M80410 + ZLM7-1]. Is this combination is showing combination of sequences or combination of functions or combination of presence of amplification products of PCR reaction?
Regarding claim 6, the claim recites the term “about” renders claim indefinite, since lower limit of the term “about” cannot be determined. Furthermore, it is not clear whether the smaller than the band size described as 500 bp, 223 bp, or 202 bp would also encompass the recited genotypes.
Regarding claim 8, the claim 8 recites the limitation "the rice" in line 1. There is insufficient antecedent basis for this limitation in the claim because it is not clear from dependent claim 2 whether the term “rice” is has been used in the context of marker set or for the reference genome of IRGSP.
Response to Argument
Applicant's arguments filed 08/27/2025 have been fully considered but they are not persuasive.
Applicant argues Applicant has amended claims 2 and 5-8 to more clearly define the claimed subject matter and canceled claims 1, 3, and 9. Applicant argues Claims 2 and 5-8 now comply with 35 U.S.C. l 12(b) (Response to rejection, pages 7, paragraph 5, respectively).
Applicant’s argument has been fully considered but they are not persuasive since recitation of the marker set “can be” identified would only provide one example of identification wherein the marker would have been identified anywhere in or near the 8, 665,233-9,600,319 bp interval on chromosome 6 and 8,556,052- 11,072,552 bp interval on chromosome 7, therefore the marker set would have been identified with any of the marker found in the IRGSP database. Furthermore, applicant has recited “photosensitivity module”, and the claim also recites “[qHd6+qHd7]” in claim 5 and 6. Furthermore, it is not clear what is the limit of the term “about” in claim 6.
Claim Rejections - 35 USC § 112 -Written Description Requirements
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2 and 5-8 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Following analysis is modified and the limitation of claim 6 reciting “marker genotype of [M80410 + ZLM7-l] for the photo-sensitivity module, [ qHd6+qHd7], wherein the claim is now dependent on claim 2 which recite the marker genotype as primers with their forward and reverse primers has been analyzed in written description requirement since it would encompass any genotypic structure wherein the primers until the primers are present in anywhere in chromosome 6 and 7.
Analysis of Breadth of Claims
Marker set of claims 2 and 5 would encompass any marker set for the photosensitivity module located anywhere in the 8,665,233-9,600,319 bp interval on chromosome 6 as qHd6 and 8,556,052- 11,072,552 bp interval on chromosome 7 as qHd7.
In claim 5, the phrase transgressive photo-sensitivity would encompass any extreme phenotype from low heading date to high heading date.
The early Geng/japonica rice progenies encompass any rice line from Japonica subgroups (claims 6).
The location of PCR primer named ZLM7-1 with its forward and reverse primers encompass different locations in different chromosomes across rice germplasms (claim 6).
A marker genotype of [M80410 + ZLM7-l] for the photo-sensitivity module, [ qHd6+qHd7], would encompass any genotypic structure wherein the primers are present in chromosome 6 and 7.
What is Described in the Specification
Applicant describes the following:
two RIL populations were derived through single-grain transmission, of which TH886/XQ62 contains 226 F1 families, and TH899/XQ62 contains 231 F1 families (page 6, paragraph 3).
TH886 and TH899 are high quality and high yield Jilin materials (page 6, paragraph 2).
XQ62 is Heilongjiang early maturing Geng /japonica background Pigm material (page 6, paragraph 3).
70 Heilongjiang and 50 Jilin breeding materials (35 of them were listed in Table 1) were randomly picked as the validation materials for the marker set (page 6, paragraph 3).
two near-isogenic lines XQ62 and Kongyu 131 were used to cross with 35 materials (16 Heilongjiang and 19 Jilin breeding materials) randomly selected from 120 breeding materials respectively (Table 1), and the performance of F 1 was observed under LD and SD conditions (page 6-7, last and first paragraphs).
QTLs with high LOD values were located in the 8,665,233-9,600,319 bp interval on chromosome 6 as qHd6 and 8,556,052- 11,072,552 bp interval on chromosome 7 as qHd7 under long-day and short-day conditions (Fig. 3-6) (page 9 paragraph 3).
A molecular marker named ZLM7-1 was designed within 100 bp around the candidate gene of qHd7 using IRGSPv1.0 as the reference genome (page 9 paragraph 4).
M80410 is a known marker and it was found linked to the qHd6 locus for the photo-sensitivity trait (page 9, last paragraph).
Using the developed molecular marker set [M80410+ZLM7-1] for the photo-sensitivity module, [qHd6+qHd7], the marker genotype selection was carried out in F6 generation of RIL population derived from the cross TH886/XQ62 (page 10, second paragraph).
the predicted F 1 photo-sensitivity of the marker genotype was 88.6%, breeding material Heilongjiang from female parent to be 75% and from female parent Jilin to be 100% consistent with the actual observation.
Difference Between What was Described and What is Claimed
Applicant has not described any photo-sensitivity module can be characterized with the PCR primers of SEQ ID NOs: 1-4 other than in the photo-sensitivity module found in the Jilin breeding materials as lines TH886 and TH899 and Heilongjiang early maturing Geng /japonica breeding material as line XQ62.
Applicant has not described any of the early Geng/japonica rice progenies would comprise the qHd6 and qHd7 QTLs with recited photosensitivity module (claims 5 and 8).
Applicant has not described the structure of the photosensitivity module since the claim does not reference the deposit.
Applicant has not described any fragments produced by primer sets of claim 2 would characterize the photosensitivity other than 500 bp band detected as A_ otherwise aa (Fig. 7) when qHd6 the M80410 marker primer is used to amplify the rice genome template and regarding qHd7. Furthermore, for ZLM7-1 marker primer that is used to amplify the rice genome template, when a 223bp bands are amplified, the qHd7 genotype is detected as BB; if about 202bp bands are amplified, the qHd7 genotype is detected as bb (Fig. 8) other than in the cross of TH886/XQ62.
Applicant has not described a PCR primer named ZLM7-1 for qHd7, with a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1), and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2) is located in chromosome 7 in any japonica rice verities other than in the cross of TH886/XQ62.
Applicant has not described the structure of marker genotype of [M80410 + ZLM7-l] for the photo-sensitivity module, [qHd6+qHd7], that would encompass any genotypic structure wherein the primers are present in chromosome 6 and 7.
Analysis
The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim.
Applicant has not described the markers sets for the photosensitivity module. In claims 2, 5, and 8 applicant recites the location of a QTLs qHd6 and qHD7 each located ~1Mb of the chromosome 6 and 7 that would encompass many markers. See for example Mauricio et al. (Published: 2001, Journal: Nature Reviews Genetics 2: 370-381), teaches locating a quantitative trait loci (QTL) for a trait simply involves finding an association between a genetic marker and a phenotype that one can measure (page 370, right paragraph 1) wherein a QTL is a chromosomal segment, potentially encompassing many hundreds of individual loci, most of which have nothing to do with the phenotypic trait of interest and an actual locus that contributes to a phenotype is a veritable needle in a haystack of QTL and a QTL might contain many genes that contribute to the phenotype of interest (page 378, left paragraph 1). Mauricio et al. teaches the limits of QTL detection are determined by several factors, including recombination, the number of progeny in the mapping population and the number of markers (page 378, right paragraph 2). Furthermore, claim 6 recites “marker genotype of [M80410 + ZLM7-l]” and “claim 9 recites molecular marker set [M80410 + ZLM7-1]” wherein it is not clear where the marker ZLM7-1 is located at since applicant has only stated the molecular marker ZLM7-1 located within 100 bp around the candidate gene of qHd7 using IRGSPv1.0 as the reference genome with its forward and reverse primers. Thus, there is dearth of description of any marker set located in qHd6 and qHd7.
Applicant has not described any of the early Geng/japonica rice progenies would comprise the qHd6 and qHd7 QTLs with recited photosensitivity module (claims 5 and 8). For example Lei et al. (Published:2024, Journal: Scientific Data 11:230, https://doi.org/10.1038/s41597-024-03057-x 1) teaches early Geng/japonica rice varieties and the varieties could be any early japonica varieties of japonica group (page 1, paragraph 2). There is no clear indication in specification and art for any limitation of Geng/japonica rice progenies other than them being early for the Heilongjiang (HLJ) province of China and that comprise a japonica rice. Furthermore, Nei et al. (Published: 2017, Journal: Scientific Data 4:170195, DOI: 10.1038/sdata.2017.195) teaches O. sativa subsp. Japonica is the Geng (page 2, first paragraph). Furthermore, Liu et al. (Published: 2021, Journal: Genomics 113: 3083–3091) teaches the Japonica rice in Japan, Korea are diverse germplasms wherein the heading date genes Hd1 and Hd3a are artificially selected (page 3083, Abstract). Liu et al. teaches out of 239 elite japonica lines only 93 elites found to have the early maturity allele at Hd1 (page 3084, right paragraph 2). Applicant’s example itself showed different effects since when Jilin material was crossed to XQ62 there were 84.2% F1 had positive TPS while among F1 of XQ62 x Heilongjiang materials they have only 43.8% positive TPS, showing diversity in the japonica crosses for variation in TPS.
For this reason, there is dearth of description of any Geng/japonica rice progenies would comprise the qHd6 and qHd7 QTLs with recited photosensitivity module.
Applicant has not described any photo-sensitivity module can be characterized or predicted with the PCR primers of SEQ ID NOs: 1-4 in any other than the photo-sensitivity module found in the Jilin breeding materials as lines TH886 and TH899 and Heilongjiang early maturing Geng /japonica breeding material as line XQ62. Applicant has not described the PCR primers of SEQ ID NOs: 1-4 can be used to predict or characterized the QTLs qHd6 and qHd7 in any of the northern early Geng /japonica rice progenies since within the Jilin and Heilogjian materials the marker was found only effective when the materials were used as female of 75% and 100% respectively (Spec, pages 10 and 11, last and first paragraphs).
Furthermore, Li et al.’15 (Published:2015, Journal: Journal of Integrative Plant Biology, 57: 698–707), teaches Hd1 (i.e. qHD6) is non-functional or negative functional in 127 out of 136 rice verities grown the Heilongjiang province (page 700, right last paragraph). Wherein in most varieties (127 out of 136), Hd1 is non-functional or negative functional due to large fragment insertions and can be divided into three types: Hd1-type 2 to type 4 (see Figure 3 below, page 700, last paragraph). Li et al.’15 teaches association between the Hd1 genotype and heading date was not significant in their analysis because of limited number of nonfunctional Hd1 varieties. Thus, it showed there is lots of variation in the region of Hd1 among the varieties from Heilongjiang province. For this reason, the applicant’s recited region in claim 1 would comprise any of these alternative alleles with different functions. Li et al.’15 found two Hd4 haplotypes (i.e. qHD7): a functional Ghd7–2 haplotype and a non-functional Ghd7–0a haplotype (Figure 4A) (Xue et al. 2008) (page 701, left paragraph 1, see figure 4 below).
Therefore, there is dearth of description whether any of the plant from Japonica subgroup from this reason would be used to predict recited function of TPS, other than in the photo-sensitivity module found in the Jilin breeding materials as lines TH886 and TH899 and Heilongjiang early maturing Geng /japonica breeding material as line XQ62.
PNG
media_image2.png
798
1038
media_image2.png
Greyscale
PNG
media_image3.png
742
397
media_image3.png
Greyscale
Applicant has not described any fragments produced by primer sets of claim 4 would characterize the photosensitivity other than 500 bp band detected as A_ otherwise aa (Fig. 7) when qHd6 the M80410 marker primer is used to amplify the rice genome template and regarding qHd7. Furthermore, for ZLM7-1 marker primer that is used to amplify the rice genome template, when a 223 bp bands are amplified, the qHd7 genotype is detected as BB; if about 202 bp bands are amplified, the qHd7 genotype is detected as bb (Fig. 8) anywhere other than in the cross of TH886/XQ62.
For example, Zhang et al. (Published:2015, Journal: New Phytologist 208: 1056–1066, doi: 10.1111/nph.13538) teaches functional classification of different haplotypes of Hd1 and Ghd7 genes which has different types of deletions, leading to different phenotypes of heading dates variations. Therefore, it is less likely that the specific band anywhere in the large regions of qHd6 and qHd7 would have been associated with the specific phenotype of positive or negative TPS (see Table 2 below). Furthermore, see Zhang et al. supplementary figure S4 and S2 further showed the variation in different haplotypes of Ghd7 and Hd1 genes in sample of 320 and 328 different rice cultivars respectively. Thus, there is dearth of description of association of the specific band of PCR with the AA or BB genotype in any other rice lines other than the specific cross of TH886/XQ62 described by applicant.
PNG
media_image4.png
827
463
media_image4.png
Greyscale
Applicant has not described a PCR primer named ZLM7-1 for qHd7, with a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1), and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2) is located in chromosome 7 in any japonica rice verities other than in the cross of TH886/XQ62. For example, alignment of SEQ ID NO: 1 and 2 instead has 100% sequence identity to chromosome 2 of the cultivar Changxianggeng 1813 (see alignment below) different from chromosome 7 of applicant. For this reason, there is dearth of description of the PCR primer named ZLM7-1 for qHd7, with a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1), and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2) is located in chromosome 7 in any japonica rice verities other than in the cross of TH886/XQ62. Furthermore, the SEQ ID NOs: 1 and 2 are located on different locations of the rice cultivars in chromosome 7. For this reason, there is dearth of description wherein the location in IRGSP v1.0 which was specifically based on Nipponbare genome would translate to use in any germplasm or use in any japonica germplasms. For this reason, there is dearth of description of the primer sequence would have been useful for identifying the genotypes in any other germplasms other than the cross of TH886/XQ62.
Applicant has not described the structure of marker genotype or marker sets [M80410 + ZLM7-1] for the photo-sensitivity module, [ qHd6+qHd7], since that would encompass any genotypic structure wherein the primers are present in chromosome 6 and 7. Since the primers are any genomic sequence identified by forward and reverse primer sequences in any rice plants. There would be multiple markers present between the forward and reverse primers identified. Applicant has not expressly described which of the marker genotype is the marker genotype. Applicant describes different bands of sequence fragments produced using primers M80410 and ZLM7-1 (page 3, last paragraph) that leads to detection of genotype. However, applicant has not described if there are SNPs, RFLPs, SSRs or any other biochemical or physiological markers in the plant containing [M80410 + ZLM7-1] that would have been utilized as photosensitivity in the rice plants and that would comprise the regions of qHd6 and qHd7. Furthermore, since applicant has not described the structure of the marker the forward and reverse primers would have been located anywhere in the genome of any rice plant in any linkage relations that would comprise qHd6 and qHd7 in the any rice plants. Therefore, there is dearth of description of the structure of marker genotype or marker set of [M80410 + ZLM7-1] for the photo-sensitivity module, [ qHd6+qHd7].
Alignment of SEQ ID NO: 1 to GenEmbl database:
ESULT 11
CP101142s1/c
LOCUS CP101142s1 12010020 bp DNA linear PLN 14-NOV-2022
COMMENT segment of length 12010020: from 1 to 12010020
DEFINITION Oryza sativa Japonica Group cultivar Changxianggeng 1813 chromosome
2.
ACCESSION CP101142
VERSION CP101142.1
DBLINK BioProject: PRJNA856027
BioSample: SAMN29513669
KEYWORDS .
SOURCE Oryza sativa Japonica Group (Japanese rice)
ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
REFERENCE 1 (bases 1 to 29831576)
AUTHORS Lu,R., Liu,J., Wang,X., Song,Z., Ji,X., Li,N., Ma,G. and Sun,X.
TITLE Chromosome-Level Genome Assembly of a Fragrant Japonica Rice
Cultivar 'Changxianggeng 1813' Provides Insights into Genomic
Variations between Fragrant and Non-Fragrant Japonica Rice
JOURNAL Int J Mol Sci 23 (17), 9705 (2022)
PUBMED 36077110
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 29831576)
AUTHORS Lu,R.
TITLE Direct Submission
JOURNAL Submitted (08-JUL-2022) Plant Diversity and Systematics, Institute
of Botany, Jiangsu Province and Chinese Academy of Sciences,
Qianhuhoucun #1, Nanjing 210014, China
COMMENT ##Genome-Assembly-Data-START##
Assembly Method :: NextDenovo v. 2.4.0
Genome Representation :: Full
Expected Final Version :: Yes
Genome Coverage :: 320.11x
Sequencing Technology :: Illumina; Oxford Nanopore
##Genome-Assembly-Data-END##
FEATURES Location/Qualifiers
source 1..29831576
/organism="Oryza sativa Japonica Group"
/mol_type="genomic DNA"
/cultivar="Changxianggeng 1813"
/db_xref="taxon:39947"
/chromosome="2"
/tissue_type="fresh leaves"
/geo_loc_name="China: Nanjing
Query Match 100.0%; Score 23; Length 12010020;
Best Local Similarity 100.0%;
Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCCCCCAAACATTTTCAGAACAC 23
|||||||||||||||||||||||
Db 9025004 TCCCCCAAACATTTTCAGAACAC 9024982
Alignment of SEQ ID NO: 2 to GenEmbl database:
RESULT 26
CP101142s1
LOCUS CP101142s1 12010020 bp DNA linear PLN 14-NOV-2022
COMMENT segment of length 12010020: from 1 to 12010020
DEFINITION Oryza sativa Japonica Group cultivar Changxianggeng 1813 chromosome
2.
ACCESSION CP101142
VERSION CP101142.1
DBLINK BioProject: PRJNA856027
BioSample: SAMN29513669
KEYWORDS .
SOURCE Oryza sativa Japonica Group (Japanese rice)
ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
REFERENCE 1 (bases 1 to 29831576)
AUTHORS Lu,R., Liu,J., Wang,X., Song,Z., Ji,X., Li,N., Ma,G. and Sun,X.
TITLE Chromosome-Level Genome Assembly of a Fragrant Japonica Rice
Cultivar 'Changxianggeng 1813' Provides Insights into Genomic
Variations between Fragrant and Non-Fragrant Japonica Rice
JOURNAL Int J Mol Sci 23 (17), 9705 (2022)
PUBMED 36077110
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 29831576)
AUTHORS Lu,R.
TITLE Direct Submission
JOURNAL Submitted (08-JUL-2022) Plant Diversity and Systematics, Institute
of Botany, Jiangsu Province and Chinese Academy of Sciences,
Qianhuhoucun #1, Nanjing 210014, China
COMMENT ##Genome-Assembly-Data-START##
Assembly Method :: NextDenovo v. 2.4.0
Genome Representation :: Full
Expected Final Version :: Yes
Genome Coverage :: 320.11x
Sequencing Technology :: Illumina; Oxford Nanopore
##Genome-Assembly-Data-END##
FEATURES Location/Qualifiers
source 1..29831576
/organism="Oryza sativa Japonica Group"
/mol_type="genomic DNA"
/cultivar="Changxianggeng 1813"
/db_xref="taxon:39947"
/chromosome="2"
/tissue_type="fresh leaves"
/geo_loc_name="China: Nanjing
Query Match 100.0%; Score 20; Length 12010020;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAGGTGCAGTTGCAGTAGGT 20
||||||||||||||||||||
Db 9024781 TAGGTGCAGTTGCAGTAGGT 9024800
Alignment of SEQ ID NO:1 to the GenEmbl database:
PNG
media_image5.png
340
1250
media_image5.png
Greyscale
Alignment of SEQ ID NO:2 to the GenEmbl database:
PNG
media_image6.png
561
1227
media_image6.png
Greyscale
Accordingly, the claims are drawn to an extremely large genus of marker loci encompassing any possible yet unspecified alleles associated with the claimed phenotype of photosensitivity, when Applicants have only reduced to practice the primers M80410 and ZLM7-1. The claims are drawn to any unspecified marker of any type and sequence, and any unspecified allele, vs. the exemplified SNPs listed in the Specification. The claims are drawn to any unspecified Japonica progenies that would require to have specific primer sequences in specific location of the chromosomes.
Relating to structure vs. function, the claims remain drawn to any unspecified allele of the unspecified marker loci. This leads to a situation where the instantly claimed allele of the claimed marker loci would not possess the necessary structural features needed to accomplish the claimed phenotype. The Specification makes clear that the specific primers M80410 and ZLM7-1 comprised within the QTLs (a Hd6 and qHd7) lead to the recited phenotype, thus it is necessary to claim the polymorphisms as such in all the claims. Furthermore, it is necessary to recite the specific germplasms the QTLS are located and are can be characterized by the recited primers.
"The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to one skilled in the art that the inventor had possession of the claimed subject matter as of the filing date." Ariad Pharm, Inc, v EH Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, ina, 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). "An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPG2d at 1966". While the written description requirement does not demand either examples or an actual reduction, actual "possession" or reduction to practice outside of the specification is not enough. Ariad Pharm, Inc. v. Eli Lilly & Co., 598 F,3d 1336,1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id.
Thus, based on the analysis above, Applicant has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly. As a result, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed.
Response to Argument
Applicant's arguments filed 08/27/2025 have been fully considered but they are not persuasive.
Applicant argues Applicant has amended 2 and 5-8 to more clearly define the claimed subject matter and canceled claims 1, 3, 4, and 9. Applicant argues claims 2 and 5-8 now comply with the written description requirement (Response to rejection, pages 7 and 8, first and last paragraph, respectively).
Applicant's arguments have been fully considered but they are not persuasive since applicant has not described the molecular marker genotypes [M80410 + ZLM7-l] (claim 6) and the molecular marker genotype found in any rice plant (claim 1). Therefore the rejection has been maintained. Furthermore, recitation of the marker set “can be” identified would only provide one example of identification wherein the marker would have been identified anywhere in or near the 8, 665,233-9,600,319 bp interval on chromosome 6 and 8,556,052- 11,072,552 bp interval on chromosome 7, therefore the marker set would have been identified with large number of the marker found in the IRGSP database.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Anticipated by Zhang et al.
Claim 2 is rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Zhang et al. (Published:2015, Journal: New Phytologist 208: 1056–1066, doi: 10.1111/nph.13538) and further evidenced by Li et al. (Published:2018, Journal: Plant Growth Regulation (2018) 84:593–602).
The claim 2 recite “marker set can be identified by using Polymerase Chain Reaction (PCR) with primers M80410 and ZLM7-1”. Since the claim recite the phrase “can be” it would mean any other markers effecting photosensitivity would also encompassed in markers and the primers M80410 and ZLM7-l would be one of the examples. Therefore the rejection has been maintained.
Regarding claim 2, Li et al. showed the evidence that flowering time gene Hd4 (i.e. qHD7) is located on chromosome 7 (LOC_Os07g15770) between the positions 9,152,402 to 9,155,185. Li et al. showed the evidence that flowering time gene Hd1 (i.e. qHD6) is located on chromosome 6 (LOC_Os06g16370) between the positions 9,336,359 to 9,338,643 (page 597, see Table 1) which are within the same location as the applicant’s marker sets are located in claim 1 and 2.
Li et al. showed evidence that Hd4 (i.e. qHD7) is major flowering gene in northern China (see Figure 2 below) and it is a flowering repressor (page 599, left paragraph 2).
Thus, in following analysis Hd4 or qHD7 and Hd1 or qHD6 are used interchangeably.
Zhang et al. discloses sequence repeat (SSR) marker MRG4436 is tightly linked to Ghd7 and the gene Hd1 (i.e. qHD6) has functional marker S56 (page 1057, right last paragraph), wherein S56 cosegregated with heading date (page 1059, left paragraph 1).
Zhang et al. discloses multiple other polymorphic nucleotides in Hd1 (i.e. qHD6) and GHd7 coding sequence region (see Supplementary Figure S4 and S2).
Zhang et al. discloses RM314 is closely linked to Hd1 on chromosome 6, was polymorphic between the pools (Fig. 1d) (page 1059, left last paragraph). Sequencing analysis showed that 93-11 and Zhenshan 97 carried the Hd1 alleles, described as type 1 and type 7 wherein Type 7 Hd1 is regarded as functional while type1 Hd1 which has 4-bp deletion in the conserved CCT domain has been confirmed as nonfunctional (page 1059, left last paragraph and right first paragraph).
Zhang et al. discloses coding regions of GHd7 and Hd1 genes were amplified for sequencing and PCR product were digested (page 1057, right last paragraph). Zhang et al. discloses PCR primers to amplify the gene (see supplementary Table S2 below).
Thus Zhang et al. discloses the marker set in qHd6 and qHd7.
PNG
media_image7.png
796
1221
media_image7.png
Greyscale
Thus Zhang et al. anticipates claim 2.
Response to Argument
Applicant's arguments filed 08/27/2025 have been fully considered but they are not persuasive.
Applicant argues Zhang and Li fail to teach or suggest the marker set of claim 2 which are amended to recite “a PCR primer named M80410 for qHd6 comprises a forward primer sequence: GGATTGTCTTGTCTCTCTCGC (SEQ ID NO: 3) and a reverse primer sequence: CAGGACTTAGGGTTTCTCTCTTT (SEQ ID NO: 4); and a PCR primer named ZLM7-l for qHd7 comprises a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1) and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2)."
Applicant’s arguments have been fully considered but they are not persuasive since the claim recite the phrase “can be” it would mean any other markers effecting photosensitivity would also encompassed in markers and the primers M80410 and ZLM7-l would be one of the examples. Therefore, the rejection has been maintained.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Obvious over Zhang et al., and further in view of Zhang et al.’17, Deng et al., Ye et al., and Kim et al.
Claims 2 and 5-7 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al., and further in view of Zhang et al.’ (Published :2017, Journal: Scientific Reports 7: 5388 DOI:10.1038/s41598-017-05873-117), and further in view of Ye et al. (Published Year: 2012, Journal: BMC bioinformatics, Volume: 13, pages: 1-11) and further in view of Deng et al. (Published:2017, Journal: Science 355, 962–965), and further in view of Kim et al. (Published:2016, Journal: Rice 9:12 DOI 10.1186/s12284-016-0084-7) and as evidenced by Li et al.
The claim 2 recite “marker set can be identified by using Polymerase Chain Reaction (PCR) with primers M80410 and ZLM7-1. Since the claim recite the phrase “can be” it would mean any other markers effecting photosensitivity would also encompass in markers and the primers M80410 and ZLM7-1 would be one of the examples. Therefore, the rejection has been maintained.
Regarding claim 2, Li et al. showed the evidence that flowering time gene Hd4 (i.e. qHD7) is located on chromosome 7 (LOC_Os07g15770) between the positions 9,152,402 to 9,155,185. Li et al. showed the evidence that flowering time gene Hd1 (i.e. qHD6) is located on chromosome 6 (LOC_Os06g16370) between the positions 9,336,359 to 9,338,643 (page 597, Table 1) which are within the same location as the applicant’s marker sets are located.
Zhang et al. teaches line 93-11 carried functional Ghd7 (i.e. qHd7) allele but nonfunctional Hd1 (qHd6) allele which showed lowest heading date in long day conditions (see Figure S1 below) showing negative TPS. Zhang et al. teaches Zhenshan 97 carried nonfunctional Ghd7 but functional Hd1 (qHd6) alleles which showed higher heading date in long day conditions (see Figure S1 below and see figure 1a) showing positive TPS.
PNG
media_image8.png
767
1058
media_image8.png
Greyscale
Zhang et al. teaches difference in heading dates was < 35 d for functional vs nonfunctional Hd1 alleles under positive alleles of Ghd7 which greatly surpassed the genetic effects of Hd1 (Fig. S1b).
Zhang et al. teaches combination NNN (nonfunctional Ghd7, Ghd8 and Hd1) represented by one japonica variety originating from Heilongjiang which is the northern limit of the rice growing area in China was associated with the earliest heading date (page 1061, left last paragraph, see table below).
PNG
media_image9.png
635
1462
media_image9.png
Greyscale
Thus, it is clear from the Table 3 above that presence of the functional Ghd7 and Hd1 (i.e. A_B_) would cause later flowering in long day conditions (i.e. positive TPS) wherein the other genotype with one of the alleles being nonfunctional causes the negative TPS (see Table 3 above). This was also showed by Zhang et al.’17 wherein the Hd1ghd7 i.e. A_bb showed the earliest flowering date in long day conditions showing negative TPS and when the genotype A_B_ was present in the rice as both QTL being functional had latest heading date in the long day condition showing positive TPS (see figure 4 below).
PNG
media_image10.png
593
1197
media_image10.png
Greyscale
Regarding claims 5-6, Zhang et al. does not expressly teach the progeny comprises Pigm donor as parent and Zhang et al. does not expressly teach the marker genotype of M80410 and ZLM7-1.
Deng et al. teaches marker M80410 with forward and backward primer GGATTGTCTTGTCTCTCTCGC and CAGGACTTAGGGTTTCTCTCTTT (Deng et al., supplementary Table S7, page 42) that were found to co-segregate with Pigm locus (page 3, last paragraph). Applicant’s SEQ ID NOs: 3 and 4 have 100% identity with the Deng et al.’s primer sets. Further Deng et al. taches molecular breeding wherein the cultivar GM4 (Pigm) was crossed with varieties Maratelli (japonica), and Nipponbare (japonica) and backcrossed to generate BC4F1 lines and afterwards near isogenic lines NIL_Pigms carrying a genomic fragment with Pigm locus was selected in the Japonica varieties (page9, paragraph 2).
For this reason, it would have been obvious to a skilled in the art to use the marker M80410 to select for Pigm locus in chromosome 6 of Japonica rice progenies as qHd6. Furthermore, Deng et al. showed the Pigm R8 and Pigm R9 gene is located within 90473-97733 and 112801-118005 (see enclosed PDF) which is the same region in locus KU904633.2 of cultivar Gumei4. Specifically, Pigm R8 is within the same location of 9,336,359- 9,338,643 (i.e. qHd6 or Hd1) showed by the Li et al. For this reason, there was high predictability that the marker would associate with the PigmR8 and heading date because of their position within the same chromosome interval in chromosome 6.
Designing a specific primer for example for qHd7 is located in 8,556,052-11,072,552 bp interval on chromosome 7 is known in the art. Ye et al. teaches a tool Primer-BLAST which can be used to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (Ye et al., page 1, Abstract) and Ye et al. teaches an example to design primers using the human zinc finger protein 419 (ZNF419) transcript variant 5 mRNA (Genbank accession: NM_001098494) (Ye et al., page 6, left paragraph 2). Furthermore, alignment of SEQ ID NOs:1 and 2 as forward and reverse primer for PCR primer named ZLM7-1 was common sequence in rice cultivars (see sequence alignment above).
Therefore it would have been obvious from teaching suggestions and motivation from Zhang et al. to develop the method of predicting the positive or negative TPS using their associated genotypes of the qHd6 and qHd7 (i.e. AABB, AAbb, aaBB etc.) and furthermore utilize the PCR primer M80410 that would both effect on heading date (qHd6) and blast resistance (Pigm) from teaching of Deng et al. and PCR primer ZLM7-1 in the qHD7 region of chromosome 7 as taught by Zhang et al., Deng et al. and Ye et al. to carry out the MAS in Japonica progenies. The PCR reaction would produce specific band as inherent property of the PCR reaction. Furthermore, with the recitation of “about” it is not clear what is the exact size of the band required by the claim. Furthermore, it would have been obvious to add Pigm donor as parent of the breeding progenies since the marker M80410 would also select for the blast resistance as taught by Deng et al.
Regarding claim 7, creating an agarose gel electrophoresis band for genotype was known in the art see for example Kim et al. teaches PCR-gel-based markers and their bands for Ghd7 based on Agarose gel image analysis (page 8, Figure 4, see image below).
PNG
media_image11.png
637
558
media_image11.png
Greyscale
Response to Argument
Applicant's arguments filed 08/27/2025 have been fully considered but they are not persuasive.
Applicant argues claims 5-7 now depend from claim 2, and incorporate all the elements of claim 2. Applicant argues combined teaching of Zhang, Zhang II, Ye, Deng, and Kim fails to teach or suggest the above-recited elements of claim 2, namely, "a marker set for a photo-sensitivity module, comprising: a combination of two loci, named qHd6 and qHd7, which are located in 8, 665,233- 9,600,319 bp interval on chromosome 6 and 8,556,052- 11,072,552 bp interval on chromosome 7, respectively, based on the reference genome of IRGSP v1.0 for rice ... the marker set can be identified by using Polymerase Chain Reaction (PCR) with primers ... a PCR primer named M80410 for qHd6 comprises a forward primer sequence: GGATTGTCTTGTCTCTCTCGC (SEQ ID NO: 3) and a reverse primer sequence: CAGGACTTAGGGTTTCTCTCTTT (SEQ ID NO: 4); and a PCR primer named ZLM7-1 for qHd7 comprises a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1) and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2)." (Response to Rejection, page 9, first paragraph).
Applicant argues the claimed invention achieves the superior and unexpected results. Applicant argues Specifically, "by using the molecular marker set of the photo-sensitive module [qHd6+qHd7] of the present invention, the specific example is the combination of [M80410+ZLM7-l]. Applicant argues one usage of the marker set is, breeders can get useful progenies with Pigm gene but no strong TPS; another usage is breeders can predict the degree of TPS in F1 derived from crosses with Pigm donor as one parent by testing the marker genotype of [M80410+ZLM7-l] in parents. Applicant argues the joint work of the marker set of [M80410+ZLM7-l] can speed up the breeding process by screening progenies with Pigm but weak TPS." Applicant argues page 4, lines 15-21. "Furthermore, ZLM7-1 specification, is closely linked to qHd7 and is less prone to be recombinated, making it effective in rice molecular marker assisted breeding. Applicant argues the molecular marker ZLM7-1 of the present invention can be used alone to pre identify the qHd7 genotype of parents, and thus select suitable breeding parents in crossing with donors carrying Pigm genes." Specification, page 4, lines 22-25. Applicant argues these unexpected result data further establish that it would not have been obvious to one of ordinary skill in the art to combine Zhang, Zhang II, Ye, Deng, and Kim to arrive at the claimed invention. Applicant argues claim 2 and its dependent claims 5-7 are allowable for this additional reason (Response to Rejection, page 9, last paragraph).
Applicant’s arguments have been fully considered but they are not persuasive since the claim recite the phrase “can be” it would mean any other markers effecting photosensitivity would also encompassed in markers and the primers M80410 and ZLM7-1 would be one of the examples. Furthermore, it would have been obvious to try to develop primer sets including SEQ ID NOs:3-4 as taught by Deng et al. and develop the primer with forward and reverse primers of SEQ ID NOs: 1 and 2 as taught by Ye et using the tool Primer-BLAST which can be used to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (Ye et al., page 1, Abstract).
Regarding argument on unexpected results, Zhang et al. Table 3 clearly showed the presence of qHd7 and qHd6 located on the recite regions would effectively identify the degree of photosensitivity in rice germplasms. Furthermore, Deng et al. showed the Pigm R8 and Pigm R9 gene is located within 90473-97733 and 112801-118005 (see enclosed PDF) which is the same region in locus KU904633.2 of cultivar Gumei4. Specifically, Pigm R8 is within the same location of 9,336,359- 9,338,643 (i.e. qHd6 or Hd1) showed by the Li et al. For this reason, there was high predictability that the marker would associate with the PigmR8 and heading date because of their position within the same chromosome interval in chromosome 6. Therefore, the rejection has been maintained.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law.
Obvious over Zhang et al. and further in view of Zhang et al.’17 , Ye et al., Deng et al. and Zhou et al.
Claims 2 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al., and further in view of Zhang et al.’17 and further in view of Ye et al. and further in view of Deng et al., and further in view of Zhou et al. (Published:2018, Journal: Journal of Genetics and Genomics 45: 539-547) and as evidenced by Li et al.
Regarding claim 2, Li et al. showed the evidence that flowering time gene Hd4 (i.e. qHD7) is located on chromosome 7 (LOC_Os07g15770) between the positions 9,152,402 to 9,155,185. Li et al. showed the evidence that flowering time gene Hd1 (i.e. qHD6) is located on chromosome 6 (LOC_Os06g16370) between the positions 9,336,359 to 9,338,643 (page 597, Table 1) which are within the same location as the applicant’s marker sets are located.
Zhang et al. teaches 9311 carried functional Ghd7 (i.e. qHd7) allele but nonfunctional Hd1 (qHd6) allele which showed lowest heading date in long day conditions (see Figure S1 below) showing negative TPS. Zhang et al. teaches Zhenshan 97 carried nonfunctional Ghd7 but functional Hd1 (qHd6) alleles which showed higher heading date in long day conditions (see Figure S1 below and see figure 1a) showing positive TPS.
Zhang et al. teaches combination NNN (nonfunctional Ghd7, Ghd8 and Hd1) represented by one japonica variety originating from Heilongjiang which is the northern limit of the rice growing area in China was associated with the earliest heading date (page 1061, left last paragraph, see table above).
Thus, it is clear that presence of the functional Ghd7 and Hd1 (i.e. A_B_) would cause later flowering in long day conditions (i.e. positive TPS) wherein the other genotype with one of the alleles being nonfunctional causes the negative TPS (see Table 3 above). This was also showed by Zhang et al’17 wherein the Hd1ghd7 i.e. A bb showed the earliest flowering date in long day conditions and when the genotype A_B_ was present in the rice as both QTL being functional had latest heading date (see figure 4 above).
Regarding claims 8, Zhang et al. does not teach screening for progenies carrying Pigm without positive TPS utilizing markers M80410 and ZLM7-1.
Zhou et al. teaches a Kongyu 131 (KY131) from Northeast Chine when crossed to BL6 carrying Pi1 and Pi2 genes for blast resistance from Jiansanjiang of Heilongjiang Province and backcrossed four times using marker assisted backcrossing to produce BC4F2 lines, the plant showed a delayed heading date in long day conditions because of large fragment of Hd1 gene was introgressed in plant carrying Pi2 gene due to linkage drag of the heading date gene Hd1 (page 540, left last and right paragraphs 1-2). Zhou et al. teaches method of breaking linkage drag due to Hd1 (9.3 Mb on Chr06) which is closely linked to Pi2 (10.4 Mb on Chr06) approximately 1.1Mb away by developing large BC4F4 population wherein the recombinant between Hd1 and Pi2 identified when identified in long day conditions showed the early a KY131 line harboring Pi2 without changing the heading date or early as the KY131 (page 540, paragraph 3). Zhou et al. also teaches the Ghd7/Hd4 gene in 328 cultivars and developing improved lines with Hd4NHd5NHd2NHd1FPi1F (page 544, right paragraph 1) showing importance of developing A_bb allele showing the rice line with negative TPS and disease resistance. This would have carried out the screening progenies carrying Pigm without positive TPS in plant resistance breeding.
Zhou et al. does not specifically teach the markers M80410 and ZLM7-1.
Deng et al. teaches marker M80410 with forward and backward primer GGATTGTCTTGTCTCTCTCGC and CAGGACTTAGGGTTTCTCTCTTT (Deng et al., supplementary Table S7, page 42) that were found to co-segregate with Pigm locus (page 3, last paragraph). Further Deng et al. taches molecular breeding of cultivar GM4 (Pigm) was crossed with varieties Maratelli (japonica), and Nipponbare (japonica) and backcrossed to generate BC4F1 lines where near isogenic lines NILPigms carrying a genomic fragment with Pigm locus was selected in the Japonica varieties (page9, paragraph 2).
For this reason, it would have been obvious to an skill in the art to use the marker M80410 to select for Pigm locus in chromosome 6 Japonica rice progenies as qHd6. Furthermore, Deng et al. showed that the Pigm R8 and Pigm R9 gene is located within 90473-97733 and 112801-118005 (see enclosed PDF) which is the same region in locus KU904633.2 of cultivar Gumei4. Specifically, Pigm R8 is within the same location of 9,336,359- 9,338,643 (i.e. qHd6 or Hd1) showed by the Li et al. For this reason, there was high predictability to associate the M80410 and the PigmR8 with the heading date because of their position within the same chromosome interval in chromosome 6.
Designing a specific primer for example for qHd7 is located in 8,556,052-11,072,552 bp interval on chromosome 7 is known in the art. Ye et al. teaches a tool Primer-BLAST which can be used to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (Ye, page 1, Abstract) and Ye teaches an example to design primers using the human zinc finger protein 419 (ZNF419) transcript variant 5 mRNA (Genbank accession: NM_001098494) (Ye, page 6, left paragraph 2). Furthermore, alignment of SEQ ID NOs:1 and 2 as forward and reverse primer for PCR primer named ZLM7-1 was common sequence in rice cultivars (see sequence alignment above).
Therefore, someone skilled in the art would utilize the molecular marker sets to break the linkage drag of later flowering with Pigm gene to select for early flowering japonica germplasm with negative TPS and strong blast resistance as taught by Zhou et al. to further select the nonfunctional gene GHd7 gene as taught by Zhang et al. to invent the germplasms with earlier flowering in long day conditions or negative TPS (i.e. without positive TPS) and blast disease resistance. Furthermore, add the marker set identified by primers M80410 and ZLM7-1 associated with Pigm and GHd6 and Ghd7 respectively to invent the application for selecting japonica progenies using marker assisted selection for negative TPS and blast resistance. Therefore, the sensitivity module of rice would be northern early japonica derived from crosses with Pigm donor as one parent.
Response to Argument
Applicant's arguments filed 08/27/2025 have been fully considered but they are not persuasive.
Applicant argues claim 8 now depends from claim 2, and incorporates all the elements of claim 2. Applicant argues the combined teaching of Zhang, Zhang II, Ye, Deng, and Zhou fails to teach or suggest the above combined teaching of Zhang, Zhang II, Ye, Deng, and Zhou fails to teach or suggest the above recited elements of claim 2, namely, "a marker set for a photo-sensitivity module, comprising: a combination of two loci, named qHd6 and qHd7, which are located in 8, 665,233-9,600,319 bp interval on chromosome 6 and 8,556,052- 11,072,552 bp interval on chromosome 7, respectively, based on the reference genome of IRGSP vl.0 for rice ... the marker set can be identified by using Polymerase Chain Reaction (PCR) with primers ... a PCR primer named M80410 for qHd6 comprises a forward primer sequence: GGATTGTCTTGTCTCTCTCGC (SEQ ID NO: 3) and a reverse primer sequence: CAGGACTTAGGGTTTCTCTCTTT (SEQ ID NO: 4); and a PCR primer named ZLM7-l for qHd7 comprises a forward primer sequence: TCCCCCAAACATTTTCAGAACAC (SEQ ID NO: 1) and a reverse primer sequence: TAGGTGCAGTTGCAGTAGGT (SEQ ID NO: 2)." (Response to Rejection, page 10, paragraph 2).
Applicant argues claim 2 and its dependent claim 8 are allowable over the combined teaching of Zhang, Zhang II, Ye, Deng, and Zhou (Response to Rejection, page 10, second to last paragraph).
Applicant’s arguments have been fully considered but they are not persuasive since the claim recite the phrase “can be” it would mean any other markers effecting photosensitivity would also encompassed in markers and the primers M80410 and ZLM7-1 would be one of the examples. Furthermore, it would have been obvious to try to develop primer sets including SEQ ID NOs:3-4 as taught by Deng et al. and develop the primer with forward and reverse primers of SEQ ID NOs: 1 and 2 as taught by Ye et using the tool Primer-BLAST which can be used to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (Ye et al., page 1, Abstract). Furthermore, it is clear from Zhou et al. to further select the nonfunctional gene GHd7 gene as taught by Zhang et al. to invent the germplasms with earlier flowering in long day conditions or negative TPS (i.e. without positive TPS) and blast disease resistance.
Furthermore, where a rejection of a claim is based on two or more references, a reply that is limited to what a subset of the applied references teaches or fails to teach, or that fails to address the combined teaching of the applied references may be considered to be an argument that attacks the reference(s) individually. Where an applicant’s reply establishes that each of the applied references fails to teach a limitation and addresses the combined teachings and/or suggestions of the applied prior art, the reply as a whole does not attack the references individually as the phrase is used in Keller and reliance on Keller would not be appropriate. This is because the test for obviousness is what the combined teachings of the references would have suggested to a person having ordinary skill in the art (PHOSITA).”
Claim Rejections - 35 USC § 112 - improper dependent form
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 8 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
The claim 8 does not further limit of the subject matter of the marker set of the dependent claim 2, because the rice being northern early derived from crosses with Pigm donor s one parent does not further limit the marker set recited in claim 2.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Summary
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Examiner’s Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SANTOSH SHARMA whose telephone number is (571)272-8440. The examiner can normally be reached Mon-Fri 8:00 AM - 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, AMJAD A. ABRAHAM can be reached at (571)270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SANTOSH SHARMA/Examiner, Art Unit 1663
/DAVID H KRUSE/Primary Examiner, Art Unit 1663
Prosecution Insights