Prosecution Insights
Last updated: August 16, 2026
Application No. 18/403,862

METHODS AND COMPOSITIONS FOR TREATING SUBJECTS HAVING OR AT RISK OF DEVELOPING A NON-PRIMARY HYPEROXALURIA DISEASE OR DISORDER

Non-Final OA §102§103§112§DP
Filed
Jan 04, 2024
Priority
Jul 19, 2021 — provisional 63/223,278 +1 more
Examiner
WHITEMAN, BRIAN A
Art Unit
Tech Center
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
794 granted / 1161 resolved
+8.4% vs TC avg
Strong +17% interview lift
Without
With
+16.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
59 currently pending
Career history
1200
Total Applications
across all art units

Statute-Specific Performance

§101
6.8%
-33.2% vs TC avg
§103
30.4%
-9.6% vs TC avg
§102
19.6%
-20.4% vs TC avg
§112
25.7%
-14.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1161 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Objections Claims 1 and 2 are objected to because of the following informalities: the limitation “of of” on line 5. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-4, 6-9, 19, 21, 23, 27-29, and 34-36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1 and 2 recite the limitation " the subject" in line 6. There is insufficient antecedent basis for this limitation in the claim. Claim 19 recites the limitation " the subject" in line 2. There is insufficient antecedent basis for this limitation in the claim. The dependent claims are rejected because they are dependent on claims 1, 2, or 19. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 80-82 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Erbe et al. (WO 2019014530). ‘530 contains claims encompassing a method of treating a subject having a disorder that would benefit from a reduction in LDHA or treating or preventing at least one symptom in a subject having an oxalate pathway-associated disease, disorder or condition, comprising administering to the subject a therapeutically effective amount of the agent of any one of claims 1-66 or pharmaceutical composition of any one of claims 71-74, thereby treating or preventing the disorder that would benefit from a reduction in LDHA or preventing at least one symptom of an oxalate pathway associated disease in the subject, wherein the disease, disorder or condition is enteric hyperoxaluria, dietary hyperoxaluria and idiopathic hyperoxaluria; and wherein the agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. See pages 243-246. Claim 74 embraced by the method is directed to a pharmaceutical composition comprising a pharmaceutical composition, comprising a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of LDHA comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-5; and a second double stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAOl) comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 7-14. Page 245: discloses: Claim 109. The method of claim 108, wherein the hyperoxaluria disease, disorder, or condition is selected from the group consisting of primary hyperoxaluria, enteric hyperoxaluria, dietary hyperoxaluria, and idiopathic hyperoxaluria; claim 110. The method of claim 109, wherein the non-hyperoxaluria stone formation disease, disorder, or condition is hypercalciuria and/or hypocitraturia; and claim 111. The method of claim 110, wherein the non-hyperoxaluria stone formation disease, disorder, or condition is calcium oxalate or non-calcium oxalate kidney stone formation disease. Claims 80-82 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hinkle (WO 2016205323). Hinkle discloses using a polynucleotide agent that inhibits expression of HAO1 in a method of treating or preventing a HAO1-associated disease that is secondary hyperoxaluria which is enteric hyperoxaluria or resulting from high oxidate diet, deficiencies in intestinal oxalate degrading microorganism, genetic variations in intestinal oxalate transporters or renal transplantation. Pages 138-145. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-4, 6-9, 19, 21, 23, 27-29, and 34-36 are rejected under 35 U.S.C. 103 as being unpatentable over Erbe et al. (WO 2019014530). ‘530 contains claims encompassing a method of treating a subject having a disorder that would benefit from a reduction in LDHA or treating or preventing at least one symptom in a subject having an oxalate pathway-associated disease, disorder or condition, comprising administering to the subject a therapeutically effective amount of the agent of any one of claims 1-66 or pharmaceutical composition of any one of claims 71-74, thereby treating or preventing the disorder that would benefit from a reduction in LDHA or preventing at least one symptom of an oxalate pathway associated disease in the subject, wherein the disease, disorder or condition is enteric hyperoxaluria, dietary hyperoxaluria and idiopathic hyperoxaluria; and wherein the agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. See pages 45-94 and 243-246. Claim 74 embraced by the method is directed to a pharmaceutical composition comprising a pharmaceutical composition, comprising a first double stranded ribonucleic acid (dsRNA) agent that inhibits expression of LDHA comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-5; and a second dsRNA agent that inhibits expression of HAOl comprising a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 7-14. Page 245: discloses: Claim 109. The method of claim 108, wherein the hyperoxaluria disease, disorder, or condition is selected from the group consisting of primary hyperoxaluria, enteric hyperoxaluria, dietary hyperoxaluria, and idiopathic hyperoxaluria; claim 110. The method of claim 109, wherein the non-hyperoxaluria stone formation disease, disorder, or condition is hypercalciuria and/or hypocitraturia; and claim 111. The method of claim 110, wherein the non-hyperoxaluria stone formation disease, disorder, or condition is calcium oxalate or non-calcium oxalate kidney stone formation disease. ‘530 discloses SEQ ID NO: 220 (Db) and 596 are 100% in table 8 are 100% identical to instant SEQ ID NO: 33 Qy. Qy 1 GACTTTCATCCTGGAAATATA 21 Db 1 GACUTUCAUCCUGGAAAUAUA 21 ‘530 also discloses SEQ ID NO: 100 (Db) and 515 are 100% in table 8 are 100% identical to instant SEQ ID NO: 34 (Qy). Qy 1 TATATTTCCAGGATGAAAGTCCA 23 Db 1 UAUAUUUCCAGGATGAAAGUCCA 23 However, ‘530 does not specifically teach administering a fixed dose of about 200 mg to about 600 mg of a dsRNA which inhibits the expression of HAO1 to a human subject having a non-primary hyperoxaluria disease or disorder. A person of ordinary skill in the art would possess the knowledge that the average weight of a human worldwide is 62 kg and youth can be 32 kg to about 70kg depending on youth’s age. See MPEP 2141(II)C. Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.” MPEP 2141. FACTORS TO CONSIDER IN DETERMINING LEVEL OF ORDINARY SKILL The person of ordinary skill in the art is a hypothetical person who is presumed to have known the relevant art at the relevant time. Factors that may be considered in determining the level of ordinary skill in the art may include: (1) "type of problems encountered in the art;" (2) "prior art solutions to those problems;" (3) "rapidity with which innovations are made;" (4) "sophistication of the technology; and" (5) "educational level of active workers in the field." In re GPAC, 57 F.3d 1573, 1579, 35 USPQ2d 1116, 1121 (Fed. Cir. 1995). "In a given case, every factor may not be present, and one or more factors may predominate." Id. See also Custom Accessories, Inc. v. Jeffrey-Allan Indust., Inc., 807 F.2d 955, 962, 1 USPQ2d 1196, 1201 (Fed. Cir. 1986); Environmental Designs, Ltd. v. Union Oil Co., 713 F.2d 693, 696, 218 USPQ 865, 868 (Fed. Cir. 1983). It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to try a dose of about 200 mg to about 600 mg of the dsRNA agent to the human subject having a non-primary hyperoxaluria disease or disorder, namely to arrive at the claimed invention. See MPEP 2143(I)E. The specification does not appear to teach that the claimed dose range is crucial for carrying out the claimed method of that the dose results in any unexpected or superior result. ‘530 teaches that the agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. See pages 243-246. If the average weight of a human worldwide is 62 kg and a youth can be 32 kg to about 70kg depending on youth’s age, then depending on the human being administered the composition comprising the dsRNA, the dose could be about 200 mg to about 600 mg. For example, if the human subject being administered the dsRNA weighed 62 kg and was administered 10 mg/kg of the dsRNA, the dose would be 620mg and read on the dose of about 600mg ‘530 teaches the urinary oxalate is urinary calcium oxalate (page 10). ‘530 teaches that the disease or disorder can be idiopathic hyperoxaluria or a calcium oxalate or non-calcium oxalate kidney stone formation disease (page 10). ’530 teaches administering the dsRNA subcutaneously to the subject (page 12). ‘530 discloses SEQ ID NO: 220 (Db) and 596 are 100% in table 8 are 100% identical to instant SEQ ID NO: 33 Qy. Qy 1 GACTTTCATCCTGGAAATATA 21 Db 1 GACUTUCAUCCUGGAAAUAUA 21 ‘530 also discloses SEQ ID NO: 100 (Db) and 515 are 100% in table 8 are 100% identical to instant SEQ ID NO: 34 (Qy). Qy 1 TATATTTCCAGGATGAAAGTCCA 23 Db 1 UAUAUUUCCAGGATGAAAGUCCA 23 Each dsRNA is contemplated for use in the method made obvious by ‘530 (see page 241). The dsRNA would read on the structural limitations recited in instant claims 23 and 27. Thus, since ‘530 contemplates using these dsRNA, it would have been obvious for one of ordinary skill in the art try these dsRNA in claimed method. ‘530 teaches modifying all the nucleotides on the sense and antisense strand of the dsRNA, including at least one phosphorothioate (pages 45-90). It would have been obvious to use the dsRNA taught by ‘530 including all the nucleotides in both strands to study the bioavailability and/or therapeutic effect of the dsRNA when treating the disease. ‘530 teaches attaching a GalNac ligand to the dsRNA to assist in delivery of the dsRNA to the subject (pages 55-104). Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 80-82 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 27, 72, 73, 78-84, and 86-100 of copending Application No. 17945151 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace administering a dsRNA that inhibits the expression of HAO1 in a subject having a kidney stone, wherein the subject does not suffer from primary hyperoxaluria type 1 (PH1). Claims 1-4, 6-9, 19, 27-29, and 34-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 27, 72, 73, 78-84, and 86-100 of copending Application No. 17945151 in view of Erbe (WO2019014530). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace administering a dsRNA that inhibits the expression of HAO1 in a subject having a kidney stone disease. The only difference between the instant claims and the claims from ‘151 does not specifically embrace administering a fixed does of about 200 mg to about 600 mg of a dsRNA which inhibits the expression of HAO1 to a human subject having a non-primary hyperoxaluria disease or disorder. Claim 1 of ‘151 discloses a HAO1 dsRNA, wherein all of the nucleotides in both strands are modified. Claim 4 of ‘151 discloses that the subject is a human. Also claim 27 of ‘151 discloses that the ligand attached the dsRNA is one or more GalNAc derivatives. Claim 85 of ‘151 discloses subcutaneously administering the dsRNA to the subject. It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the claims of ‘151 with the teaching ‘530 to administer a dose of the HAO1 dsRNA of about 200 mg to about 600 mg, namely to arrive at the claimed invention. ‘530 teaches that the agent is administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. See pages 243-246. If the average weight of a human worldwide is 62 kg and a youth can be 32 kg to about 70kg depending on youth’s age, then depending on the human being administered the composition comprising the dsRNA, the dose could be about 200 mg to about 600 mg. For example, if the human subject being administered the dsRNA weighed 62 kg and was administered 10 mg/kg of the dsRNA, the dose would be 620mg and read on the dose of about 600mg. 530 teaches the urinary oxalate is urinary calcium oxalate (page 10). ‘530 teaches that the disease or disorder can be idiopathic hyperoxaluria or a calcium oxalate or non-calcium oxalate kidney stone formation disease (page 10). Claim 85 of ‘151 discloses subcutaneously administering the dsRNA to the subject. The dsRNA in claim 1 of ‘151 makes obvious the limitations instant claims 27-29 and 34-35. Also claim 27 of ‘151 discloses that the ligand attached the dsRNA is one or more GalNAc derivatives set forth in instant claim 36. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. This is a provisional nonstatutory double patenting rejection. Claims 80-82 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. 10946107. Although the claims at issue are not identical, they are not patentably distinct from each other because both claims embrace administering a single stranded antisense polynucleotide that inhibits HAO1 expression in a subject, wherein subject has an HAO1 associated disease selected from the group consisting of primary hyperoxaluria and secondary hyperoxaluria. Co-pending applications 17579655 and 18324191 and U.S. Patent Nos. 10478500; 11446380; 11261447 disclose claims directed to using dsRNA which inhibits the expression of HAO1 in a subject that has PH1, however, the claims do not suggest or make obvious the claimed methods requiring a subject not having a PH1. Conclusion See attached PTO-326 for disposition of claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jan 04, 2024
Application Filed
Jul 22, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698500
CTGF GENE-SPECIFIC DOUBLE-STRANDED OLIGONUCLEOTIDE, AND A COMPOSITION FOR PREVENTING AND TREATING FIBROTIC DISEASES AND RESPIRATORY-RELATED DISEASES COMPRISING SAME
4y 2m to grant Granted Aug 04, 2026
Patent 12698502
RNA APTAMERS AND USE THEREOF FOR TREATING CANCER
3y 10m to grant Granted Aug 04, 2026
Patent 12686867
RNAi AGENT TARGETING MYD88 AND USE THEREOF
3y 8m to grant Granted Jul 21, 2026
Patent 12680101
RNA MOLECULE, CHIMERIC NA MOLECULE, DOUBLE-STRANDED RNA MOLECULE, AND DOUBLE-STRANDED CHIMERIC NA MOLECULE
4y 0m to grant Granted Jul 14, 2026
Patent 12674165
OLIGONUCLEOTIDES FOR TREATMENT OF ANGIOPOIETIN LIKE 4 (ANGPTL4) RELATED DISEASES
4y 2m to grant Granted Jul 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+16.7%)
2y 8m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1161 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month