Prosecution Insights
Last updated: August 18, 2026
Application No. 18/376,217

TMPRSS6 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Non-Final OA §112§DP
Filed
Oct 03, 2023
Priority
May 22, 2013 — provisional 61/826,178 +6 more
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
3 (Non-Final)
75%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allowance Rate
1090 granted / 1454 resolved
+15.0% vs TC avg
Moderate +11% lift
Without
With
+11.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
80 currently pending
Career history
1513
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
33.8%
-6.2% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1454 resolved cases

Office Action

§112 §DP
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 7/17/26 has been entered. Applicant’s election without traverse of group I, SEQ ID NOs: 1, 6, and 187; 2’-O-methyl, trivalent branched linker, and phosphorothioate, and 2’-O-methyl in the reply filed on 2/20/25 is acknowledged. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 108 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 108 recites a method of treating a subject that is suffering from any disorder with any association to TMPRSS6, which is a genus that has not been adequately described in the specification. The specification discloses minimal species of disorders that are not representative of the entire claimed genus of any possible disorder that can be treated by inhibiting the expression of TMPRSS6. The specification defines a "TMPRSS6 associated disorder", as used herein, is intended to include any disorder that can be treated or prevented, or the symptoms of which can be alleviated, by inhibiting the expression of TMPRSS6. However, without further description of the genus, one would not be able to readily envision which disorders would necessarily be treatable by inhibition of TMPRSS6. One would not be able to readily envision which diseases are necessarily treatment by inhibition of TMPRSS6 alone. One would not be able to readily envision which disorders are necessarily included or excluded from the recited genus. The claims are not directed to a subject populating that is suffering from a recognizable and adequately described genus of disorders. The specification does not adequately describe the genus of disorders that are dependent upon expression of TMPRSS6 alone. Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of disorders that have any association to TMPRSS6 such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing. Response to Arguments The species of the specification are not representative of the entire claimed genus. Although the specification explains the TMPRSS6 mechanism, this is not an adequate description of which disorders necessarily have the required association to TMPRSS6. Given any specific condition, one would not be able to readily recognize if the condition has an association to TMPRSS6 as instantly recited. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 5, 24, 28, 29, 32, 41, 68, 74, 82, 101-104, and 106-108 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 10,988,768 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of US ‘768 B2 are directed to ds RNAi agents for inhibiting TMPRSS6 wherein the sense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence ACCUGCUUCUUCUGGUUCAUU (SEQ ID NO:139), and the antisense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187), wherein all nucleotides are modified and the duplex comprises a ligand. The instant claims require for substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides and wherein said-sense at least one strand is conjugated to a ligand attached at the 3'- terminus, the 5'-terminus or both termini. Both claim sets recite the same types of modifications, a pharmaceutical composition comprising the compound, and a trivalent linker. The claims are obvious variations of each other. The instant method claims are the intended use of the product of US ‘768 B2. The instantly recited method is obvious in view of the patented product. Both applications disclose the same intended use of inhibition of the same target or treatment of diseases associated with the target. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached on M-F 8:00am-6:00pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 03, 2023
Application Filed
May 08, 2025
Non-Final Rejection mailed — §112, §DP
Nov 03, 2025
Response Filed
Jan 20, 2026
Final Rejection mailed — §112, §DP
Jun 16, 2026
Response after Non-Final Action
Jul 17, 2026
Request for Continued Examination
Jul 20, 2026
Response after Non-Final Action
Aug 05, 2026
Non-Final Rejection mailed — §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12692496
COMPOSITIONS AND METHODS FOR MODULATING RPGR EXPRESSION
3y 11m to grant Granted Jul 28, 2026
Patent 12691135
INHIBITORS OF MICRO-RNA 22
3y 9m to grant Granted Jul 28, 2026
Patent 12686870
NOVEL TLR9 AGONISTS
4y 1m to grant Granted Jul 21, 2026
Patent 12685745
THERAPEUTIC CIRCULAR DNA FORMS
9m to grant Granted Jul 21, 2026
Patent 12680102
miRNAS FOR REDUCING VENTRICLE ENLARGEMENT
4y 5m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.4%)
2y 5m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 1454 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month