DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-29 are pending and are examined here, along with the species of artificial cerebral spinal fluid.
Priority
The claim to benefit of U.S. Provisional 63/485807, filed on 02/17/2023, is recognized.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 02/28/2025, 03/14/2025 along with a fee were filed after the mailing date of the first Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 103
The rejection of claims 1-29 is maintained.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-29 are rejected under 35 U.S.C. 103 as being unpatentable over Zhao et al. (WO2022026589, pub. 02/03/2022), Anderson et al. (pub. 8/20/2021, Nucleic Acids Research, 49, pg. 9026-9041) and Monia et al. (1996, JBC, 14, 14533-14540, referred as Monia).
Claims 1, 4 and 5 recite either a modified oligonucleotide with a specific structural formula as disclosed in claims 1 and 4, or an oligomeric compound with chemical notation of SEQ ID NO: 19 with the oligomeric compound also optionally comprising a conjugate group or a terminal group.
PNG
media_image1.png
312
604
media_image1.png
Greyscale
Claims 2 and 3 recite oligonucleotide of claim 1, is a pharmaceutically acceptable salt comprising one or more recited cations, with sodium or potassium salt. Claims 6, 10, 14, 18 recite a population of modified oligonucleotides, wherein each of the phosphorothioate internucleotide linkages of the modified oligonucleotide are stereorandom; claims 7, 11, 15, 19, 22, 24, 26, 28 recite a pharmaceutical composition comprising a modified oligonucleotide or an oligomeric compound and a pharmaceutically acceptable diluent; claims 8, 9, 12, 13, 16, 17, 20, 21, 23, 25, 27, and 29 recite pharmaceutical diluent is the elected artificial cerebrospinal fluid (aCSF).
Zhao discloses SEQ ID NO: 1064: CTCCAATTTTAACTTGCACC (Compound #: 1398227) and its modified form (see below, pg. 31):
PNG
media_image2.png
240
564
media_image2.png
Greyscale
Zhao discloses that SEQ ID NO: 1064 is Compound No. 1398227, which demonstrated the highest level of in vitro target inhibition (at 91%) compared to many other ASOs tested (pg. 75, see Table A); and Example 31 provides it is a well-tolerated drug in rats (pg. 220), while less so in mice (pg. 201, Table 101); Table 98 discloses dose-dependent inhibition of APP expression in various regions of a brain (s.c., cortex, and hippocampus) of a transgenic mice model expressing mutant human amyloid beta precursor protein (Table 98, pg. 200); thus SEQ ID NO: 1064 is an inhibitor that reduces expression of APP mRNA in transgenic mice and is well tolerated.
Similar to instant SEQ ID NO: 19, SEQ ID NO: 1064 is a 5-10-5 gapmer with 2’-MOE wings flanking 10 central deoxyribosyl nucleotides, all cytosines are 5-methylated, and the internucleotide linkages (INL) are either modified with phosphorothioate (PS-INL) or are phosphodiester (PD-INL). Although not disclosed in SEQ ID NO: 1064, Zhao also discloses at least 3 mesyl phosphoramidate INL (MP-INL) (pg. 12); and discloses that MP-INL can be placed at various locations along the oligonucleotide (pg. 14, 46), , similarly to PS-INL and PD-INL.
Zhao discloses an oligomeric compound or composition of oligomeric compounds which comprises a modified oligonucleotide encompassing pharmaceutically acceptable salts of the oligomeric compound (pg. 55, line 30) and discloses acceptable salts as sodium or potassium salt (pg. 55, line 35) (relevant to instant cl. 2, 3); discloses pharmaceutical composition comprises a pharmaceutically acceptable diluent (pg. 55, line 7-8) (relevant to instant claims 7, 11, 15, 19, 22, 24, 26, 28); discloses pharmaceutical composition comprising oligomeric compound and artificial cerebrospinal fluid (pg. 55, line 15) and discloses pharmaceutical composition comprising a modified oligonucleotide and aCSF (pg. 55, line 16); (relevant to instant claims 8, 9, 12, 13, 16, 17, 20, 21, 23, 25, 27, 29); discloses that oligomeric compounds of embodiment 115, comprising a modified SEQ ID NO: 1064 (pg. 31), discloses wherein all of the PS-INL of the modified oligonucleotide are stereorandom (pg. 32, line 38) (relevant to instant claims 6, 10, 14, 18).
However, Zhao does not disclose MP-INL at INL positions 6, 11, and 12 (out of 19 positions), nor phosphodiester INL at positions 4 and 16, while the others are phosphorothioate INL.
Although Zhao does not teach the exact MP-INL locations of instant SEQ ID NO: 19, it would have been obvious for one of ordinary skill in the art to have tried workable modification patterns based on prior art to achieve improved results.
Anderson discloses that an oligonucleotide with solely PS-INLs are known for their cytotoxic effects, such as pro-inflammatory effects and species specific complement activation (pg. 9028). Thus Anderson discloses that gapmer oligonucleotides with both MP-INLs and PS-INLs have improved therapeutic index, potency, duration of effect, and reduced pro-inflammatory effects (Abstract). Anderson demonstrated that replacing up to 5 PS-INLs in the gap with MP-INLs was well tolerated at various INL positions along the gapmer; demonstrated reduction in both immune stimulation and cytotoxicity (Abstract, Fig. 1, pg. 9026-9027; see “’[w]e walked one or two MsPA [MP-INL] in a row across the entire ASO”, pg. 9031). MP-INLs allow for reduction in PS-INL content, thus reducing non-specific binding (pg. 9036), but still maintain beneficial properties, such as allowing RNaseH1 degradation of the hybrid DNA/RNA duplex and providing stability (pg. 9028, Fig. 3 pg. 9033); also discloses that replacing MP-INLs in the gap resulted in a stronger effect of reducing non-specific protein binding than MP-INLs in the wings (pg. 9036). Anderson discloses modifying all the internucleotide position of a gapmer, including 6, 11, and 12, with MP-INL.
Thus, Anderson provides a finite number of types of INL, i.e. of MP-INL, that can be substituted instead of PS-INL.
Similarly by introducing PD-INL, the PS-INL content would be reduced and would provide an improved toxicity profile for a gapmer. Monia et al. taught that testing PD-INLs and PS-INLs along an ASO showed that replacing up to 2 PS-INLs still provided the same protection against nuclease degradation (Fig. 2) and similar reduction profile of the target transcript (Fig. 4) as a fully modified PS-linkage (pg. 14535, 14536). Although, there is a difference between instant PD-INL placement and the numbers of PS-INL and PD-INL in prior art, Monia teaches the ability to modify the placement and the numbers of PS-INL and PD-INL in an oligonucleotide.
Here, the instant gapmer has up to 7 PS-INLs and 3 MP-INLs, which are in the gap region. Based on the disclosures of Anderson and Monia, one skill of the art would have obviously tried to introduce PS-INL, PD-INL, and MP-INL at various positions in order to optimize gapmer performance/therapeutic index by taking into consideration melting temperature, cytotoxicity, degradation and dosage amount. Thus it would not be inventive to identify the optimal locations of various INLs or a desired gapmer profile (i.e. therapeutic index) based on the content of PS-INL, PM-INL and PD-INLs, as it would be obvious to try the various positions along the oligonucleotide.
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the SEQ ID NO: 1064 of Zhao in view of Anderson and Monia and arrive at the claimed invention with a reasonable expectation of success. Because Anderson discloses that too many PS-INLs are cytotoxic and elicits an inflammatory response, and demonstrates the use of MP-INLs provides an optimal performance/therapeutic index with reduced cytotoxic effects, a skilled artisan would have been motivated to modify SEQ ID NO: 1064 of Zhao to introduce MP-INL and PS-INL at desired locations based on the profile desired for the gapmer that encompasses its stability, cytotoxicity, ability to degrade target mRNA, dosage and therapeutic index as taught by Anderson, while also introducing two PD-INLs to reduce the PS-INL content without losing the benefits of a modified oligonucleotide as taught by Monia. The modifications of introducing MP-INL, PD-INL to reduce the overall PS-INL would successfully result in an optimal therapeutic oligonucleotide that has reduced cytotoxicity. Thus, claims 1-29 are obvious.
Response to Arguments
Applicant's arguments filed 02/28/2025 (“the Remarks”) have been fully considered but they are not persuasive.
Remarks argue that cited documents do not provide a reason for a skilled artisan to arrive at the compound recited in the present claims, specifically “the specific internucleoside linkage arrangement of the claimed compound from among the myriad of possibilities envisioned by Zhao,” since Zhao indicates at least 10 different types of possible INLs (pg. 5). Even considering just the MP-INL, PS-INL and PD-INL, which the Remarks argue is an impermissible hindsight reconstruction (pg. 6), the possibilities are innumerable (1.1X109, i.e. 319) (pg. 5). The Remarks indicate that Zhao discloses some 24 different INL motifs that include MP-INL, PD-INL, PS-INL and a skilled artisan would not have ignored these embodiments (Zhao in embodiment 38) (pg. 6).
Further, the Remarks argue that it is highly unpredictable that the presently claimed modified oligonucleotide, having the specific nucleobase sequence, the specific sugar motif, and the specific INL linkage motif, would have superior properties disclosed in the present application (pg. 7). It attempts to argue the unpredictability based on the results of instant specification (see Table 1 of 4 compounds, each with specific INL motif containing PS-INL, PD-INL, and MP-INLs, pg. 7 with results indicated in Tables 2, 4 (pg. 8)).
Further the patentability of the present claims is also supported by objective evidence of non-obviousness, i.e. the secondary considerations of unexpected results: the “presently claimed compound is 2- to 3-fold more potent than compound 1398227 of Zhao” (pg. 9-10) and “exhibited 2-to almost 4-fold improved potency 12 weeks after treatment compared to compound 1398227 of Zhao” (pg. 11, also see Table 10 with its results charted in Fig. on pg. 13 of improved long term reduction of target mRNA expression in cortex).
The argument is not persuasive.
Regarding Argument 1: first, a skilled does not ignore the embodiment 38, which illustrates some 24 different INL motifs comprising PD-INL, PS-INL, and MP-INL. A skilled artisan would understand that Zhao teaches that an oligonucleotide can comprise of those embodiments, but due to the lack of examples would not be able to determine the outcomes of these motifs, and consequently, would have to search other references to understand their effects on inhibition.
Regarding the large numbers of potential motifs, the 319 is not completely accurate. First, Anderson discloses that MP-INLs in the wings did not reduce potency or cytotoxicity (pg. 9031), thus the number of INL in the wings would not be tested initially. This would reduce the INL number by 9 or 10, thus 39 or 310, since here, there are 10 nt. in the wings and 10 nt. in the gap. Thus a skilled artisan would focus replacing PS-INL with MP-INL in the gap region. Anderson discloses that ASOs where all PS in the gap were replaced with [MP-INL] showed reduced potency (pg. 9031). Thus, a skilled artisan would understand to not replace all the INL in the gap region with MP-INLs and thus based on Anderson’s suggestion that replacing up to 5 PS-INLs in the gap with MP-INLs was well tolerated, as noted in prior action, a skilled artisan would determine the optimal numbers and placement to try.
Similarly, a skilled artisan can also reduce the PS-INLs by introducing PD-INLs based on the study of Monia. Thus, the art of modifying INL and their purpose is known in the art, e.g. see Anderson and Monia. Thus, there’s still a discrete number of INLs indicated in Anderson and Monia. Further Anderson with the step-walk of INL modification along the oligonucleotide, provides guidance regarding potential outcome, in terms of inhibition, see fig. 1 generally and IC50 of Fig. 1E. So although, as the Remarks point out, “there is simply no way to predict a priori, based on Zhao, Anderson, and/or Monia” the INL-motif arrangement (pg. 9), the importance of Zhao, Anderson and Monia is that they provide guidance regarding how to handle the problem of too many PS-INLs and provide discrete solutions and thus would provide “an obvious to try” rationale.
Regarding argument 2, concerning unpredictability is also unpersuasive. First, there is no unpredictability regarding the sequence and the specific sugar motif, since they are the same as Zhao, only distinction is the INL motif arrangement. As indicated above, Zhao’s sequence is functional in vivo. Further, a skilled artisan would expect that there would be variability, what the Remarks is indicating as unpredictability, in the inhibitory profile based on the INL motif. It is expected that some INL motif will be less potent than others. Anderson illustrates the variability in the inhibition effect when dual MP-INLs are substituted, i.e. walked, across the length of an ASO (e.g. fig. 1E the IC50 is higher when double MP-INLs were more towards the 3’ end than at 5’ end). Based on the figures of Anderson, one would expect that some ASOs with different INL motif, comprising of MP-INL, PS-INL and PD-INL, will have variability in their inhibition.
Further, In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Regarding argument 3 of the secondary consideration of unexpected result, although comparison to the Zhao’s compound is the closest prior art, the comparison fails to consider the improvement based upon the cited references. E.g. Anderson, in figure 1 illustrates that when compared to a fully PS-INL oligonucleotide (IC50 of 84), just replacing two PS-INL with MP-INL anywhere in the gap region improves IC50 (ranging from 28-61). Thus, introducing MP-INL improves the inhibition profile. Further, replacing four PS-INL with MP-INLs at the 5’ end gap region resulted in longer duration of inhibitory effect (pg. 9036, Fig. 8). Thus, the improved results are expected.
Thus the argument is not persuasive and the rejection is maintained.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 16357
/Soren Harward/Primary Examiner, TC 1600
Prosecution Insights