Prosecution Insights
Last updated: April 19, 2026
Application No. 18/398,506

ANTIBACTERIAL PEPTIDE P104 AND LYSIN LYSP53 WITH BROAD-SPECTRUM LYTIC ACTIVITY, AND APPLICATIONS THEREOF

Non-Final OA §101§102§112
Filed
Dec 28, 2023
Examiner
KUBELIK, ANNE R
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wuhan Institute Of Virology Chinese Academy Of Sciences
OA Round
1 (Non-Final)
76%
Grant Probability
Favorable
1-2
OA Rounds
2y 9m
To Grant
76%
With Interview

Examiner Intelligence

Grants 76% — above average
76%
Career Allow Rate
1001 granted / 1308 resolved
+16.5% vs TC avg
Minimal -1% lift
Without
With
+-1.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
60 currently pending
Career history
1368
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
18.8%
-21.2% vs TC avg
§102
16.3%
-23.7% vs TC avg
§112
40.9%
+0.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1308 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Claims 1-17 are pending. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Acknowledgment is made of applicant's claim for foreign priority based on an application filed in China on 5 July 2021. It is noted, however, that applicant has not filed a certified copy of the CN2021107606436 application as required by 37 CFR 1.55. Claim Objections Claims 6, 8, 10, 12-13 and 15-16 are objected to because of the following informalities: In claim 6, in line 1, the comma after “vector” should be deleted, and in line 3, “a” should be deleted. In claim 8, in line 1, the comma after “cell” should be deleted. In claim 10, in line 1, --wherein the method-- should inserted after the comma, and in part S2, “a” should be deleted. In claim 12, in line 2, --said method-- should inserted after the comma. In claims 13 and 16, in line 2, “comprises” should be replaced with --comprise-- to be grammatically consistent with the plural “bacteria” and the semi-colon should be deleted. In claim 15, in line 1, --said method-- should inserted after the comma. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-5 and 12-17 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. Claim 1 recites an antibacterial peptide P104 of SEQ ID NO:1 and claim 3 recites a lysin LysP53 of SEQ ID NO:2. The specification teaches that both of these proteins are from bacteriophage p53 (¶39 and 45). The claims recite the additional element that the peptide has lytic activity. However, lytic activity is an inherent feature of both the proteins is SEQ ID NOs:1 and 2. Thus, these claims are not directed to significantly more than products of nature. Claims 2 and 4 recites the additional element that the gene sequence of the proteins are specific nucleic acid sequences. However, these sequences do not confer any structure onto the protein, and merely recites nucleic acids that encode the proteins. Thus, these claims are not directed to significantly more than products of nature. Claim 5 recites the additional element that primer sequences configured to amplify the nucleotide sequence of the lysin LysP53 are SEQ ID NO:5 and SEQ ID NO:6. However, these sequences do not confer any structure onto the protein, and merely recites primers that amplify a nucleic acid that encodes that encode the protein. Thus, this claim is not directed to significantly more than a product of nature. Claims 12 and 15 are drawn to methods comprising lysing Gram-negative bacteria by applying the P104 of claim 1 or the LysP53 of claim 3, respectively. However, bacteriophage p53 lyses Gram-negative bacteria (Luo et al, 2018, Analytica Chimica Acta 1044:147-153; see pg 150, right column, ¶1-2) and would encounter them in nature, as phage p53 was isolated from sewage (pg 148, right column, ¶2). As bacteriophage p53 encodes both P104 and LysP53, the phage would direct the production of both of these enzymes in Gram-negative bacteria, leading to the lysis of those bacteria. Thus, these claims are not directed to significantly more than processes of nature. Claims 13 and 16 are drawn to the methods where the Gram-negative bacteria species are listed. However, all these bacterial species are present in sewage and other places where human and animal feces may be present, like lakes and streams. Thus, these claims are not directed to significantly more than processes of nature. Claims 14 and 17 are drawn to the methods where the gene sequences of the P104 of claim 1 or the LysP53 of claim 3 are recited. However, these gene sequences are those present in bacteriophage p53 (specification¶39 and 45). Thus, these claims are not directed to significantly more than processes of nature. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 6-11 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Claims 6-9 are drawn to vector pET28a-LysP53 and host cells comprising it. The specification does not teach the sequence of the insert of the vector and only teaches that it was made by amplification from bacteriophage p53. While bacteriophage p53 was mentioned in the prior art (Luo et al, 2018, Analytica Chimica Acta 1044:147-153), it does not appear to be publicly available. Thus, one of skill in the art would not be able to make pET28a-LysP53. Claims 10-11 are drawn to a method of preparing LysP53, where the method comprises amplifying the LysP53 gene from bacteriophage p53 and constructing pET28a-LysP53. As bacteriophage p53 does not appear to be publicly available, one of skill in the art would not be able to make pET28a-LysP53 or prepare LysP53 by the recited method. Since bacteriophage p53 is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. If the plasmids are not so obtainable or available, a deposit of microorganism containing bacteriophage p53 may satisfy the requirements of 35 USC 112. The specification does not disclose a repeatable process to obtain bacteriophage p53 and it is not apparent if bacteriophage p53 is readily available to the public. Thus, a deposit is required for enablement purposes. If the deposit is made under the terms of the Budapest Treaty, then a statement, affidavit or declaration by Applicants, or a statement by an attorney of record over his or her signature and registration number, or someone empowered to make such a statement, stating that the instant invention will be irrevocably and without restriction released to the public upon the issuance of a patent, and that deposit was accepted under the Budapest Treaty would satisfy the deposit requirement made herein. If the deposit is not been made under the Budapest Treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801-1.809 and MPEP 2402-2411.05, Applicant may provide assurance of compliance by statement, affidavit or declaration, or by someone empowered to make the same, or by a statement by an attorney of record over his or her signature and registration number showing that: (a) during the pendency of this application, access to the invention will be afforded to the Commissioner upon request; (b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent; (c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and (d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807). In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.801 - 1.809 [MPEP 2401-2411.05] for additional explanation of these requirements. ``` The following is a quotation of 35 U.S.C. 112(b): (B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of the second paragraph of 35 U.S.C. 112: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2, 4-9, and 12-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter that the inventor or a joint inventor, or for pre-AIA the applicant, regards as the invention. Dependent claims are included in all rejections. Claim 2 lacks antecedent basis for the limitation “the gene sequence of the antimicrobial peptide P104”. Claim 4 lacks antecedent basis for the limitation “the gene sequence of the lysin LysP53”. Claims 5 and 7 are indefinite in their recitation of “the nucleotide sequence of the lysin LysP53” as lysin LysP53 is a protein. Claim 5 is drawn to a protein where primer sequences configured to amplify the nucleotide sequence of the protein. It is not clear how the primer sequences are related to the claimed protein, as primers that amplify a nucleotide sequence that encodes it have nothing to do with the protein itself. Claim 6 lacks antecedent basis for the limitation “the gene sequence of the lysin LysP53 as claimed in claim 4” as claim 4 is drawn to a protein. Claims 12 and 15 are indefinite because it is not clear what antimicrobial peptide P104 and lysin LysP53, respectively, are applied to. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), fourth paragraph: Subject to the [fifth paragraph of 35 U.S.C. 112 (pre-AIA )], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 2, 4-9, 14 and 17 are rejected under 35 U.S.C. 112(d) or 35 U.S.C. 112(pre-AIA ), fourth paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Parent claims 1 and 3 are drawn to an antibacterial peptide P104 of SEQ ID NO:1 and a lysin LysP53 of SEQ ID NO:2, respectively. Dependent claims 2 and 4 recite the gene sequence of the proteins. However, these gene sequences do not confer alter the structure of the claimed proteins. Thus, the claims fail to further limit the subject matter of the claims upon which they depend. Claim 5 is drawn to the protein of claim 4 where primer sequences configured to amplify the nucleotide sequence of the protein. It is not clear how the primer sequences are related to the claimed protein, as primers that amplify a nucleotide sequence that encodes it have nothing to do with the protein itself. Thus, the claim fails to further limit the subject matter of the claim upon which it depends. Claim 7 is drawn to the vector of claim 6, and claim 9 is drawn to a host cell comprising the vector, where primer sequences configured to amplify the nucleotide sequence of the protein. The vector of claim 6, pET28a-LysP53, either has or does not have sequences that can be amplified by the recited primers. In either case, the claim fails to further limit the subject matter of the claim upon which it depends. Parent claims 12 and 15 are drawn to methods comprising lysing Gram-negative bacteria by applying the P104 of claim 1 or the LysP53 of claim 3, respectively. Dependent claims 14 and 17 are drawn to the methods where the gene sequences of the P104 of claim 1 or the LysP53 of claim 3 are recited. However, the gene sequences that encode these proteins to do alter the P104 of claim 1 or the LysP53 of claim 3. Thus, the claims fail to further limit the subject matter of the claims upon which they depend. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claims 1-5 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank MW590698 (2021, https://www.ncbi.nlm.nih.gov/nuccore/MW590698). GenBank teaches the nucleic acid sequence of bacteriophage p53, which encodes SEQ ID NOs:1 and 2: MW590698 LOCUS MW590698 42916 bp DNA circular PHG 10-MAR-2021 DEFINITION UNVERIFIED: Acinetobacter phage 53, complete genome. ACCESSION MW590698 VERSION MW590698.1 KEYWORDS UNVERIFIED. SOURCE Acinetobacter phage 53 ORGANISM Acinetobacter phage 53 Viruses; Duplodnaviria; Heunggongvirae; Uroviricota; Caudoviricetes. REFERENCE 1 (bases 1 to 42916) AUTHORS Li,C. TITLE Direct Submission JOURNAL Submitted (11-FEB-2021) Center for Emerging Infectious Diseases, Wuhan Institute of Virology, Chinese Academy of Sciences, 44 Xiaohongshan, Wuchang, Wuhan, Hubei 430071, China COMMENT GenBank staff is unable to verify sequence and/or annotation provided by the submitter. ##Assembly-Data-START## Assembly Method :: soapdenovo v. 2 Sequencing Technology :: Illumina ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..42916 /organism="Acinetobacter phage 53" /mol_type="genomic DNA" /isolation_source="hospital" /host="Acinetobacter baumannii WHG40137" /db_xref="taxon:2813175" /geo_loc_name="China Alignment Scores: Length: 42916 Score: 169.00 Matches: 33 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-18-398-506-1 (1-33) x MW590698 (1-42916) Qy 1 MetThrMetThrThrLysArgIlePheGluHisMetArgProAsnLeuThrAspSerGln 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27352 ATGACGATGACAACAAAACGTATTTTCGAGCATATGCGTCCGAATCTCACGGACTCACAA 27411 Qy 21 ValGlnAlaLeuTyrLysLeuMetGluLysGlyAlaAsp 33 ||||||||||||||||||||||||||||||||||||||| Db 27412 GTACAAGCGCTGTACAAGCTCATGGAAAAAGGTGCAGAC 27450 MW590698 LOCUS MW590698 42916 bp DNA circular PHG 10-MAR-2021 DEFINITION UNVERIFIED: Acinetobacter phage 53, complete genome. ACCESSION MW590698 VERSION MW590698.1 KEYWORDS UNVERIFIED. SOURCE Acinetobacter phage 53 ORGANISM Acinetobacter phage 53 Viruses; Duplodnaviria; Heunggongvirae; Uroviricota; Caudoviricetes. REFERENCE 1 (bases 1 to 42916) AUTHORS Li,C. TITLE Direct Submission JOURNAL Submitted (11-FEB-2021) Center for Emerging Infectious Diseases, Wuhan Institute of Virology, Chinese Academy of Sciences, 44 Xiaohongshan, Wuchang, Wuhan, Hubei 430071, China COMMENT GenBank staff is unable to verify sequence and/or annotation provided by the submitter. ##Assembly-Data-START## Assembly Method :: soapdenovo v. 2 Sequencing Technology :: Illumina ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..42916 /organism="Acinetobacter phage 53" /mol_type="genomic DNA" /isolation_source="hospital" /host="Acinetobacter baumannii WHG40137" /db_xref="taxon:2813175" /geo_loc_name="China Alignment Scores: Length: 42916 Score: 1093.00 Matches: 209 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-18-398-506-2 (1-209) x MW590698 (1-42916) Qy 1 MetThrMetThrThrLysArgIlePheGluHisMetArgProAsnLeuThrAspSerGln 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27352 ATGACGATGACAACAAAACGTATTTTCGAGCATATGCGTCCGAATCTCACGGACTCACAA 27411 Qy 21 ValGlnAlaLeuTyrLysLeuMetGluLysGlyAlaAspLeuAspThrIleAlaGlnPhe 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27412 GTACAAGCGCTGTACAAGCTCATGGAAAAAGGTGCAGACCTTGACACCATTGCACAGTTC 27471 Qy 41 AlaGlyValSerProLeuValSerThrAlaAspValLysGlnProSerGlyPheLysPhe 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27472 GCAGGGGTATCGCCGTTAGTATCCACAGCCGACGTAAAACAGCCGAGCGGCTTTAAGTTC 27531 Qy 61 SerGlnThrSerLeuLysArgLeuGluGlyValAsnProLysLeuValGlnValValAsn 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27532 AGCCAAACATCATTAAAACGACTTGAGGGCGTAAATCCTAAGTTAGTGCAAGTGGTTAAT 27591 Qy 81 ArgAlaLeuGluIleSerLysGluAspPheMetValIleGluGlyValArgThrLysGlu 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27592 CGTGCCTTGGAAATCAGTAAAGAGGATTTCATGGTGATCGAAGGAGTCCGCACTAAGGAA 27651 Qy 101 SerAlaTrpAlaAsnTrpGlyLysGlyArgThrAlaAlaGlnCysGlnAlaAlaGlyVal 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27652 AGTGCATGGGCCAACTGGGGTAAAGGACGCACGGCGGCACAGTGCCAAGCTGCAGGAGTG 27711 Qy 121 ProThrLysTyrAlaGlnProSerLeuAlaLysValThrTrpLeuThrAspProLeuLys 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27712 CCGACCAAGTATGCCCAACCAAGTCTGGCTAAGGTGACATGGCTCACAGATCCACTTAAA 27771 Qy 141 SerLysHisMetThrGlyHisAlaValAspLeuAlaProIleProLeuAspTrpAsnAsp 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27772 AGCAAACACATGACAGGCCACGCCGTGGACCTAGCTCCAATCCCACTGGACTGGAACGAC 27831 Qy 161 LeuLysArgPheAspLeuMetAlaGlnAlaMetPheGlnAlaSerAlaGluLeuAsnIle 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27832 CTTAAACGATTCGACCTAATGGCCCAAGCGATGTTTCAAGCATCCGCCGAGTTAAATATC 27891 Qy 181 ProIleArgTrpGlyAlaAspTrpAspAsnAspGlyValPheArgGluLysGlyGluThr 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 27892 CCGATTCGTTGGGGTGCCGACTGGGACAACGATGGCGTATTCCGTGAAAAAGGTGAGACT 27951 Qy 201 AspSerProHisPheGluLeuAlaGly 209 ||||||||||||||||||||||||||| Db 27952 GACAGCCCACACTTTGAATTGGCGGGG 27978 Nucleic acids teach all proteins they encode. Applicant has made claim for foreign priority to CN2021107606436, filed 5 July 2021, but applicant has not filed a certified copy of it. Further, Applicant cannot rely upon a certified copy of the foreign priority application to overcome this rejection unless an English language translation of said application is made of record in accordance with 37 CFR 1.55. together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Claims 12-17 are rejected 35 U.S.C. 102(a)(1) as being anticipated by Luo et al, 2018, Analytica Chimica Acta 1044:147-153) taken with the evidence of GenBank MW590698 (2021, https://www.ncbi.nlm.nih.gov/nuccore/MW590698). Luo et al teaches lysing Gram-negative bacteria with bacteriophage p53 (pg 150, right column, ¶1-2). As bacteriophage p53 encodes both P104 and LysP53 (GenBank MW590698, see above), this method is inherently one of applying P104 and LysP53 to Gram-negative bacteria. Luo et al also teach PCR detection of bacteriophage p53 in a mixture of bacteria comprising Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae and Escherichia coli (paragraph spanning pg 151-152; Table 1). Preparation of this mixture is inherently one of applying P104 and LysP53 to those Gram-negative bacteria. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Anne R. Kubelik, Ph.D., whose telephone number is (571) 272-0801. The examiner can normally be reached Monday through Friday, 9:00 am - 5:00 pm Eastern. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham, can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Anne Kubelik/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Dec 28, 2023
Application Filed
Jan 21, 2026
Non-Final Rejection — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599074
Plants and Seeds of Corn Variety CV861286
2y 5m to grant Granted Apr 14, 2026
Patent 12595489
STERILE GENES AND RELATED CONSTRUCTS AND APPLICATIONS THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12593769
Plants and Seeds of Corn Variety CV870012
2y 5m to grant Granted Apr 07, 2026
Patent 12593773
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010538
2y 5m to grant Granted Apr 07, 2026
Patent 12588614
Plants and Seeds of Corn Variety CV899591
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
76%
Grant Probability
76%
With Interview (-1.0%)
2y 9m
Median Time to Grant
Low
PTA Risk
Based on 1308 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month