The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s election without traverse of group I, SEQ ID NOs: 1, 6, and 187; 2’-O-methyl, trivalent branched linker, and phosphorothioate, and 2’-O-methyl in the reply filed on 2/20/25 is acknowledged.
The product claims are free of the prior art. In interest of compact prosecution, claims 74 and 82 has been rejoined.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 104 and 105 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 104 and 105 are directed to a compound but depend from a method claim (claim 82) and therefore the metes and bounds of the claims are not definite. The claims are indefinite because they combine different statutory classes (product and process) in a way that makes the scope of the claim unclear to a person of ordinary.
For purposes of the instant examination, the claims are interpreted as being directed to the method of claim 82, wherein the subject is human (claim 104) and the method of claim 82, wherein the TMPRSS6 associated disorder is selected from the group consisting of hereditary hemochromatosis, β-thalassemia, erythropoietic porphyria, and a disorder associated with iron overload (claim 105).
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 82, 104, and 105 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim recites a method of treating a subject having any disorder with any association to TMPRSS6, which is a genus that has not been adequately described in the specification. The specification discloses minimal species of disorders that are not representative of the entire claimed genus of any possible disorder that can be treated by inhibiting the expression of TMPRSS6.
The specification defines a "TMPRSS6 associated disorder", as used herein, is intended to include any disorder that can be treated or prevented, or the symptoms of which can be alleviated, by inhibiting the expression of TMPRSS6.
However, without further description of the genus, one would not be able to readily envision which disorders would necessarily be treatable by inhibition of TMPRSS6. One would not be able to readily envision which diseases are necessarily treatment by inhibition of TMPRSS6 alone. One would not be able to readily envision which disorders are necessarily included or excluded from the recited genus.
Claim 105 recites that the disorder is any disorder with any association with iron overload. Without further description of the genus, one would not be able to readily envision which disorders having any possible association with iron overload are treatable by inhibition of TMPRSS6 alone. For example, Jian et al. (Free Radical Biology & Medicine 50 (2011) 841–847) teach that iron overload is associated with breast cancer incidence (abstract) and therefore the instant genus encompasses breast cancer.
The claims are not directed to treatment of a recognizable and adequately described genus of disorders. The specification does not adequately describe the genus of disorders that are dependent upon expression of TMPRSS6 alone.
Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of disorders that can be treated by inhibition of expression of TMPRSS6 such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing.
Response to Arguments
It is noted that the previously pending scope of enablement rejection has been withdrawn in view of the need for the TMPRSS6 associated disorder to be a disease that is treatable by inhibition of TMPRSS6. However, should the claims be amended to specific disorders, the rejection may be applicable depending upon if the specification is enabling for treatment of that disorder.
As instantly drafted, the specific disorders that can in fact be treatable by inhibition of TMPRSS6 alone are not immediately evident.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 5, 24, 28, 29, 32, 41, 68, 74, 82, 101, and 102-105 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 10,988,768 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of US ‘768 B2 are directed to ds RNAi agents for inhibiting TMPRSS6 wherein the sense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence ACCUGCUUCUUCUGGUUCAUU (SEQ ID NO:139), and the antisense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187), wherein all nucleotides are modified and the duplex comprises a ligand. The instant claims require for substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides and wherein said-sense at least one strand is conjugated to a ligand attached at the 3'- terminus, the 5'-terminus or both termini. Both claim sets recite the same types of modifications, a pharmaceutical composition comprising the compound, and a trivalent linker. The claims are obvious variations of each other. The instant method claims are the intended use of the product of US ‘768 B2.
The instantly recited method is obvious in view of the patented product. Both applications disclose the same intended use of inhibition of the same target or treatment of diseases associated with the target.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached on M-F 8:00am-6:00pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/ Primary Examiner, Art Unit 1636