DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 06/12/2026 has been entered.
Claim Status
Claims 1-29 are pending and are examined here, along with the species of artificial cerebral spinal fluid.
Priority
The claim to benefit of U.S. Provisional 63/485807, filed on 02/17/2023, is recognized.
Claim Rejections - 35 USC § 103
The rejection of claims 1-29 is maintained.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-29 are rejected under 35 U.S.C. 103 as being unpatentable over Zhao et al. (WO2022026589, pub. 02/03/2022), Anderson et al. (pub. 8/20/2021, Nucleic Acids Research, 49, pg. 9026-9041) and Monia et al. (1996, JBC, 14, 14533-14540, referred as Monia).
Claims 1, 4 and 5 recite either a modified oligonucleotide with a specific structural formula as disclosed in claims 1 and 4, or an oligomeric compound with chemical notation of SEQ ID NO: 19 with the oligomeric compound also optionally comprising a conjugate group or a terminal group.
PNG
media_image1.png
312
604
media_image1.png
Greyscale
Zhao discloses SEQ ID NO: 1064: CTCCAATTTTAACTTGCACC (Compound #: 1398227) and its modified form (see below, pg. 31):
PNG
media_image2.png
240
564
media_image2.png
Greyscale
Zhao discloses that SEQ ID NO: 1064 is Compound No. 1398227, which demonstrated the highest level of in vitro target inhibition (at 91%) compared to many other ASOs tested (pg. 75, see Table A); and Example 31 provides it is a well-tolerated drug in rats (pg. 220), while less so in mice (pg. 201, Table 101); Table 98 discloses dose-dependent inhibition of APP expression in various regions of a brain (s.c., cortex, and hippocampus) of a transgenic mice model expressing mutant human amyloid beta precursor protein (Table 98, pg. 200); thus SEQ ID NO: 1064 is an inhibitor that reduces expression of APP mRNA in transgenic mice and is well tolerated.
Similar to instant SEQ ID NO: 19, SEQ ID NO: 1064 is a 5-10-5 gapmer with 2’-MOE wings flanking 10 central deoxyribosyl nucleotides, all cytosines are 5-methylated, and the internucleotide linkages (INL) are either modified with phosphorothioate (PS-INL) or are phosphodiester (PD-INL). Although not disclosed in SEQ ID NO: 1064, Zhao also discloses at least 3 mesyl phosphoramidate INL (MP-INL) (pg. 12); and discloses that MP-INL can be placed at various locations along the oligonucleotide (pg. 14, 46), , similarly to PS-INL and PD-INL.
Zhao discloses an oligomeric compound or composition of oligomeric compounds which comprises a modified oligonucleotide encompassing pharmaceutically acceptable salts of the oligomeric compound (pg. 55, line 30) and discloses acceptable salts as sodium or potassium salt (pg. 55, line 35) (relevant to instant cl. 2, 3); discloses pharmaceutical composition comprises a pharmaceutically acceptable diluent (pg. 55, line 7-8) (relevant to instant claims 7, 11, 15, 19, 22, 24, 26, 28); discloses pharmaceutical composition comprising oligomeric compound and artificial cerebrospinal fluid (pg. 55, line 15) and discloses pharmaceutical composition comprising a modified oligonucleotide and aCSF (pg. 55, line 16); (relevant to instant claims 8, 9, 12, 13, 16, 17, 20, 21, 23, 25, 27, 29); discloses that oligomeric compounds of embodiment 115, comprising a modified SEQ ID NO: 1064 (pg. 31), discloses wherein all of the PS-INL of the modified oligonucleotide are stereorandom (pg. 32, line 38) (relevant to instant claims 6, 10, 14, 18).
However, Zhao does not disclose MP-INL at INL positions 6, 11, and 12 (out of 19 positions), nor phosphodiester INL at positions 4 and 16, while the others are phosphorothioate INL.
Although Zhao does not teach the exact MP-INL locations of instant SEQ ID NO: 19, it would have been obvious for one of ordinary skill in the art to have tried workable modification patterns based on prior art to achieve improved results.
Anderson discloses that an oligonucleotide with solely PS-INLs are known for their cytotoxic effects, such as pro-inflammatory effects and species specific complement activation (pg. 9028). Thus Anderson discloses that gapmer oligonucleotides with both MP-INLs and PS-INLs have improved therapeutic index, potency, duration of effect, and reduced pro-inflammatory effects (Abstract). Anderson demonstrated that replacing up to 5 PS-INLs in the gap with MP-INLs was well tolerated at various INL positions along the gapmer; demonstrated reduction in both immune stimulation and cytotoxicity (Abstract, Fig. 1, pg. 9026-9027; see “’[w]e walked one or two MsPA [MP-INL] in a row across the entire ASO”, pg. 9031). MP-INLs allow for reduction in PS-INL content, thus reducing non-specific binding (pg. 9036), but still maintain beneficial properties, such as allowing RNaseH1 degradation of the hybrid DNA/RNA duplex and providing stability (pg. 9028, Fig. 3 pg. 9033); also discloses that replacing MP-INLs in the gap resulted in a stronger effect of reducing non-specific protein binding than MP-INLs in the wings (pg. 9036). Anderson discloses modifying all the internucleotide position of a gapmer, including 6, 11, and 12, with MP-INL.
Thus, Anderson provides a finite number of types of INL, i.e. of MP-INL, that can be substituted instead of PS-INL.
Similarly by introducing PD-INL, the PS-INL content would be reduced and would provide an improved toxicity profile for a gapmer. Monia et al. taught that testing PD-INLs and PS-INLs along an ASO showed that replacing up to 2 PS-INLs still provided the same protection against nuclease degradation (Fig. 2) and similar reduction profile of the target transcript (Fig. 4) as a fully modified PS-linkage (pg. 14535, 14536). Although, there is a difference between instant PD-INL placement and the numbers of PS-INL and PD-INL in prior art, Monia teaches the ability to modify the placement and the numbers of PS-INL and PD-INL in an oligonucleotide.
Here, the instant gapmer has up to 7 PS-INLs and 3 MP-INLs, which are in the gap region. Based on the disclosures of Anderson and Monia, one skill of the art would have obviously tried to introduce PS-INL, PD-INL, and MP-INL at various positions in order to optimize gapmer performance/therapeutic index by taking into consideration melting temperature, cytotoxicity, degradation and dosage amount. Thus it would not be inventive to identify the optimal locations of various INLs or a desired gapmer profile (i.e. therapeutic index) based on the content of PS-INL, PM-INL and PD-INLs, as it would be obvious to try the various positions along the oligonucleotide.
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the SEQ ID NO: 1064 of Zhao in view of Anderson and Monia and arrive at the claimed invention with a reasonable expectation of success. Because Anderson discloses that too many PS-INLs are cytotoxic and elicits an inflammatory response, and demonstrates the use of MP-INLs provides an optimal performance/therapeutic index with reduced cytotoxic effects, a skilled artisan would have been motivated to modify SEQ ID NO: 1064 of Zhao to introduce MP-INL and PS-INL at desired locations based on the profile desired for the gapmer that encompasses its stability, cytotoxicity, ability to degrade target mRNA, dosage and therapeutic index as taught by Anderson, while also introducing two PD-INLs to reduce the PS-INL content without losing the benefits of a modified oligonucleotide as taught by Monia. The modifications of introducing MP-INL, PD-INL to reduce the overall PS-INL would successfully result in an optimal therapeutic oligonucleotide that has reduced cytotoxicity. Thus, claims 1-29 are obvious.
Response to Arguments
Applicant's arguments filed 06/12/2026 (“the Remarks”) have been fully considered but they are not persuasive.
Repeating some of the arguments made in prior actions, the Remarks insist the following:
(1) Prior art (Zhao, Anderson and Monia) does not provide a reason for a person of ordinary skill to arrive at the compound with the claimed motif of internucleoside linkages, i.e. guidance is not provided regarding the number of MP-INLs and PD-INLs to be incorporated nor the positioning of the PD-INLs, PS-INLs, and MP-INLs within the oligomer (pg. 2-3).
(2) Then the Remarks proceed to argue that the prior art references “do not teach the improved activity and duration of action associated with the claimed compound” (pg. 3).
a) Anderson Fig. 8 teaches only one ASO compound and is “substantially shorter in length [16nt.], targets a nucleic acid encoding a completely different protein, and comprises a different internucleotide linkage motif [11 PS linkages and 4 MP-INLs] and different sugar modifications (cEt) compared to claimed compound” and no PD-INLs, thus cannot extrapolate its results to instant results (pg. 3).
(3) Regarding Zhao’s disclosure of additional 24 different INL motifs, “the reference does not provide even a starting point” and Monia and Anderson are distinct in size with different INL motifs and the oligomer targets a different nucleic acid, thus cannot be extrapolated to instant improved activity disclosed of claimed product (pg. 4). To counter the action’s points of Tables 111-113 and 118, the Remarks collate data of those tables into Tables A-C in Remarks to “better compare the data for compounds having the same sequence and sugar motif but different internucleoside linkage motifs” (pg. 4-7) to indicate that “Zhao does not provide the skilled artisan with any expectation of success that an APP-targeting compound including PD-INLs, PS-INLs, and MP-INLs will have improved activity compared to a compound including only PD-INLs and PS-INLs, and certainly does not provide any expectation that a longer duration of inhibitory effects can be achieved by incorporating MP-INLs” (pg. 7).
(4) The Remarks counter that Anderson’s rationale of “too many PS-INLs are cytotoxic” would not lead a skilled artisan to the specific claimed motif since instant compound 1620705 has the same number of PS-INLs as Zhao’s 1398227 (pg. 8). Also, Anderson nor Monia disclose replacing PD-INLs with PS-INLs in order to maintain the same number of PS-INLs in a given oligonucleotide sequence when incorporating MP-INLs and PD-INLs: see comparison of instant 1620705 v. Zhao’s 1398227 below (see pg. 8-9).
PNG
media_image3.png
126
695
media_image3.png
Greyscale
(5) The Remarks then provides Table D, which collates data from instant specification Tables 1, 2, 4, 5, 6 and 10, to suggest unexpected results of instant compound since it has improved function in the cortex compared to Zhao’s 1398227 or 1353884 (1353884 is of a different sequence, Table 95 of Zhao) (pg. 9-10) and compares claimed product (1620705) with other products that have the same sequence but have different INL motif (1683009, 1683010, 1683011, 1620693, 1620701, and 1620705) (pg. 9-11).
The argument although a very detailed and thorough analysis but, respectfully, is not persuasive.
The obviousness rationale used is “obvious to try.”
Addressing argument (1) and (3), based on the prior art references it would be obvious to try modifying the positioning of the known INLs (PS-INL, PD-INL, and MP-INL) noted in the prior art references for a known gapmer, i.e. the starting point. The Remarks ultimately argue for improved activity of claimed product based on comparison with Zhao’s product and products with same sequence but with different INL motifs from instant specification. As noted in prior action, “the importance of Zhao, Anderson and Monia is that they provide guidance regarding how to handle the problem of too many PS-INLs and provide discrete solutions and thus would provide ‘an obvious to try’ rationale” (pg. 10, action of 5/19/2025). “E.g. Anderson, in figure 1 illustrates that when compared to a fully PS-INL oligonucleotide (IC50 of 84), just replacing two PS-INL with MP-INL anywhere in the gap region improves IC50 (ranging from 28-61)” (pg. 11, action of 5/19/2025). The Remarks fail to provide how exactly from a known gapmer of Zhao that is highly efficient would result in a gapmer that is ineffective with incorporation of MP-INL and PD-INL that follow the guidance provided by Zhao, Anderson and Monia.
Regarding argument (2), Anderson discloses the improved duration by substituting MP-INLs for PS-INLs, as noted in prior action, pg. 5 of Advisory Action of 12/09/2025.
The issue with comparison of instant claimed product with Zhao’s product is that Zhao’s product lacks the improvements suggested by the teachings of Anderson and Monia, both elaborate on PD-INLs and MP-INLs. First, to be clear in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Second, Anderson is a relevant reference since Zhao does not teach the full scope of capabilities of the MP-INLs, although Anderson used a different 2’ ribose modification and length (i.e. a cEt and 16 nt. gapmer; it should be pointed out the 2’-ribose modification have similar functions of providing stability by preventing nuclease degradation and improving binding affinity, and prior art of Zhao discloses 2’-ribose modification of claimed product). Anderson suggests that MP-INLs are utilized not only for maintaining RNase H-based degradation of a gapmer (central 10 DNA bound to RNA target) but also for lacking the negative charge of sulfur group and reducing immune stimulation and cytotoxicity. Anderson discloses that “[t]he improved nuclease stability of MsPA [MP-INLs] over PS translated to significant improvement in the duration of ASO action in mice” and requires balancing its cytotoxic (measured by caspase activity) and inhibitory activity (IC50). Thus merely focusing on degradation (i.e. having the best inhibition level) is insufficient without considering the complete therapeutic index, which includes not only RNase-H compatibility and other advantageous features of a MP-INL. E.g., Fig. 1C illustrates that, first, none of the oligomers with MP-INL in Fig. 1C have a lower IC50 than the oligomer with only PS-INL, but then reviewing the caspase activity it is noted that the PS-INL has a relatively high caspase activity (2290), but with introduction of MP-INLs, it reduces the relative caspase activity albeit at the cost of inhibition activity. Product 1378794, which has MP-INLs in the wings of the gapmer, in Fig. 1C has the closest IC50 to PS-INL only gapmer, but also has the highest caspase activity (2500). Thus, based on the results of Fig. 1 a skilled artisan would try to optimize the positioning of MP-INLs and this is exactly what Anderson demonstrates by modifying the position of MP-INL along the oligomer. Thus, a skilled artisan is balancing between reducing cytotoxic effect and its inhibitory effect associated with Zhao’s product by modifying the MP-INLs.
Regarding arriving at the claimed product, as noted in action (see Action of 5/19/2025, pg. 6), Anderson discloses replacing MP-INLs in the gap resulted in a stronger effect of reducing non-specific protein binding than MP-INLs in the wing. Here, the claimed product comprises the MP-INLs in the gap region, see the boxed INL gap area (‘705-claimed product, ‘227-Zhao’s product).
PNG
media_image3.png
126
695
media_image3.png
Greyscale
Regarding arguments (4) and (5) focusing on unexpected results (Remarks data of Tables A-D), the argument conflates the term variability and unexpected. The Remarks highlight and focus on different data points on a curve to argue that results of one data point of claimed product varies from the other data points of products with the same sequence but different INL motifs to argue for “unexpected results”. But, the Remarks mainly highlight the variability of gapmers with three kinds of INLs, the PS-INL, PD-INL and MP-INL. Here, the variability (differences) of discussed results are not unexpected. Both the results of Zhao and Anderson highlight the broad variability in the results (the Remarks highlight the data well). The variability is highlighted by Anderson, see, e.g., Fig. 1C, D, specifically the IC50: For Fig. 1C, the IC50 ranges from 83 to 1158 nM (some 12 fold difference); Fig. 4A illustrates a range of IC50 from 81-1693 nM depending on number of and positioning of MP-INLs. Thus, reviewing Tables A-D of the Remarks, the number and positioning of MP-INLs varies. E.g. Table B has some oligomers with 2 MP-INLs and some have 6 MP-INLs, and some oligomers with MP-INLs within the gap region, others solely in wing region, and some with MP-INLs in both gap and wing region. The variability disclosed by Anderson of Fig. 4A and other figures help in understanding the “unpredictability” of the claimed product when compared to products of same sequences but with different INL motifs. Thus, when replacing the INLs of Zhao’s product with MP-INL it still depends on the positioning and the number of INLs that are modified with MP-INLs, thus it would be “obvious to try” modifying the positioning and number of INLs to identify the optimal oligomer that balances both the cytotoxic effects and inhibitory effects.
The Remarks argue that instant compound (1620705) and Zhao’s product (1398227) have the same number of 14 PS-INLs, then argues that Anderson and Monia do not disclose replacing PD-INLs with PS-INLs in order to maintain the same number of PS-INLs (pg. 8). However, Monia Fig. 2 test various chimeric oligomers comprising solely of PS-INL and PD-INL and demonstrate that oligomers with two or more contiguous PD-INLs have decreased % of oligomers intact. See Zhao’s product above (‘227), which has three contiguous PD-INL within the 5’ wing, thus Monia teaches that switching to PS-INL (or arguably even MP-INL) would stabilize the oligomer.
Thus, respectfully, the arguments are not persuasive and the rejection is maintained.
Conclusion
All claims are identical to or patentably indistinct from, or have unity of invention with claims in the application prior to the entry of the submission under 37 CFR 1.114 (that is, restriction (including a lack of unity of invention) would not be proper) and all claims could have been finally rejected on the grounds and art of record in the next Office action if they had been entered in the application prior to entry under 37 CFR 1.114. Accordingly, THIS ACTION IS MADE FINAL even though it is a first action after the filing of a request for continued examination and the submission under 37 CFR 1.114. See MPEP § 706.07(b). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 16357
/Soren Harward/Primary Examiner, TC 1600