DETAILED CORRESPONDENCE
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This action is in response to the papers filed January 20, 2026. Currently, claims 1-18 are pending. Claims 6, 8-9, 11-18 have been withdrawn as drawn to non-elected subject matter.
All arguments have been thoroughly reviewed but are deemed non-persuasive for the reasons which follow. This action is made FINAL.
Any objections and rejections not reiterated below are hereby withdrawn.
The Improper Markush rejection has been withdrawn in view of the amendments to the claims to require miR-16 only.
Election/Restrictions
Applicant's election of Group I, claims 1-10 and SEQ ID NO: 2, miR-16 in the paper filed January 20, 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.03(a)).
The requirement is still deemed proper and is therefore made FINAL.
Priority
This application claims priority to two foreign priority applications Korea 10/222-0126760 and 10-2023-0053685, filed October 5, 2022 and Aril 25, 2023, respectively.
It is noted that a translation of the foreign document has not been received.
Drawings
The drawings are acceptable.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Newly amended Claims 1-5, 7 are rejected under 35 U.S.C. 101 because the claimed invention is not directed to patent eligible subject matter. Based upon an analysis with respect to the claim as a whole, the rejected claim(s) do not recite something significantly different than a judicial exception. The rationale for this determination is explained below:
Briefly, 1-5, 7 are rejected because these claims have been amended to require an agent for measuring an expression level of miR-16 where the reagent comprises a nucleic acid that binds complementarily to miR-16. Claim 7 requires the miRNA nucleic acid molecule consists of 22 nucleotides of SEQ ID NO: 2.
Claims 1-5, 7 are directed to nucleic acid fragments from the human genome, i.e. known naturally occurring nucleic acids. Such isolated nucleic acid molecules, that are identical to fragments of naturally occurring nucleic acid molecules are not patent eligible subject matter, i.e. they are judicial exceptions to patentable subject matter.
MPEP 2106.04(b)(II) discusses products of nature. The MPEP specifically discusses DNA, primers and probes. The isolated DNA of Myriad and the primers of Ambry Genetics were described as products of nature by the courts. Ass’n for Molecular Pathology v. Myriad Genetics, Inc., 133 S. Ct. 2107, 2116-17, 106 USPQ2d 1972, 1979 (2013); University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 758-59, 113 USPQ2d 1241, 1243 (Fed. Cir. 2014). The MPEP further states the “product of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart. See, e.g., Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244 ("Contrary to Myriad's argument, it makes no difference that the identified gene sequences are synthetically replicated. As the Supreme Court made clear, neither naturally occurring compositions of matter, nor synthetically created compositions that are structurally identical to the naturally occurring compositions, are patent eligible.").” The Federal Circuit in Ambry Genetics reviewed “[t]he Supreme Court held ineligible claims directed to segments as short as 15 nucleotides, the same length as the primer claims at issue here, suggesting that even short strands identical to those found in nature are not patent eligible. Compare ’492 patent col. 170 ll. 32–38, with ’282 patent col. 153 ll. 66–67.”
In the instant case, the claims, embrace DNA that encodes miR-16 that are identical to naturally occurring gene fragments and clearly read on nature-based products that themselves do not exhibit markedly different characteristics from the naturally occurring gene. See e.g. Myriad in which one claim at issue was drawn to “[a]n isolated DNA having at least 15 nucleotides [an isolated DNA coding for a BRCA1 polypeptide having the amino acid sequence of SEQ ID NO: 2] (Myriad at 2113). The Court recognized that this claim, if valid, would have given Myriad exclusive right to isolate any strand of 15 or more nucleotides of an individual’s BRCA1 gene (paragraph bridging 2113 and 2114). This is directly analogous to the instant situation wherein Applicant’s claims cover probe and primer molecules that are fragments of a naturally occurring human genome sequence. The Court held that “[a] naturally occurring DNA segment is a product of nature and not patent eligible merely because it has been isolated”, and that “Myriad’s claims are not saved by the fact that isolating DNA from the human genome severs the chemical bonds that bind gene molecules together” (page 2118). The Court found that while Myriad had located and sequenced an important gene, Myriad had not created anything, and that “separating that gene from its surrounding genetic material is not an act of invention” (page 2118). Consistent with the findings of the Court in Myriad, the Office finds that the primers and probe molecules embraced by the instant clams are not patent eligible compositions of matter regardless of whether or not they are isolated from the genome. The Guidelines indicate that a change in biological function or activity maybe a characteristic of an isolated product that can provide a marked difference sufficient to distinguish over a naturally occurring product. However, in this case, as in the Ambry case, the function of the nucleic acids is the same function as the relevant portion of the naturally occurring sequence. Just as in nature, primers and probes utilize the innate ability of DNA to bind to itself.
Having established that the claims include a naturally occurring product that is a judicial exception, it must now be determined whether or not the claims recite an element or combination of elements that amount to significantly more than that exception, and whether those additional elements also amount to significantly more for the other claimed exception(s), which ensures that the claim does not have a preemptive effect with respect to any of the recited exceptions. To determine whether a claim that includes a nature-based product limitation recites a “product of nature” exception, an analysis is performed in which it is first determined if a claim includes a nature-based product that has markedly different characteristics from the corresponding naturally occurring product, and if it does not, then it is determined whether or not other elements of the claim are sufficient to ensure that the claim as a whole amounts to significantly more than the exception itself (see the Interim Guidance on Patent Subject Matter Eligibility published 12/16/2014 in the Federal Register at pages 74618-74633). In order to be markedly different the claimed product must possess at least one characteristic that is different from that of the counterpart.
In the instant case, only claim 10 recites any additional element, i.e. a kit comprising reaction tubes, contains, vials. None of these limitations provides any significant addition to the judicial exceptions already claimed that would prevent the claims from having a pre-emptive effect on the use of the judicial exception. The presence of a “tube" in a composition comprising a nucleic acid is entirely conventional and does not represent a modification that amounts to something significantly more than the judicial exception.
The fact that these natural products are organized into a kit with an intended use adds nothing to the judicial exceptions that would distinguish them from the naturally occurring material. That does not occur in this case because the naturally occurring material exists as a distinct entity within the kit, and is not integrated in terms of form or function with any other element of the kit. A claim to a kit in which one of the kit elements is naturally-occurring product that is separate and distinct from the other kit elements would forestall the use of that naturally occurring product.
Therefore, the claims are properly rejected under 35 USC 101 as being drawn to patent-ineligible subject matter.
Response to Arguments
The response traverses the rejection. The response asserts the miRNA target is not the same as the claimed agent which is a synthetic nucleic acid designed to bind complementarily to miR-16. The response argues the claimed agent is not miR-16 itself but rather an artificially designed nucleic acid molecule that binds complementary to miR-16. This argument has been considered but is not convincing. The newly amended claims are directed to an agent that comprises nucleic acid that binds complementarily to miR-16. The prior art teaches genomic DNA on chromosome 13q14 is complementary to miR-16.
DEFINITION Homo sapiens chromosome 13q14 BAC clone CITB-369L16, complete
sequence.
ACCESSION AF334404
Query Match 100.0%; Score 22; Length 154868;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAGCAGCACGTAAATATTGGCG 22
||||||||||||||||||||||
Db 99670 TAGCAGCACGTAAATATTGGCG 99649
Thus, sequences that are complementary to miR-16 are naturally occurring sequences.
Furthermore, the response argues that strands naturally pairing with miR-16 are complementary less than half of the sequence. The claims are directed to nucleic acid that binds complementarily to miR-16. This does not require 100% complementary sequence such that even the hairpin sequence with the bulges prior to cutting is encompassed by the instant claims. The claims also encompass the strand that naturally pairs with miR-16.
Finally, the genome is full of sequences that are partially complementary to miR-16.
Thus for the reasons above and those already of record, the rejection is maintained.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
Claim(s) 1-5, 7, 10 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Huang et al. (Japanese J. or Clinical Oncology, Vol. 46, No. 9, pages 811-818, 2016).
Huang teaches microRNA expression profiles in cancer for miR-16. Table 2 illustrates SEQ ID NO: 2 as the primer used for RT-PCR. Huang uses the primer to generate a double stranded PCR product. One of the strands is complementary to miR-16. Thus, Huang teaches a composition comprising an agent comprising a nucleic acid that binds complementarily to miR-16.
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The instant claims provide the intended use for diagnosing breast cancer where the miRNA is derived from an extracellular vesicle.
Response to Arguments
The response traverses the rejection. The response asserts Huang is directed to diagnosing gastric cancer not breast cancer. This argument has been considered but is not convincing. A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. Applicant has provided no evidence that the product taught by Huang would not function for the intended use for diagnosing breast cancer. Thus, for the reasons above and those already of record, the rejection is maintained.
Claim(s) 1-5, 7, 10 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kim et al. (Cancer Science, Vol. 112, pages 5078-5087, 2021).
Kim teaches miRNA panel of tumor-derived extracellular vesicles for diagnostic biomarkers of early-stage breast cancer. Kim teaches miR-16 is an miRNA from the EV that was highly elevated in early-stage breast cancer patients compared to healthy donors. Kim teaches analysis of extracellular vesicle miRNA expression of tissues in TCGA (section 2.4). Differential expression of mRNA in breast cancer was analyzed (section 2.4). Kim teaches reagents for measuring expression levels of miR-16.
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The instant claims provide the intended use for diagnosing breast cancer where the miRNA is derived from an extracellular vesicle.
Response to Arguments
The response traverses the rejection. The response asserts the exception under 35 USC 102(b)(1)(A) applies because Kim was published online on October 2021 which is less than a year prior to October 2022. This argument has been considered but is not convincing. This application claims priority to two foreign priority applications Korea 10/222-0126760 and 10-2023-0053685, filed October 5, 2022 and Aril 25, 2023, respectively. As noted above, a translation of the foreign document has not been received. “The filing date of the priority document is not perfected unless applicant has filed a certified priority document in the application (and an English language translation, if the document is not in English) (see 37 CFR 1.55(g) ).” If an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) and it must be filed together with a statement that the translation of the certified copy is accurate. Here there is no translation and statement, thus, the foreign priority is not perfected and the Kim document is more than a year before the filing date.
Thus, for the reasons above and those already of record, the rejection is maintained.
Claim(s) 1-5, 7, 10 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Myomoto (Kyoto Univ. 3D_Gene Human miRNA oligo chip v11.0, May 14, 2009).
Myomoto teaches a miRNA oligo chip comprising oligonucleotides that detected human, mice and rat miR-sequences. The chip comprises a reagent/probe that binds complementarily to miR-16.
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim.
Conclusion
No claims allowable over the art.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JEANINE ANNE GOLDBERG whose telephone number is (571)272-0743. The examiner can normally be reached Monday-Friday 6am-3:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng (Winston) Shen can be reached on (571) 272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEANINE A GOLDBERG/Primary Examiner, Art Unit 1682 June 12, 2026