DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The preliminary amendments filed 17 October 2024 are acknowledged and have been entered. Claims 1, 10, 15, 20, 25, 28-31, 34, 44, 45, 51, 60, 62, 66, and 74 have been amended. Claims 2-9, 11-14, 16-19, 21-24, 26, 27, 35-43, 46-50, 52-59, 63-65, 67-73, and 75-77 have been canceled. Claims 1, 10, 15, 20, 25, 28-34, 44, 45, 51, 60, 62, 66, and 74 are pending and being examined on the merits.
Priority
The application is a continuation of PCT US2022/038613 filed 07/28/2022 which claims priority to applications 63/226,873 filed 07/29/2021 and 63/284,720 filed 12/01/2021.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c). Please see Tables 2-5
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on page 11, . Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The use of the several terms on pages 115-118, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
The following claims are objected to because of the following informalities:
Claims 1, 25, 51, and 74 are objected to because of inconsistent terminology. Claim 1 introduces the claimed subject matter as a “double stranded ribonucleic acid (dRNA) agent,” but subsequently refers to the agent as a “dsRNA agent.” Claims 25, 51, and 74 likewise recite a “dRNA agent,” whereas other claims consistently use “dsRNA agent.” Applicant is required to amend the claims to employ a consistent abbreviation for “double-stranded ribonucleic acid,” e.g., “dsRNA.”
Claim 1 recites “the dsRNA agent, or a pharmaceutically acceptable salt thereof”. This wording is somewhat cumbersome even though the intended scope is understandable. It would be remedial to recast that claim as “A double-stranded ribonucleic acid (dsRNA) agent … or a pharmaceutically acceptable salt of the dsRNA agent, wherein the dsRNA agent comprises…”
Claim 10 recites a Markush group identifying various nucleotide modifications. However, several members of the recited group are grammatically unclear or improperly phrased as a result of the amendment replacing references to a “modified nucleotide” with references to a “nucleotide modification.” For example, claim 10 recites: “a non-natural base comprising nucleotide modification,” “a nucleotide comprising a phosphorothioate group modification,” “a nucleotide comprising a methylphosphonate group modification,” “a nucleotide comprising a 5′-phosphate modification,” and “a nucleotide comprising a 5′-phosphate mimic modification.” These expressions inconsistently characterize the recited subject matter as either a nucleotide, a group comprised by a nucleotide, or a nucleotide modification, even though the introductory language of claim 10 requires selection of a “nucleotide modification” from the recited group. It would be remedial to amend the claim to provide grammatically consistent terminology identifying the particular nucleotide modifications intended to constitute members of the recited Markush group.
Claim 10 further inconsistently identifies certain members of the Markush group by naming a type of nucleotide followed by the term “modification,” e.g., “a locked nucleotide modification,” “an unlocked nucleotide modification,” and “a conformationally restricted nucleotide modification,” while other members identify a particular chemical modification or substituent. It would be remedial to revise the claim so that each member of the Markush group is stated in a grammatically and technically consistent manner.
Claims 15, 28, 34, and 45 are objected to because of informalities in the placement and/or repetition of the phrase “or a pharmaceutically acceptable salt thereof.” For example, claim 15 recites “a pharmaceutically acceptable salt thereof of claim 1,” claim 28 contains the same “thereof of claim 1” construction and additionally repeats the salt alternative after reciting the sense strand, claim 34 unnecessarily repeats “the dsRNA agent, or a pharmaceutically acceptable salt thereof” within the wherein clause, and claim 45 recites “the dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1.” It would be remedial to amend the claims to provide grammatically consistent language clearly identifying the claimed dsRNA agent and any pharmaceutically acceptable salt thereof.
Claim 28 recites “the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent, or a pharmaceutically acceptable salt thereof.” The latter recitation improperly places “or a pharmaceutically acceptable salt thereof” within the limitation defining the sense strand to which the ligand is conjugated, thereby suggesting that the salt itself is an alternative to the dsRNA agent having the sense strand. Although the intended meaning remains reasonably apparent from the dependency and claim 1, it would be remedial to amend the claim to clarify the intended subject matter.
Claim 30 recites “one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.” As grammatically written, the adjective “branched” modifies each member of the series, including “monovalent,” thereby reciting a “monovalent branched linker.” Applicant is required to amend the claim to clarify whether “branched” is intended to modify each of the monovalent, bivalent, and trivalent linker alternatives, or only the bivalent and trivalent linker alternatives.
Claim 34 recites “at least one phosphorothiate or methylphosphonate internucleotide linkage.” It appears that “phosphorothiate” is a typographical error for “phosphorothioate.” Applicant is required to correct the terminology.
Claim 34 redundantly recites “wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, further comprises” after already defining the claimed subject matter as “the dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1.” It would be remedial to amend the claim to remove the unnecessary repetition and clarify that the recited phosphorothioate or methylphosphonate internucleotide linkage is a linkage of the dsRNA agent.
Claim 60 recites “comprising administering to the subject a therapeutically effective amount of the dsRNA agent, or a pharmaceutically acceptable salt thereof, of claim 1.” The placement of the phrase “or a pharmaceutically acceptable salt thereof” renders the dependency unnecessarily awkward and interrupts the identification of the dsRNA agent of claim 1. Claim 60 further unnecessarily repeats the phrase “having the disorder that would benefit from reduction in HMGCR expression” following the recitation “thereby treating the subject.” it would be remedial to amend the claims to recite “A method of treating a subject having a disorder that would benefit from reduction in HMGCR expression, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of claim 1, or a pharmaceutically acceptable salt thereof, thereby treating the subject.”
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 10, 15, 20, 25, 28-34, 44, 45, 51, 60, 62, 66, and 74 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “a pharmaceutically acceptable salt thereof”. It is unclear if this recitation is referring to the previously recited “pharmaceutically acceptable salt thereof” or a different pharmaceutically acceptable salt thereof.
Claim 1 recites “one of the antisense nucleotide sequences in any one of Tables 2-5”. Incorporation by reference to a table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words” MPEP 2173.05(s). In this case, Applicant may refer to the SEQ ID NOs in the tables, rather than referring to the tables themselves.
Claim 1 recites, in alternative (a), that “the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs:1–8, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of the nucleotide sequence of any one of SEQ ID NOs:9–16.” It is unclear what is meant by “the corresponding portion.” In particular, the claim does not specify which one of SEQ ID NOs:9–16 corresponds to a selected one of SEQ ID NOs:1–8. For example, where the sense strand is defined relative to SEQ ID NO:1, the claim does not state whether the antisense strand must be defined relative to SEQ ID NO:9, i.e., the reverse complement corresponding to SEQ ID NO:1, or whether the phrase “any one of SEQ ID NOs:9–16” permits the antisense strand to be defined relative to any of SEQ ID NOs:9–16. Moreover, the claim does not identify which nucleotide positions within the selected SEQ ID NO:9–16 constitute the “corresponding portion” relative to the selected ≥15-nucleotide portion of SEQ ID NO:1–8. Because the claimed reference sequences extend for thousands of nucleotides, the scope of the required correspondence cannot be determined from the claim language with reasonable certainty. Accordingly, one of ordinary skill in the art would not be able to determine with reasonable certainty the metes and bounds of the antisense-strand limitation of alternative (a).
Claim 10 depends from claim 1, which requires that “all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification.” Claim 10 further recites that “at least one of the nucleotide modifications is selected from the group consisting of” the subsequently recited modifications and combinations thereof. It is unclear what is intended by “at least one of the nucleotide modifications.” In particular, it is unclear whether the limitation requires (i) at least one individual nucleotide of the dsRNA agent to comprise a modification selected from the recited group, while the modifications of the remaining nucleotides may fall outside the recited group; (ii) at least one type of nucleotide modification employed in the dsRNA agent to be selected from the recited group; or (iii) the nucleotide modifications required for all nucleotides by claim 1 to be selected from the recited group. These interpretations result in materially different scopes. Accordingly, the scope of claim 10 cannot be determined with reasonable certainty.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 10, 15, 20, 25, 28-34, 44, 45, 51, 60, 62, 66, and 74 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Claim 1 is directed to a double-stranded ribonucleic acid agent “for inhibiting expression” of HMGCR in a cell, or a pharmaceutically acceptable salt thereof. The claim encompasses a dsRNA having a sense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of SEQ ID NOs:1–8 and an antisense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from the corresponding portion of SEQ ID NOs:9–16, wherein every nucleotide of both strands comprises a modification and at least one strand is conjugated to a ligand.
The specification identifies SEQ ID NOs:1–8 as full HMGCR transcript sequences from human and other mammalian species and identifies SEQ ID NOs:9–16 as their corresponding reverse complements [pg. 10]. For example, human HMGCR transcript NM_000859.3 is SEQ ID NO:1 and the reverse complement thereof is SEQ ID NO:9 [pg. 10]. The informal sequence listing likewise identifies NM_000859.3 as SEQ ID NO:1. The sequences recited in claim 1(a) are not short RNAi species. Rather, SEQ ID NOs:1–16 are full-length transcript sequences or reverse complements thereof extending for thousands of nucleotides. Consequently, claim 1(a) is not confined to the particular target sites and duplexes disclosed in Tables 2–5. It broadly encompasses dsRNA sequences selected from substantially throughout the full lengths of these HMGCR sequences and further permits as many as three nucleotide differences within the claimed ≥15-nucleotide region. For illustration, for merely one 15-nucleotide window, the number of possible sequences differing by zero through three substitutions is over 13,000. A 4,000-nucleotide reference sequence contains approximately 3,986 different 15-nucleotide windows. Thus, even before considering longer claimed regions, the eight different HMGCR transcripts, corresponding antisense sequences, different modification patterns, and different ligands, alternative (a) embraces an extraordinarily large sequence genus. This calculation is offered only to illustrate the magnitude of the genus and is not itself the basis for the rejection. Although tables 2–5 identify selected unmodified and modified duplexes and corresponding target sites, those selected species do not reasonably establish possession of functional HMGCR inhibitors distributed across the vastly broader sequence space of claim 1(a).
The application’s own experimental results demonstrate substantial sequence-dependent variability. Table 6 reports testing of 42 HMGCR-directed duplexes in Hep3B cells. Eleven of the 42 tested agents produced at least approximately 100% message remaining. Thus, under the disclosed assay conditions, numerous specifically designed HMGCR RNAi agents showed no measured reduction of HMGCR message relative to the control. Table 7 likewise demonstrates substantial differences in activity among HMGCR-targeting agents; and Table 8 reports an even larger HMGCR screen and again shows extensive sequence-dependent variation. Accordingly, the disclosure demonstrates that having the claimed degree of sequence relationship to an HMGCR transcript does not, standing alone, identify the members that possess the claimed HMGCR-inhibiting function.
Furthermore, the specification states that methods described therein or known in the art can be used to determine whether an RNAi agent containing a mismatch to the target sequence is effective in inhibiting HMGCR expression and emphasizes the importance of considering efficacy of mismatch-containing RNAi agents [pg. 16]. Thus, the specification itself does not disclose a predictable correlation whereby a sequence falling anywhere within the ≥15-nucleotide/≤3-difference formula of claim 1(a) can be recognized from structure alone as possessing the required HMGCR-inhibitory function.
State of the art corroborates the absence of a sufficiently predictable structure-function correlation. Hibbitt (Hibbitt et al. Gene therapy 19.4 (2012): 463-467) reports successful HMGCR RNA interference, but Hibbitt employed a “predesigned and validated” human HMGCR-specific siRNA identified as s141 and a separately validated mouse Hmgcr siRNA [pg. 467; abstract]. Hibbitt reports that selected HMGCR siRNA concentrations produced approximately 60–80% HMGCR protein knockdown in human Hep3B cells [Fig. 1]. Hibbitt therefore establishes that HMGCR was amenable to RNA interference, but it does not establish that substantially any 15-nucleotide or longer portion of a full HMGCR transcript, including sequences having as many as three differences, predictably produces an HMGCR inhibitor. Rather, Hibbitt’s use of a specifically predesigned and validated reagent is consistent with the application’s own disclosure that sequence-specific efficacy must be determined experimentally. Fitz (US 2018/0273955 A1) likewise does not supply the missing general structure-function correlation. Fitz teaches sophisticated RNAi agents directed to SCAP, including short modified duplexes, GalNAc conjugation, and an analogous ≥15-nucleotide/≤3-difference sequence formulation [0109-0110, 0105, 0189]. However, Fitz expressly reports that particular modification motifs produced a “superior” result and that it was “surprisingly discovered” that completely modified sense and antisense strands having particular modification motifs exhibited enhanced gene-silencing activity [0189]. Fitz therefore corroborates that RNAi activity depends upon specific sequence/chemical architecture, rather than establishing that every member falling within a broad transcript-relative sequence definition will possess the required silencing function.
Although applicant has disclosed and experimentally tested numerous particular HMGCR RNAi agents, those examples represent selected target sites and selected chemical architectures. They do not represent the full diversity of: substantially all possible target regions across SEQ ID NOs:1–8; the corresponding antisense regions of SEQ ID NOs:9–16; variants containing one, two, or three nucleotide differences from those regions; and the resulting functional HMGCR-inhibiting dsRNAs encompassed by claim 1.Nor has applicant identified a structural characteristic, beyond the broad sequence-relationship formula itself, that permits a skilled artisan to recognize which members throughout this scope possess the required HMGCR-inhibiting function. The application’s own screening data demonstrate that the broad sequence relationship is not such an identifying characteristic. The specification therefore provides neither a representative number of species commensurate with the structural and functional diversity of the claimed genus, nor a sufficiently established structure-function correlation by which the skilled artisan could recognize members throughout the genus as belonging to the claimed class. Accordingly, the disclosure does not reasonably convey possession of the entire functional genus encompassed by claim 1.
Claims 10, 15, 20, 25, 28–34 depend directly or indirectly from claim 1 and further limit nucleotide chemistry, duplex length, strand length, overhangs, ligand position, GalNAc structure, linker structure, or internucleotide linkage. None of these additional limitations limits the dsRNA to the specifically disclosed HMGCR target sequences or otherwise removes the broad sequence genus. Accordingly, claims 10, 15, 20, 25, 28–34, 44, 45, 51, 60, 62, 66, and 74 are rejected for the same reasons as they do not cure the deficiency in convey possession of the entire functional genus encompassed by claim 1.
Claims 1, 10, 15, 20, 25, 28-34, 44, 45, 51, 60, 62, 66, and 74 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for HMGCR-targeting dsRNA agents and for a reasonable predictable genus of closely related HMGCR-targeting dsRNA agents centered on the specifically designed sequences disclosed in Tables 2-5 demonstrated to reduce HMCGR expression , does not reasonably provide enablement for the broader genus of dsRNA agents that comprise a sense and antisense strand as claimed. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Nature of the Invention
The invention concerns sequence-specific RNA interference, which requires formation and utilization of an active RNAi complex capable of recognizing an HMGCR transcript and producing measurable inhibition. State of the Art
Breadth of the claims
Claim 1(a) is not limited to the particular sequences identified in Tables 2–5 or to the particular species experimentally demonstrated in Tables 6–8. Rather, the claim permits selection from substantially throughout each of eight full-length HMGCR transcripts, together with the corresponding portions of eight reverse-complement sequences, and allows as many as three nucleotide differences in a sequence as short as 15 nucleotides. As discussed above, one 15-nucleotide target window alone encompasses over 13,000 possible sequences containing zero through three substitutions. A full-length HMGCR sequence of more than approximately 4,000 nucleotides contains thousands of possible 15-nucleotide windows. Claim 1 further encompasses longer contiguous regions, multiple species-specific HMGCR sequences, numerous nucleotide-modification patterns, and ligand conjugates. The structural and sequence scope therefore extends enormously beyond the particular molecules actually synthesized and tested.
Guidance of the Specification
The specification describes RNAi as involving incorporation of an siRNA into RISC, unwinding of the duplex, recognition of an appropriate target mRNA by the antisense strand, and cleavage of the target. Accordingly, the claimed function depends on biological interactions that are sensitive to target sequence, strand architecture, sequence position, mismatch location, and nucleotide modification. Applicant itself states that its iRNAs were designed to target particular HMGCR regions and expresses the belief that a combination or sub-combination of particular properties, specific target sites, and specific modifications confers improved efficacy, stability, potency, durability, and safety. Table 6 demonstrates large differences between ostensibly HMGCR-targeting RNAi agents. At 10 nM, residual HMGCR message ranges from 20.9% to 124.2%. Eleven of 42 tested HMGCR agents leave approximately 100% or more HMGCR message remaining, indicating no measured HMGCR inhibition under the reported assay conditions. The unpredictability becomes still more evident at 0.1 nM, where many Table 6 agents produce approximately 100–130% message remaining, while other sequences remain substantially active. Table 7 similarly ranges from 8.2% to 75.7% message remaining. Table 8 ranges from approximately 5.9% to 79.2% message remaining despite testing HMGCR-directed sequences designed for the same general purpose. Most significantly, the specification itself instructs that disclosed or known methods can be used to determine whether a mismatch-containing RNAi agent is effective for HMGCR inhibition. This is affirmative evidence that a skilled artisan cannot determine functionality simply by applying the claimed ≥15-nucleotide/≤3-difference structural rule.
State of the Art
The state of the art taught how to synthesize and test siRNA, which reduces the technical difficulty of performing individual experiments. For example, Hibbitt demonstrates successful inhibition of HMGCR using RNA interference. However, Hibbitt specifically employed predesigned and validated human and mouse HMGCR siRNAs. The validated human reagent produced substantial HMGCR knockdown in Hep3B cells. Hibbitt therefore shows that a skilled artisan could test and use an appropriately selected HMGCR siRNA, but does not provide a teaching by which one could predict that substantially any ≥15-nucleotide HMGCR-related sequence containing up to three differences would work. Fitz similarly shows that sophisticated, completely modified, ligand-conjugated RNAi agents were known. But Fitz also reports unexpectedly superior gene silencing associated with particular modification motifs and describes the effect as a surprising discovery.
Experimentation Required
A skilled artisan attempting to practice claim 1(a) throughout its scope would need to: select candidate target sites across thousands of nucleotides of each HMGCR transcript; choose candidate sense and corresponding antisense strand sequences; consider the large number of sequences having one, two, or three nucleotide differences from each target region; synthesize completely modified sense and antisense strands; prepare ligand-conjugated duplexes; introduce those duplexes into appropriate cells; and experimentally determine which candidates actually inhibit HMGCR expression. Because applicant’s own data show that target-directed candidates vary from highly active to effectively inactive under the tested conditions, testing is not merely confirmatory. It is required to discover which members of the broadly defined genus possess the claimed function. The use of standardized synthesis and assays may render each individual experiment routine, but routine experimentation can still be undue when the disclosure requires a skilled artisan to engage in extensive trial-and-error screening across a vast and unpredictable genus.
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue experimentation would be required to make and use the invention as claimed.
Accordingly, claims 10, 15, 20, 25, 28–34, 44, 45, 51, 60, 62, 66, and 74 are rejected under 35 U.S.C. 112(a) for lack of enablement for the same reasons as claim 1.
The present written-description and enablement rejections are directed to the scope encompassed by alternative (a) of claim 1. The Examiner does not presently determine that alternative (b), which is limited by reference to the specifically disclosed antisense sequences of Tables 2–5, independently fails to satisfy the written-description or enablement requirements.
Claim 60 and 62 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for certain methods of reducing HMGCR expression and for treating certain disorders of lipid metabolism, does not reasonably provide enablement for the full scope of the claimed methods of treating any disorder that would benefit from reduction in HMGCR expression or any HMGCR-associated disorder. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Nature of the Invention
Claim 60 recites a method of treating a subject having “a disorder that would benefit from reduction in 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) expression” by administering a therapeutically effective amount of the dsRNA agent of claim 1, thereby treating the disorder. Claim 62 depends from claim 60 and further requires that the disorder is “an HMGCR-associated disorder.”
Breadth of the claims
The claims encompass any disorder that would benefit from reduction in 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) expression or any HMGCR-associated disorder.
Guidance of the Specification
The specification provides support for the proposition that inhibition of HMGCR may be useful in treating certain disorders of lipid metabolism [pg. 6]. The specification teaches that HMGCR catalyzes the rate-limiting step in cholesterol biosynthesis, that competitive inhibition of HMGCR induces hepatic LDL-receptor expression, and that this increases catabolism of plasma LDL and lowers plasma cholesterol [pg. 1]. The specification further identifies disorders of lipid metabolism and discusses the association of elevated cholesterol with atherosclerosis and cardiovascular disease [pg. 1]. The specification also expressly identifies certain contemplated disorders, including hyperlipidemia, mixed hyperlipidemia, hypertriglyceridemia, and hypercholesterolemia [pg. 6]. However, the scope of claims 60 and 62 is substantially broader than these specifically identified lipid-metabolism disorders. Claim 60 is not limited to hyperlipidemia, hypercholesterolemia, hypertriglyceridemia, or another specifically disclosed lipid disorder. Rather, claim 60 encompasses any disorder that would benefit from reduction in HMGCR expression. Likewise, claim 62 merely requires an HMGCR-associated disorder, which the specification does not define as being restricted to the specifically exemplified lipid disorders. The specification itself indicates that the potential therapeutic scope extends beyond conventional lipid disorders. For example, the specification states that efficacy may, in some embodiments, be monitored by detecting or monitoring a reduction in tumor formation [pg. 109]. The specification additionally describes combination treatment with diverse classes of therapeutic agents, including cardiovascular-disease treating agents, anti-hyperlipemic agents, anti-obesity agents, NASH-treating agents, chemotherapeutic agents, immunotherapeutic agents, immunosuppressive agents, and anti-inflammatory agents [pg. 113]. Thus, the language of claims 60 and 62 is capable of encompassing therapeutically and mechanistically distinct disease states beyond the lipid disorders for which the specification provides its clearest rationale.
The working examples do not demonstrate treatment of this broad genus of disorders. Example 1 is directed to synthesis of HMGCR-targeting iRNAs. Examples 2 and 3 are directed to in vitro screening of HMGCR-targeting duplexes.
State of the Art
The conclusion regarding the unpredictability of practicing the full claimed therapeutic scope is further supported by the state of the art. Liu (Liu et al. Molecular Diagnosis & Therapy 22.5 (2018): 551-569) teaches that explains that although siRNAs are capable of sequence-specific inhibition of target genes, development of siRNAs as therapeutic agents continued to present challenges including off-target effects, delivery, immune responses, and toxicity, and that delivery of an siRNA does not itself guarantee effective gene silencing in vivo [abstract]. Thus, Liu demonstrates that the ability of a candidate RNAi agent to silence a target sequence does not, standing alone, establish predictable therapeutic efficacy in a subject. Setten(Setten et al., Nature Reviews Drug Discovery 18:421–446 (2019)), likewise reviews the development of RNAi drugs and identifies safety and potency as significant considerations in therapeutic development, notwithstanding the successful clinical development of particular RNAi agents [abstract, entire paper]. Setten therefore further evidences that therapeutic activity was dependent upon successful optimization and validation of particular RNAi agents rather than being predictable merely from target complementarity or in-vitro gene silencing. This general evidence is particularly relevant when considered together with Hibbitt. Hibbitt did not infer treatment of familial hypercholesterolemia merely from the ability to reduce HMGCR expression. Rather, Hibbitt experimentally confirmed HMGCR knockdown, evaluated the resulting changes in LDL biology, and thereafter performed in-vivo studies in which HMGCR knockdown was evaluated in the context of LDLR gene-replacement therapy [abstract]. Hibbitt’s study therefore provides direct evidence that the therapeutic consequence of HMGCR knockdown was established empirically in a specific disease context. Accordingly, the prior art supports the conclusion that one of ordinary skill could make and test HMGCR-directed RNAi agents, but does not establish a predictable relationship whereby reduction of HMGCR expression would successfully treat substantially every disorder falling within the functional genus “a disorder that would benefit from reduction in HMGCR expression” or “an HMGCR-associated disorder.” Determining therapeutic applicability to additional disease states would require disease-specific investigation of the biological consequence of HMGCR reduction, appropriate tissue exposure, dose, safety, and relevant therapeutic endpoints.
Experimentation Required
Accordingly, the quantity of experimentation necessary to practice the full scope of claims 60 and 62 would be undue because the claims encompass a broad functional genus of diseases while the specification provides enabling guidance primarily for HMGCR inhibition itself and for its relationship to lipid-metabolism disorders. The specification therefore fails to teach one of ordinary skill in the art how to practice the full scope of the claimed therapeutic methods without undue experimentation.
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue experimentation would be required to make and use the invention as claimed.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 44 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 44 is drawn to a “cell.” The specification teaches inhibition of gene expression can be carried out in vivo [pg. 17]. Thus, the term “cell” could reasonably be interpreted as encompassing cells within a human organism, which is non-statutory subject matter. The rejection may be obviated by requiring that the cell be an isolated cell, an in vitro human cell, or a non-human cell.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 10, 15, 20, 25, 28–34, 44, 45, 51, 60, 62, 66, and 74 are rejected under 35 U.S.C. 103 as being unpatentable over Hibbitt (Hibbitt et al. Gene Therapy (2012) 19, 463–467) in view of Fitz (US 2018/0273955 A1) and NM_000859.3 (NCBI Reference Sequence: NM_000859.3. Homo sapiens 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), transcript variant 1, mRNA. 2019)
Regarding claim 1, Hibbitt teaches inhibition of human 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) by RNA interference [abstract]. In particular, Hibbitt teaches using a predesigned and validated siRNA specific for human HMGCR, identified as Ambion siRNA s141, and separately identifies an Hmgcr-specific siRNA for mouse [pg. 467, col. 1, para 1]. Hibbitt teaches that HMGCR-specific siRNA substantially reduced HMGCR expression in human Hep3B hepatocytes and caused a corresponding increase in LDL binding/internalization [abstract; pg. 463, col. 2, para 3; pg. 464, Fig. 1]. Thus, Hibbitt teaches selecting human HMGCR as a target and administering a double-stranded RNA interference agent designed specifically to silence that target.
Regarding claim 44, Hibbitt teaches cells comprising the dsRNA [pg. 464].
Regarding claim 51, Hibbitt teaches a method of contacting human hepatocytes with HMGCR-specific siRNA and demonstrates reduction of HMGCR expression [pg. 464; Fig. 1].
Hibbitt, however, does not disclose the nucleotide sequence of its commercially obtained s141 siRNA. Accordingly, Hibbitt is not relied upon as expressly disclosing the particular nucleotide sequence required by alternative (a) of claim 1.
NM_000859.3 cures this deficiency. NM_000859.3 expressly discloses the nucleotide sequence of the human HMGCR transcript variant 1. NCBI identifies NM_000859.3 as the reviewed human HMGCR mRNA transcript variant 1. The instant specification identifies NM_000859.3 as SEQ ID NO:1, and identifies SEQ ID NO:9 as the reverse complement thereof. Thus, before the effective filing date, the nucleotide sequence from which an HMGCR-specific siRNA could be selected was publicly known. By way of illustration, nucleotides 89–109 of NM_000859.3/SEQ ID NO:1 are: GGATTCTGTAGCTACAATGTT, which, when expressed as RNA, are: GGAUUCUGUAGCUACAAUGUU. This is an exact 21-nucleotide contiguous portion of SEQ ID NO:1 and therefore satisfies the sequence relationship required by alternative (a), which encompasses a sense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from SEQ ID NO:1. The corresponding complementary sequence is likewise obtainable directly from the known HMGCR sequence/reverse complement represented by SEQ ID NO:9.
Neither Hibbitt nor NM_000859.3, however, expressly teaches the remaining claimed architecture in which all nucleotides of both strands comprise a nucleotide modification and at least one strand is conjugated to a ligand.
Fitz teaches double-stranded RNA interference agents comprising a sense strand and an antisense strand forming a double-stranded region, a sense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from an identified target sequence, together with a corresponding antisense strand [0105-0110; 0011-0012; 0021]. Fitz further teaches that every nucleotide in the sense strand and antisense strand of an RNAi agent may be modified, with each nucleotide containing the same or a different modification, including modifications of the ribose sugar, phosphate group, base, or backbone [0015-0018; 0106]. Fitz additionally teaches preparation of the individual modified sense and antisense strands followed by annealing to form the dsRNA agent [0157]. Fitz teaches ligand-conjugated RNAi agents, including embodiments wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at its 3′ terminus [0023] (regarding claim 28).
Regarding claim 10, Fitz teaches nucleotide modifications including the claimed types, including 2′ modifications and modified internucleotide linkages [0017].
Regarding claim 15, Fitz teaches the double stranded RNAi agent comprises a region of complementarity 19 and 23 nucleotides in length; the double stranded RNAi agent comprises a region of complementarity is 19 nucleotides in length [0020].
Regarding claim 20, Fitz teaches each strand of the double stranded RNAi agent is no more than 30 nucleotides in length [0021].
Regarding claim 25, Fitz at least one strand of the double stranded RNAi agent comprises a 3 ' overhang of at least 1 nucleotide [0022].
Regarding claims 29-31, Fitz teaches the ligand of N-acetylgalactosamine (GalNAC) attached through a bivalent or trivalent branched linker [0023-0024; 0040].
Regarding claim 32, Fitz teaches wherein the dsRNA agent is conjugated to the ligand as shown in the claimed schematic and where the X is O [0024-0025].
Regarding claim 34, Fitz teaches RNAi agents containing modified internucleotide linkages, including phosphorothioate and methylphosphonate internucleotide linkages [0043-0045].
Regarding claim 45, Fitz teaches pharmaceutical compositions containing an iRNA, , and a pharmaceutically acceptable carrier [0375].
Regarding claim 74, Fitz teaches kits for performing the methods of the invention [0082].
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare an HMGCR-specific dsRNA taught by Hibbitt by selecting a suitable contiguous HMGCR target sequence from the publicly available NM_000859.3 sequence and to employ the fully modified and ligand-conjugated RNAi architecture taught by Fitz. A person of ordinary skill would have been motivated to do so because Hibbitt experimentally established HMGCR as a functional siRNA target, while NM_000859.3 provided the actual nucleotide sequence of the human HMGCR transcript from which target-complementary siRNA sequences could routinely be selected. Fitz, in turn, teaches an established architecture for implementing target-specific RNA interference agents using modified sense and antisense strands and ligand conjugation. Hibbitt targets HMGCR, the rate-limiting enzyme in cholesterol biosynthesis, whereas Fitz targets SCAP, a regulator of SREBP-mediated lipid metabolism. Fitz therefore concerns therapeutic RNAi within the same general hepatic lipid/cholesterol regulatory field as Hibbitt, rather than an unrelated target. A person of ordinary skill would have had a reasonable expectation of success because Hibbitt demonstrates successful HMGCR silencing using siRNA, while Fitz teaches that chemically modified, ligand-conjugated dsRNA agents retain RNAi activity. The proposed combination therefore would have involved applying Fitz’s known RNAi chemistry and delivery architecture to an already validated RNAi target, using the publicly known sequence of that target.
Regrading claim 60 and 62, Hibbitt or Fitz do not teach treating a subject having a HMGCR-associated disorder with the dsRNA agent. Hibbitt does establishes the biological consequence of HMGCR inhibition on LDL-receptor regulation and cholesterol biology [pg. 464; col.1, para 1-2; pg. 466, col. 2, para 3-4]. Hibbitt identifies HMGCR as the rate-limiting enzyme in cholesterol synthesis and explains that inhibition of HMGCR induces hepatic LDL receptor expression, increases plasma LDL catabolism, and lowers plasma cholesterol [pg. 464; col.1, para 1-2; pg. 466, col. 2, para 3-4]. 50. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to administer the HMGCR RNAi agent as taught and suggested by Hibbitt and Fitz to treat a HMGCR-associated disorder that benefits from reduced HMGCR expression. This therapeutic application would have been obvious due to the HMGCR-silencing activity demonstrated by Hibbitt for the purpose of lowering LDL cholesterol levels..
Regarding claim 66, Hibbitt expressly investigates human HMGCR, including HMGCR-specific siRNA in human Hep3B hepatocytes, while NM_000859.3 is expressly the Homo sapiens HMGCR transcript [pg. 464; 467; col 1, para 1]. Fitz likewise contemplates administration of its RNAi agents to human subjects [0488]. Thus, selecting a human subject for treatment with the HMGCR-directed RNAi agent would have been obvious.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIFFANY NICOLE GROOMS/Examiner, Art Unit 1637