Prosecution Insights
Last updated: October 04, 2026
Application No. 18/357,624

INSECT RESISTANT INIR6 TRANSGENIC MAIZE PLANTS LACKING A SELECTABLE MARKER AND JUNCTION

Non-Final OA §103§112§DP
Filed
Jul 24, 2023
Priority
Jul 31, 2020 — provisional 63/059,860 +12 more
Examiner
KUBELIK, ANNE R
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Inari Agriculture Technology Inc.
OA Round
1 (Non-Final)
76%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
75%
With Interview

Examiner Intelligence

Grants 76% — above average
76%
Career Allowance Rate
1021 granted / 1347 resolved
+15.8% vs TC avg
Minimal -1% lift
Without
With
+-0.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
30 currently pending
Career history
1382
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
18.8%
-21.2% vs TC avg
§102
21.0%
-19.0% vs TC avg
§112
39.2%
-0.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1347 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Applicant’s election without traverse of Group I (claims 1-2 and 4-8) in the reply filed on 3 February 2026 is acknowledged. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The priority date for the instant claim 2 is the date of the filing of PCT/US2021/044198, the PCT upon which this application and its parent are based. SEQ ID NO:25 first appears in PCT/US2021/044198 and is not present in any of the provisional applications to which this application claims priority. Claim Objections Claims 7-8 are objected to because of the following informalities: In claims 7-8, either --, said method-- or --the method- should be inserted after “seed”, as currently the comprising phrase modifies “seed” instead of “method”. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of the second paragraph of 35 U.S.C. 112: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2 and 4-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter that the inventor or a joint inventor, or for pre-AIA the applicant, regards as the invention. Dependent claims are included in all rejections. Claim 1 lacks antecedent basis for the following limitations: “the Cry1F” and “the … Cry34Ab1” in line 2, “the … Cry35Ab1 genes” in lines 2-3, “the DP-4114 transgenic locus” in line 3, “the 3' DNA junction polynucleotide” in lines 3-4, and “the … phosphinotricin acetyltransferase (PAT) selectable marker gene” in line 4. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1 and 4-8 are rejected under 35 U.S.C. 103(a) as being unpatentable over Diehn et al (2013, US 8,575,434) in view of Srivastava et al (2017, Plant Cell Tiss. Organ Cult. 129:153-160). The claims are drawn to a maize plant or plant cell comprising an INIR6 locus that is a truncation of DP-4114 in which the PAT gene cassette is deleted. Diehn et al teach maize event DP-004114-3, which the instant application calls DP-4114 (instant ¶3). Their SEQ ID NO:6 is the sequence of the event and is identical to the instant SEQ ID NO:1 (alignment available upon request). It consists of 2422 bp 5’ genomic border sequence, 11,925 bp insert, 2405 bp 3’ genomic border sequence (paragraph spanning columns 31-32). The insert is shown in Table 1, but lacks 29 bp at the right border and 24 bp at the left border (column 32, lines 2-4). The insert has expression cassettes for Bt toxins cry1F, cry34Ab1, and cry35Ab1 and herbicide resistance protein phosphinothricin acetyltransferase (PAT) (Table 1) The exact bases of the prior art’s SEQ ID NO:6/instant SEQ ID NO:1 that correspond to the PAT cassette are as follows: Element Bases of ‘434’s SEQ ID NO:5 Bases of instant SEQ ID NO:1 Polylinker 10323-10367 12716-12760 CaMV35S promoter 10368-10897 12717-13290 Polylinker 10898-10916 13291-13309 Pat gene 10917-11468 13310-13861 Polylinker 11469-11488 13862-13881 CaMV35S terminator 11489-11680 13882-14073 Polylinker 11681-11756 14074-14149 Ti plasmid 11757-11953 14150-14346 Left border 11954 11347 Diehn et al claim maize plants and seeds comprising the event (claims 6 and 8); the plants comprise plant cells comprising the event. Diehn et al also claim a method of obtaining hybrid plants with the event, comprising crossing maize plants with the event to plants of a different genotype (claim 21). Diehn et al do not teach a maize plant or plant cell comprising a truncation of DP-4114 in which the PAT gene cassette is deleted. Srivastava et al teach a method for the precise deletion of a gene. It uses CRISPR Cas9 and gRNAs that target the ends of the gene they wish to excise, in their case a transgenic construct encoding GUS (paragraph spanning the columns on pg 154). They teach the construction of a construct comprising the two gRNAs that target GUS and transformation of it and a construct encoding CRISPR Cas9 into plants (pg 154, right column, paragraph 2; Table 1; Figure 1). The gene was excised in the callus phase (pg 156, right column, paragraph 2) and plants produced (pg 157, left column, paragraph 2). The gRNAs were designed to take advantage of CRISPR Cas9 TGG and CGG PAM sites near the 5’ and 3’ ends of the GUS gene (Table 1; Figure 1a). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to delete the PAT gene from the maize DP-4114 event taught by Diehn et al using the method described in Srivastava et al. One of ordinary skill in the art would have been motivated to do so to allow the plants to be retransformed with an additional construct via use the same marker gene(Srivastava et al, pg 153, right column, paragraph 1). One of ordinary skill in the art would design the gRNAs to take advantage of CRISPR Cas9 TGG PAM sites near the 5’ and 3’ ends of the PAT gene construct in the DP-4114 event. Below, two possible such gRNAs are underlined and the TGG PAM sites are in bold: Qy 12654 TAATCATATATAATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTT 12713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10261 TAATCATATATAATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTT 10320 Qy 12714 GCGAATTATCGATGGGCCCCGGCCGAAGCTGGCCGCGGACCGAATTCCCATGGAGTCAAA 12773 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10321 GCGAATTATCGATGGGCCCCGGCCGAAGCTGGCCGCGGACCGAATTCCCATGGAGTCAAA 10380 Qy 12774 GATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAG 12833 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10381 GATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAG 10440 Qy 12834 TCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCT 12893 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10441 TCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCT 10500 Qy 12894 TGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTT 12953 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10501 TGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTT 10560 Qy 12954 TCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTT 13013 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10561 TCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTT 10620 Qy 13014 TATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGG 13073 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10621 TATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGG 10680 Qy 13074 AAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC 13133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10681 AAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCAC 10740 Qy 13134 GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATG 13193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10741 GAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATG 10800 Qy 13194 TGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTC 13253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10801 TGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTC 10860 Qy 13254 CTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCCACCATGT 13313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10861 CTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCCACCATGT 10920 Qy 13314 CTCCGGAGAGGAGACCAGTTGAGATTAGGCCAGCTACAGCAGCTGATATGGCCGCGGTTT 13373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10921 CTCCGGAGAGGAGACCAGTTGAGATTAGGCCAGCTACAGCAGCTGATATGGCCGCGGTTT 10980 Qy 13374 GTGATATCGTTAACCATTACATTGAGACGTCTACAGTGAACTTTAGGACAGAGCCACAAA 13433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 10981 GTGATATCGTTAACCATTACATTGAGACGTCTACAGTGAACTTTAGGACAGAGCCACAAA 11040 Qy 13434 CACCACAAGAGTGGATTGATGATCTAGAGAGGTTGCAAGATAGATACCCTTGGTTGGTTG 13493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11041 CACCACAAGAGTGGATTGATGATCTAGAGAGGTTGCAAGATAGATACCCTTGGTTGGTTG 11100 Qy 13494 CTGAGGTTGAGGGTGTTGTGGCTGGTATTGCTTACGCTGGGCCCTGGAAGGCTAGGAACG 13553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11101 CTGAGGTTGAGGGTGTTGTGGCTGGTATTGCTTACGCTGGGCCCTGGAAGGCTAGGAACG 11160 Qy 13554 CTTACGATTGGACAGTTGAGAGTACTGTTTACGTGTCACATAGGCATCAAAGGTTGGGCC 13613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11161 CTTACGATTGGACAGTTGAGAGTACTGTTTACGTGTCACATAGGCATCAAAGGTTGGGCC 11220 Qy 13614 TAGGATCCACATTGTACACACATTTGCTTAAGTCTATGGAGGCGCAAGGTTTTAAGTCTG 13673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11221 TAGGATCCACATTGTACACACATTTGCTTAAGTCTATGGAGGCGCAAGGTTTTAAGTCTG 11280 Qy 13674 TGGTTGCTGTTATAGGCCTTCCAAACGATCCATCTGTTAGGTTGCATGAGGCTTTGGGAT 13733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11281 TGGTTGCTGTTATAGGCCTTCCAAACGATCCATCTGTTAGGTTGCATGAGGCTTTGGGAT 11340 Qy 13734 ACACAGCCCGGGGTACATTGCGCGCAGCTGGATACAAGCATGGTGGATGGCATGATGTTG 13793 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11341 ACACAGCCCGGGGTACATTGCGCGCAGCTGGATACAAGCATGGTGGATGGCATGATGTTG 11400 Qy 13794 GTTTTTGGCAAAGGGATTTTGAGTTGCCAGCTCCTCCAAGGCCAGTTAGGCCAGTTACCC 13853 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11401 GTTTTTGGCAAAGGGATTTTGAGTTGCCAGCTCCTCCAAGGCCAGTTAGGCCAGTTACCC 11460 Qy 13854 AGATCTGAGTCGACCTGCAGGCATGCCCGCTGAAATCACCAGTCTCTCTCTACAAATCTA 13913 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11461 AGATCTGAGTCGACCTGCAGGCATGCCCGCTGAAATCACCAGTCTCTCTCTACAAATCTA 11520 Qy 13914 TCTCTCTCTATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGG 13973 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11521 TCTCTCTCTATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGG 11580 Qy 13974 TTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATAC 14033 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11581 TTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATAC 11640 Qy 14034 TTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGGGCGAGCTCGAATTCGAGC 14093 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11641 TTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGGGCGAGCTCGAATTCGAGC 11700 Qy 14094 TCGAGCCCGGGTGGATCCTCTAGAGTCGACCTGCAGAAGCTTCGGTCCGGCGCGCCTCTA 14153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11701 TCGAGCCCGGGTGGATCCTCTAGAGTCGACCTGCAGAAGCTTCGGTCCGGCGCGCCTCTA 11760 Qy 14154 GTTGAAGACACGTTCATGTCTTCATCGTAAGAAGACACTCAGTAGTCTTCGGCCAGAATG 14213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11761 GTTGAAGACACGTTCATGTCTTCATCGTAAGAAGACACTCAGTAGTCTTCGGCCAGAATG 11820 Qy 14214 GCCTAACTCAAGGCCATCGTGGCCTCTTGCTCTTCAGGATGAAGAGCTATGTTTAAACGT 14273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11821 GCCTAACTCAAGGCCATCGTGGCCTCTTGCTCTTCAGGATGAAGAGCTATGTTTAAACGT 11880 Qy 14274 GCAAGCGCTACTAGACAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTC 14333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11881 GCAAGCGCTACTAGACAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTC 11940 Qy 14334 TAAGCGTCAATTTGGAACAAGTGGCTATCGCCAGATATAAGAACTTCGATCCGAAATATC 14393 |||||||||||||| Db 11941 TAAGCGTCAATTTG 11954 Because the gRNAs span the PAT gene, after excision it would be deleted, producing maize plants comprising a truncation of DP-4114 in which the PAT gene cassette is deleted but retaining the cry1F, cry34Ab1, and cry35Ab1 expression cassettes. It would have been obvious to one of ordinary skill in the art to self the resulting plants to generate more seed and plants with the truncated event. It also would have been obvious to one of ordinary skill in the art to cross the resulting plants to plants of a different genotype to transfer the truncated event into other maize plants of other genetic backgrounds. Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over Diehn et al in view of Srivastava et al as applied to claims 1 and 4-8 above, and further in view of Schaart et al (WO 2019/238772). The claim is drawn to a transgenic maize plant with an INIR6 locus comprising SEQ ID NO:25, which is a truncation of DP-4114 in which the PAT gene cassette is deleted at particular sites. The teachings of Diehn et al in view of Srivastava et al are discussed above. Diehn et al in view of Srivastava et al do not teach a maize plant or plant cell comprising a truncation of DP-4114 in which the PAT gene cassette is deleted to form SEQ ID NO:25. Schaart et al teaches excision of a selectable marker in tobacco using Cpf1 (aka CRISPR Cas12a) (example 1). Schaart et al teaches the PAM site for Cpf1 (TTTN) and the crRNA recognition site (pg 11, lines 12-23). They teach how to construct constructs appropriate for excising the gene of interest, introduction into tobacco, and plants with the marker excised (pg 36, line 5, to pg 38, line 8; Figure 4, 11; pg 38, line 10, to pg 41, line 9; pg 42, line 22, to pg 53, line 11). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to modify the method of deleting the PAT gene from the maize DP-4114 event, and products produced, made obvious by Diehn et al in view of Srivastava et al to use CRISPR Cas12a as described in Schaart et al. One of ordinary skill in the art would have been motivated to do so substitution of one enzyme for another is a design choice/ There are suitable PAM sites in the polylinkers just upstream and downstream of the PAT gene cassette in the DP-4114 event. They are shown below in bold in the alignment of instant SEQ ID NO:25 against instant SEQ ID NO:1; the crRNAs one of ordinary skill in the art would use are underlined. Qy 12601 TCTTTGATGAACCAGATGCATTTCATTAACCAAATCCATATACATATAAATATTAATCAT 12660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12601 TCTTTGATGAACCAGATGCATTTCATTAACCAAATCCATATACATATAAATATTAATCAT 12660 Qy 12661 ATATAATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTTGCGAATT 12720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12661 ATATAATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTTGCGAATT 12720 Qy 12721 ATCGATGGGCCCC----------------------------------------------- 12733 ||||||||||||| Db 12721 ATCGATGGGCCCCGGCCGAAGCTGGCCGCGGACCGAATTCCCATGGAGTCAAAGATTCAA 12780 Qy 12734 ------------------------------------------------------------ 12733 Db 12781 ATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTA 12840 Qy 12734 ------------------------------------------------------------ 12733 Db 12841 CGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTAC 12900 Qy 12734 ------------------------------------------------------------ 12733 Db 12901 TCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAA 12960 Qy 12734 ------------------------------------------------------------ 12733 Db 12961 AGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG 13020 Qy 12734 ------------------------------------------------------------ 12733 Db 13021 AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCC 13080 Qy 12734 ------------------------------------------------------------ 12733 Db 13081 ATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGC 13140 Qy 12734 ------------------------------------------------------------ 12733 Db 13141 ATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATC 13200 Qy 12734 ------------------------------------------------------------ 12733 Db 13201 TCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATA 13260 Qy 12734 ------------------------------------------------------------ 12733 Db 13261 TAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCCACCATGTCTCCGGA 13320 Qy 12734 ------------------------------------------------------------ 12733 Db 13321 GAGGAGACCAGTTGAGATTAGGCCAGCTACAGCAGCTGATATGGCCGCGGTTTGTGATAT 13380 Qy 12734 ------------------------------------------------------------ 12733 Db 13381 CGTTAACCATTACATTGAGACGTCTACAGTGAACTTTAGGACAGAGCCACAAACACCACA 13440 Qy 12734 ------------------------------------------------------------ 12733 Db 13441 AGAGTGGATTGATGATCTAGAGAGGTTGCAAGATAGATACCCTTGGTTGGTTGCTGAGGT 13500 Qy 12734 ------------------------------------------------------------ 12733 Db 13501 TGAGGGTGTTGTGGCTGGTATTGCTTACGCTGGGCCCTGGAAGGCTAGGAACGCTTACGA 13560 Qy 12734 ------------------------------------------------------------ 12733 Db 13561 TTGGACAGTTGAGAGTACTGTTTACGTGTCACATAGGCATCAAAGGTTGGGCCTAGGATC 13620 Qy 12734 ------------------------------------------------------------ 12733 Db 13621 CACATTGTACACACATTTGCTTAAGTCTATGGAGGCGCAAGGTTTTAAGTCTGTGGTTGC 13680 Qy 12734 ------------------------------------------------------------ 12733 Db 13681 TGTTATAGGCCTTCCAAACGATCCATCTGTTAGGTTGCATGAGGCTTTGGGATACACAGC 13740 Qy 12734 ------------------------------------------------------------ 12733 Db 13741 CCGGGGTACATTGCGCGCAGCTGGATACAAGCATGGTGGATGGCATGATGTTGGTTTTTG 13800 Qy 12734 ------------------------------------------------------------ 12733 Db 13801 GCAAAGGGATTTTGAGTTGCCAGCTCCTCCAAGGCCAGTTAGGCCAGTTACCCAGATCTG 13860 Qy 12734 ------------------------------------------------------------ 12733 Db 13861 AGTCGACCTGCAGGCATGCCCGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCT 13920 Qy 12734 ------------------------------------------------------------ 12733 Db 13921 CTATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGGTTTCGCT 13980 Qy 12734 ------------------------------------------------------------ 12733 Db 13981 CATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATC 14040 Qy 12734 ------------------------------------------------------------ 12733 Db 14041 AATAAAATTTCTAATTCCTAAAACCAAAATCCAGGGCGAGCTCGAATTCGAGCTCGAGCC 14100 Qy 12734 ------------------------------------------------------------ 12733 Db 14101 CGGGTGGATCCTCTAGAGTCGACCTGCAGAAGCTTCGGTCCGGCGCGCCTCTAGTTGAAG 14160 Qy 12734 ------------------------------------------------------------ 12733 Db 14161 ACACGTTCATGTCTTCATCGTAAGAAGACACTCAGTAGTCTTCGGCCAGAATGGCCTAAC 14220 Qy 12734 ------------------------------------------------------------ 12733 Db 14221 TCAAGGCCATCGTGGCCTCTTGCTCTTCAGGATGAAGAGCTATGTTTAAACGTGCAAGCG 14280 Qy 12734 ------------------------------------------------------------ 12733 Db 14281 CTACTAGACAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGT 14340 Qy 12734 ------------------------------TAAGAACTTCGATCCGAAATATCGTTTCAA 12763 |||||||||||||||||||||||||||||| Db 14341 CAATTTGGAACAAGTGGCTATCGCCAGATATAAGAACTTCGATCCGAAATATCGTTTCAA 14400 Qy 12764 AACTAGAAAACAGCGCGGCTTTGGCTAAGCCGCGCACTATATAGGATTTTGGGCACCTTT 12823 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 14401 AACTAGAAAACAGCGCGGCTTTGGCTAAGCCGCGCACTATATAGGATTTTGGGCACCTTT 14460 Qy 12824 TGATGGAACGTGAAAGCGTACTGCGCACTAGTTATTTAGGTTGAACCTTGGATATACGGT 12883 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 14461 TGATGGAACGTGAAAGCGTACTGCGCACTAGTTATTTAGGTTGAACCTTGGATATACGGT 14520 Selection of these PAM sites for excision of the selectable marker would thus result in transgenic maize plants comprising the instant SEQ ID NO:25. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2 and 4-8 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 3-4 of U.S. Patent No. 11,753,648. ‘648 claims a biological sample comprising non-intact plant tissue comprising SEQ ID NO:34. SEQ ID NO:34 has 100% identity to bases 12365-13066 of SEQ ID NO:25: RESULT 2 US-17-680-647-25 Sequence 25, US/17680647 Patent No. 11753648 GENERAL INFORMATION APPLICANT: Nuccio, Michael APPLICANT: Kock, Michael APPLICANT: Price, Joshua L. TITLE OF INVENTION: INIR6 TRANSGENIC MAIZE FILE REFERENCE: P13421WO01 CURRENT APPLICATION NUMBER: US/17/680,647 CURRENT FILING DATE: 2022-02-25 PRIOR APPLICATION NUMBER: PCT/US21/43496 PRIOR FILING DATE: 2021-07-28 PRIOR APPLICATION NUMBER: PCT/US21/43207 PRIOR FILING DATE: 2021-07-26 PRIOR APPLICATION NUMBER: PCT/US21/43192 PRIOR FILING DATE: 2021-07-26 PRIOR APPLICATION NUMBER: PCT/US21/43187 PRIOR FILING DATE: 2021-07-26 PRIOR APPLICATION NUMBER: PCT/US21/43170 PRIOR FILING DATE: 2021-07-26 PRIOR APPLICATION NUMBER: PCT/US21/43161 PRIOR FILING DATE: 2021-07-26 PRIOR APPLICATION NUMBER: 63/203,137 PRIOR FILING DATE: 2021-07-09 PRIOR APPLICATION NUMBER: 17/302,121 PRIOR FILING DATE: 2021-04-23 PRIOR APPLICATION NUMBER: 63/201,029 PRIOR FILING DATE: 2021-04-09 PRIOR APPLICATION NUMBER: 17/302,110 PRIOR FILING DATE: 2021-04-23 Remaining Prior Application data removed - See File Wrapper or PALM. NUMBER OF SEQ ID NOS: 35 SEQ ID NO 25 LENGTH: 15115 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: synthetic Query Match 100.0%; Score 702; Length 15115; Best Local Similarity 100.0%; Matches 702; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGAAGTACTACTTCTGAGTCATGAGTCATGAGTCAGTTAACCTAGACTTGTCCATCTTCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12365 AGAAGTACTACTTCTGAGTCATGAGTCATGAGTCAGTTAACCTAGACTTGTCCATCTTCT 12424 Qy 61 GGATTGGCCAACTTAATTAATGTATGAAATAAAAGGATGCACACATAGTGACATGCTAAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12425 GGATTGGCCAACTTAATTAATGTATGAAATAAAAGGATGCACACATAGTGACATGCTAAT 12484 Qy 121 CACTATAATGTGGGCATCAAAGTTGTGTGTTATGTGTAATTACTAGTTATCTGAATAAAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12485 CACTATAATGTGGGCATCAAAGTTGTGTGTTATGTGTAATTACTAGTTATCTGAATAAAA 12544 Qy 181 GAGAAAGAGATCATCCATATTTCTTATCCTAAATGAATGTCACGTGTCTTTATAATTCTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12545 GAGAAAGAGATCATCCATATTTCTTATCCTAAATGAATGTCACGTGTCTTTATAATTCTT 12604 Qy 241 TGATGAACCAGATGCATTTCATTAACCAAATCCATATACATATAAATATTAATCATATAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12605 TGATGAACCAGATGCATTTCATTAACCAAATCCATATACATATAAATATTAATCATATAT 12664 Qy 301 AATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTTGCGAATTATCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12665 AATTAATATCAATTGGGTTAGCAAAACAAATCTAGTCTAGGTGTGTTTTGCGAATTATCG 12724 Qy 361 ATGGGCCCCTAAGAACTTCGATCCGAAATATCGTTTCAAAACTAGAAAACAGCGCGGCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12725 ATGGGCCCCTAAGAACTTCGATCCGAAATATCGTTTCAAAACTAGAAAACAGCGCGGCTT 12784 Qy 421 TGGCTAAGCCGCGCACTATATAGGATTTTGGGCACCTTTTGATGGAACGTGAAAGCGTAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12785 TGGCTAAGCCGCGCACTATATAGGATTTTGGGCACCTTTTGATGGAACGTGAAAGCGTAC 12844 Qy 481 TGCGCACTAGTTATTTAGGTTGAACCTTGGATATACGGTTCTCACTGCGCCAATGCAAGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12845 TGCGCACTAGTTATTTAGGTTGAACCTTGGATATACGGTTCTCACTGCGCCAATGCAAGG 12904 Qy 541 CTTGAAACTTGGTTAGTAATACGTACTCCCTCCGTTTCTTTTTATTTGTCGCTGGATAGT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12905 CTTGAAACTTGGTTAGTAATACGTACTCCCTCCGTTTCTTTTTATTTGTCGCTGGATAGT 12964 Qy 601 GCAATTTTGCACTATCGAGCGACAAATAAAAAGAAACGGAGGGAGTATATGATTGTCAGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12965 GCAATTTTGCACTATCGAGCGACAAATAAAAAGAAACGGAGGGAGTATATGATTGTCAGA 13024 Qy 661 TGTAGATATGTTTATTTATATATCACATACAGATATATAAAA 702 |||||||||||||||||||||||||||||||||||||||||| Db 13025 TGTAGATATGTTTATTTATATATCACATACAGATATATAAAA 13066 This region spans the deletion at base 12734 of the DP-4114 selectable marker in SEQ ID NO:25 as well as portion of DP-4114 cry35Ab1 gene and 3’ genomic DNA that is in the DP-4114 event. SEQ ID NO:34 thus makes obvious the selectable marker deletion in SEQ ID NO:25 and in maize plants comprising it. It would have been obvious to one of ordinary skill in the art to self the resulting plants to generate more seed and plants with the truncated event. It also would have been obvious to one of ordinary skill in the art to cross the resulting plants to plants of a different genotype to transfer the truncated event into other maize plants of other genetic backgrounds. Claims 1-2 and 4-8 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 22-26 and 30-31 of copending Application No. 19/402,043. Although the claims at issue are not identical, they are not patentably distinct from each other. ‘043 claims a maize plant cell comprising modified locus comprising a deletion of the PAT selectable marker cassette of the DP-4114 event; the modified locus includes SEQ ID NO:25, which is identical to the instant SEQ ID NO:25 as ‘043 is a continuation of the instant application. The maize plants claimed in ‘043 claims 30-31 thus encompass plants comprising SEQ ID NO:25 It would have been obvious to one of ordinary skill in the art to self the resulting plants to generate more seed and plants with the truncated event. It also would have been obvious to one of ordinary skill in the art to cross the resulting plants to plants of a different genotype to transfer the truncated event into other maize plants of other genetic backgrounds. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Anne R. Kubelik, Ph.D., whose telephone number is (571) 272-0801. The examiner can normally be reached Monday through Friday, 9:00 am - 5:00 pm Eastern. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham, can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Anne Kubelik/Primary Examiner, Art Unit 1663 /Amjad Abraham/SPE, Art Unit 1663 /YVONNE L EYLER/Director, Art Unit 1600
Read full office action

Prosecution Timeline

Jul 24, 2023
Application Filed
Jun 10, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742178
INSECT INHIBITORY PROTEINS
2y 1m to grant Granted Sep 22, 2026
Patent 12702107
SOYBEAN VARIETY 01098256
2y 8m to grant Granted Aug 11, 2026
Patent 12690534
MELON VARIETY NUN 71550 MEM
3y 8m to grant Granted Jul 28, 2026
Patent 12672625
PLANTS AND SEEDS OF CORN VARIETY CV988211
2y 6m to grant Granted Jul 07, 2026
Patent 12662682
METHOD FOR PRODUCING BIOLUMINESCENT PLANTS
3y 11m to grant Granted Jun 23, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
76%
Grant Probability
75%
With Interview (-0.7%)
2y 9m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1347 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month