Prosecution Insights
Last updated: October 02, 2026
Application No. 18/517,080

COMPOSITIONS AND METHODS OF TREATING USHER SYNDROME III

Final Rejection §103§112
Filed
Nov 22, 2023
Priority
Nov 06, 2014 — provisional 62/076,114 +3 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Case Western Reserve University
OA Round
2 (Final)
38%
Grant Probability
At Risk
3-4
OA Rounds
1y 2m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
285 granted / 750 resolved
-22.0% vs TC avg
Strong +53% interview lift
Without
With
+52.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
50 currently pending
Career history
813
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
38.7%
-1.3% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 750 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment filed on 06/18/2026 has been entered. Amended claims 1, 6-14 and 26-36 are pending in the present application; and they are examined on the merits herein. Response to Amendment 1. The rejection under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for Scope of Enablement was withdrawn upon further consideration, and in favor of the new Lack of Written Description rejection below. 2. All 103 rejections that were based over Chakraborty et al (US 9,061,059) in view of Lancet et al (WO 03/097685) in the Non-final Office action dated 02/18/2026 were withdrawn upon further consideration and in light of currently amended independent claim 26, particularly with the limitation “a full-length 5’UTR nucleic acid sequence of a wild-type clarin-1 gene….a full-length 3’UTR nucleic acid sequence of the wild-type clarin-1 gene”. Moreover, Chakraborty et a simply disclosed the human Clarin-1 DNA of SEQ ID NO: 6169 as one of 71,005 potential DNA that can be modified to include one or more structural and/or chemical modifications, including incorporating “UTR” features, microRNA binding sites among others into the wild-type DNA. Thus, Chakraborty et al do not teach or suggest that both the full-length 5’ UTR nucleic acid sequence and the full-length 3’ UTR nucleic acid sequence of a wild-type clarin-1 gene to flank a wild-type clarin-1 cDNA in a vector for transfecting a cell. Claim Rejections - 35 USC § 112 (Lack of Written Description) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Amended claims 26-33 and 35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116. This is a new ground of rejection necessitated by Applicant’s amendment. The instant claims encompass a vector for transfecting a cell comprising: a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with a full-length 5’UTR nucleic acid sequence of any wild-type clarin-1 gene from any animal species (e.g., mouse, human, cattle, dog, whale, rabbit, fish or frog) and at the 3’ end with a full length 3’UTR nucleic acid sequence of any wild-type clarin-1 gene from any animal species (e.g., mouse, human, cattle, dog, whale, rabbit, fish or frog), including the vector wherein the 5’UTR and the 3’UTR nucleic acid sequences enhance expression of clarin-1 in a cell transfected with the vector compared to a cell transfected with a vector that includes a wild-type clairin-1 cDNA coding sequence devoid of the 5’UTR and 3’UTR nucleic acid sequences (claim 31); and a pharmaceutical composition comprising the same vector. The instant specification disclosed that transfecting cochlear hair cells of the KO-TgAC1 mice at P1-P3 (postnatal day 1-3) through the round window membrane (RWM) using rAAV2-Clrn1-UTR vector or rAAV8-Clrn1-UTR vector, wherein each of the recombinant AAV vectors comprises the wild-type murine Clrn1 cDNA coding sequence (699 bp) flanked by the mouse wild-type Clrn1 full-length 5’-UTR (172 bp) and the mouse wild-type Clrn1 full-length 3’-UTR of SEQ ID NO: 5 (2107 bp) in the polynucleotide sequence of SEQ ID NO: 1 (2978 bp), and being fused downstream of the Atoh1 enhancer and beta-globin basal promoter sequence, that resulted in a robust and sustained preservation of hearing through adult life compared to KO-TgAC1 mice transfected with Clrn1 without the 3’ UTR or untransfected KO-TgAC1 mice (see at least paragraphs [0099], [00108]-[00111]; Figs. 1, 3 and 5A). Additionally, the specification also disclosed the wild-type human Clrn1 cDNA coding sequence (699 bp) flanked by the human wild-type Clrn1 full-length 5’-UTR (281 bp) and the human wild-type Clrn1 full-length 3’-UTR of SEQ ID NO: 6 (1372 bp) in the polynucleotide sequence of SEQ ID NO: 2 (2,352 bp). However, it is noted that there is no homology whatsoever between SEQ ID NO: 6 and the mouse wild-type clarin-1 3’UTR of SEQ ID NO: 5 (less than 12.8% according to sequence searches of record for both SEQ ID NOs. 5-6). Apart from the disclosed full-length mouse and human wild-type Clarin-1 cDNAs with their flanking full-length wild-type 5’-UTR and 3’-UTR nucleic acid sequences in SEQ ID NOs. 1-2, the instant specification fails to provide sufficient written description for any other wild-type clarin-1 cDNAs flanked by full-length wild-type 5’-UTR and 3’-UTR sequences obtained from any other animal species for a vector for transfecting a cell as claimed broadly, particularly for promoting expression of wild-type clarin-1 in mammalian cells, including the 5’UTR and the 3’UTR nucleic acid sequences enhance expression of clarin-1 in a cell transfected with the vector compared to a cell transfected with a vector that includes a wild-type clairin-1 cDNA coding sequence devoid of the 5’UTR and 3’UTR nucleic acid sequences. For example, what are the wild-type clarin-1 cDNAs with flanking full-length wild-type 5’UTR and 3’UTR sequences obtained from other animal species such as a whale, a rabbit, a fish, a dog, a cat, a frog or a cattle to be used in a vector for transfecting a cell as broadly claimed by the instant claims? Particularly, what are the exact nucleic acid sequences of a full-length whale, dog, cat or fish wild-type 5’ UTR and a full-length whale, dog, cat or fish wild-type 3’ UTR for the claimed vector? Importantly, the instant specification stated explicitly and clearly “Previous studies on other eukaryotic genes show that UTRs could play crucial roles in posttranscriptional regulation of gene expression by modulating mRNA localization, stability, and translation. We hypothesized that 3’ UTR sequence of Clrn1 is critical non-coding element of the gene and thus included that sequence in the transgene rescue experiment” (paragraph [00104]). Even 3 years after the effective filing date of the present application (11/06/2014), Geng et al (Scientific Reports 7:13480; doi:10.1038/s41598-017-13620-9; 2017) still stated in 2017 “We surmise that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. Although these immunofluorescence images (Figs 6 and 8) were captured under similar settings, we note that our interpretations are not based on quantitative data. Rigorous quantitative analyses are required to test the hypothesis that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. We will test this hypothesis in future experiments” (page 11, bottom of second full paragraph); and “Although we cannot rule out an essential role for the 5’UTR in Clrn1 gene rescue at this time, since the viral vector that rescued function in the KO-TgAC1 mice contains both 5’ and 3’ UTR (Fig. 6B), we strongly suspect that the 3’UTR is critical for a robust gene rescue effect” (page 11, fourth full paragraph). Since the prior art failed to provide adequate description for the above issues as evidenced at least by the teachings of Lancet et al (WO 03/097685), Knop et al (US 2011/0229971), Mallet et al (US 2006/0051331), Chakraborty et al (US 9,061,059) and Geng et al (Scientific Reports 7:13480; doi:10.1038/s41598-017-13620-9; 15 pages; 2017); it is incumbent upon the instant specification to do so. The present application also fails to provide at least a representative number of species for a broad genus of a vector for transfecting a cell as claimed broadly. The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision at least the complete detailed structure of a representative number of species for a broad genus of a vector for transfecting a cell as claimed broadly, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 6 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is because independent claim 1 recites the limitation “wherein the 3’ UTR nucleic acid sequence has at least 90% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 6”; and yet dependent claim 6 recites the limitation “wherein the 3’UTR nucleic acid comprises at least about 1000 consecutive nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6”. Please note at least that a 3’UTR nucleic acid comprising 1000 consecutive nucleotides of SEQ ID NO: 6 (1,372 nucleotides) only exhibits 73% sequence identity to SEQ ID NO: 6, let alone a 3’UTR nucleic acid comprising about 1000 consecutive nucleotides (less than 1000 consecutive nucleotides) of SEQ ID NO: 6. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. This is a new ground of rejection necessitated by Applicant’s amendment. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Amended claims 1, 6-8, 10-14 and 36 are rejected under 35 U.S.C. 103 as being unpatentable over Chakraborty et al (US 9,061,059) in view of Lancet et al (WO 03/097685) and Knop et al (US 2011/0229971). This is a new ground of rejection necessitated by Applicant’s amendment. The instant claims encompass a polynucleotide comprising a promoter and/or enhancer operably linked to a nucleic acid sequence that includes a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with a 5’UTR nucleic acid sequence that is derived from the 5’UTR of a wild type clarin-1 gene and at the 3’ end with a 3’UTR nucleic acid sequence that is derived from the 3’UTR of the wild-type clarin-1 gene, wherein the 3’ UTR nucleic acid sequence has at least 90% sequence identity of SEQ ID NO: 6 (1,372 base-pair sequence), including up to 137 nucleotide modifications in SEQ ID NO: 6; a nucleic acid construct or a vector for transfecting a cell such as an adeno-associated viral vector (e.g., an AAV2 vector) comprising the same polynucleotide and a pharmaceutical composition comprising the same vector. Please note that a modified 5’ UTR of a wild-type clarin-1 gene is a 5’ UTR that is derived from a wild-type clarin-1 gene. Similarly, a modified 3’ UTR of a wild-type clarin-1 gene is a 3’ UTR that is derived from a wild-type clarin-1 gene. Chakraborty et al already disclosed the human Clarin-1 DNA of SEQ ID NO: 6169 (2359 bp) that is 99.9% identical to SEQ ID NO: 2 of the present application, and the DNA contains the sequence of nucleotides 292-990 that is 100% identical to the sequence of SEQ ID NO: 4 of the present application and the sequence of nucleotides 991-2359 that is 99.8% identical to SEQ ID NO: 6 of the present application, as a gene encoding a polypeptide of interest for preparation, manufacture and/or formulation of modified mRNA (mmRNA) molecules (Particularly col. 3, lines 41-48; col. 135, lines 42-67; Table 6; SEQ ID NO: 6169; and attached sequence searches below). It is apparent that SEQ ID NO: 6169 contains a wild type human clarin-1 cDNA sequence with its flanking complete 5’UTR and complete 3’UTR. Chakraborty et al also stated “The polypeptides of interest or “Targets” of the present invention are listed in Lengthy Table 6. Shown in Lengthy Table 6, in addition to the name and description of the gene encoding the polypeptide of interest (Target Description)…It will be appreciated by those of skill in the art that disclosed in the Table are potential flanking regions. These are encoded in each ENST transcript either to the 5’ (upstream) or 3’ (downstream) of the ORF or coding sequence” (col. 135, lines 46-60). Chakraborty et al also stated “Building on this wild type modular structure, the present invention expands the scope of functionality of traditional mRNA molecules by providing polynucleotides or primary RNA constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide including, in some embodiments, the lack of a substantial induction of the innate immune response of a cell into which the polynucleotide is introduced…As used herein, a “structural” feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide, primary construct or mmRNA without significant chemical modification to the nucleotides themselves” (col. 8, lines 50-65). With respect to 5’ UTR or 3’ UTR, Chakraborty et al taught at least that introns or portions of intronic sequences may be incorporated into the flanking regions of the polynucleotides, primary constructs or mmRNA of the invention, and incorporation of intronic sequences may increase protein production as well as mRNA levels (col. 93, lines 44-49). Chakraborty et al also disclosed to engineer one or multiple target sites of miR-122 (with a microRNA seed of 6 nucleotides) into the 3’ UTR of the polynucleotide, primary constructs or mmRNA to decrease the longevity, stability, and protein translation of a polynucleotide, primary construct or mmRNA in unintended target liver (col. 94, last paragraph continues to first paragraph at col. 95). Chakraborty et al did not teach explicitly that the human Clarin-1 DNA of SEQ ID NO: 6169 with a modified 3’ UTR nucleic acid sequence that is at least 90% sequence identity to SEQ ID NO: 6 of the present application is in the form of a vector (e.g., an adeno-associated viral vector) or a polynucleotide comprising at least a promoter, and a pharmaceutical composition comprising the same vector. Before the effective filing dated of the present application (11/06/2014), Lancet et al already disclosed at least an isolated polynucleotide comprising a nucleic acid sequence encoding a USH3A/clarin-1 polypeptide, that includes the nucleic acid sequence of SEQ ID NO: 1 that is 75.8% identical to SEQ ID NO: 2 of the present application (apparently with a truncated 5’UTR relative to SEQ ID NO:2), or the mouse nucleic acid sequence of SEQ ID NO: 3 that is 35% identical to SEQ ID NO: 1 of the present application (apparently without 3’UTR relative to SEQ ID NO: 1) (see at least Abstract; particularly page 3, first two complete paragraphs; and attached sequence searches below). Lancet et al also taught that the isolated polynucleotide is in the form of a nucleic acid construct (e.g., pcDNA3, a retroviral vector) with a promoter, and a positive or negative selection markers (a vector); and a host cell or an animal comprising the nucleic acid construct (last complete paragraph at page 3 continues to fourth paragraph at page 4; and page 18, lines 14-29). Additionally, Knop et al also taught methods for efficiently producing recombinant AAV viral particles comprising a therapeutic gene, including clarin-1 (CLRN1) gene, for in vivo or ex vivo gene therapy, including for treatment of inherited or acquired diseases by replacing, altering, or supplementing a gene responsible for the disease, wherein the recombinant AAV viral particles have AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or rh-AAV10 capsid proteins (see at least Abstract; Summary of the Invention; particularly paragraphs [0002], [0028]-[0030], [0043]-[0045], [0064]-[0065], [0078], [0096], [0101]). Knop et al also stated “A gene may comprise several operably linked fragments, such as a promoter, a 5’-leader sequence, a coding sequence and a 3’ non-translated sequence comprising a polyadenylation site” (paragraph [0064]). Accordingly, it would have been obvious for an ordinary skill in the art to modify the teachings Chakraborty et al by also preparing the human Clarin-1 DNA of SEQ ID NO: 6169 containing up to 137 nucleotide modifications or up to 14 nucleotide modifications (90% and 99% sequence identity to SEQ ID NO: 6 of the present application, respectively) for a disclosed “structural” feature or modification such as incorporation of an intronic sequence or a portion of an intronic sequence and/or an engineered target site of miR-122 in the 3’ UTR in the form of a vector, including a recombinant adeno-associated virus vector such as AAV2 vector for expression in a host cell or a subject in need of a therapeutic clarin-1 gene, in light of the teachings of Lancet et al and Knop et al as presented above. An ordinary skill in the art would have been motivated to carry out the above modifications because: (i) Lancet et al already taught a nucleic acid construct/vector comprising an isolated nucleic acid sequence encoding a USH3A/clarin-1 polypeptide, and a host cell or an animal comprising the same nucleic acid construct/vector; and (ii) Knop et al also taught recombinant AAV viral particles comprising a therapeutic gene, including clarin-1 (CLRN1) gene, for in vivo or ex vivo gene therapy, including for treatment of inherited or acquired diseases by replacing, altering, or supplementing a gene responsible for the disease, wherein the recombinant AAV viral particles have AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or rh-AAV10 capsid proteins. An ordinary skill in the art would have a reasonable expectation of success in light of the teachings of Chakraborty et al, Lancet et al and Knop et al as set forth above, coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified polynucleotide/vector resulting from the combined teachings of Chakraborty et al, Lancet et al and Knop et al is indistinguishable from the claimed composition of the present application. With respect to the “intended use” limitations recited in dependent claims 11 and 13, the modified vector would transfect a cell, including an ocular cell and/or a cell of an inner ear organ and the transfected cell would express clarin-1, when it is placed or administered in a requisite environment. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Tian et al (J. Biol. Chem. 284:18980-18993) disclosed the cloning of CLRN1 cDNA by amplified the coding region of CLRN1 (NM-174878) from Human Retina Quick-Clone cDNA library and cloned into a pCRII-TOPO vector (right column, second paragraph at page 18981). Please note that a coding region does not include 5’UTR or 3’UTR sequences. Conclusions No claim is allowed. Claims 9 and 34 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/ Primary Examiner, Art Unit 1631 Mouse USH3A family gene sequence SeqID3. WO2003097685-A1. Query Match 35.0%; Score 1042.6; DB 10; Length 1043; Best Local Similarity 99.9%; Matches 1042; Conservative 1; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTGGGTGAGGAAGGATGCTTCACGGACTGGCGTTCTGCCTGGTGGAACCACTGTAAGGA 60 |||||||||||||||||||||||||||:|||||||||||||||||||||||||||||||| Db 1 AGTGGGTGAGGAAGGATGCTTCACGGAMTGGCGTTCTGCCTGGTGGAACCACTGTAAGGA 60 Qy 61 AGGGCAGTGTTTTTCAGCTGCTGTGATAAATGCAGCCGACGGGGCAGTCGCTACTTGATG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGGGCAGTGTTTTTCAGCTGCTGTGATAAATGCAGCCGACGGGGCAGTCGCTACTTGATG 120 Qy 121 CTCACAAAGGTCTTTGTTTTCAAGTTTGTCTTTACCGAAGCCTTTTCTCGTCATGCCAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTCACAAAGGTCTTTGTTTTCAAGTTTGTCTTTACCGAAGCCTTTTCTCGTCATGCCAAG 180 Qy 181 CCAGCAGAAGAAGATCATCTTTTGCATGGCTGGCGTACTGAGCTTTCTCTGTGCTCTTGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCAGCAGAAGAAGATCATCTTTTGCATGGCTGGCGTACTGAGCTTTCTCTGTGCTCTTGG 240 Qy 241 AGTGGTGACAGCAGTGGGCACCCCACTGTGGGTTAAAGCCACTATCCTCTGCAAAACAGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AGTGGTGACAGCAGTGGGCACCCCACTGTGGGTTAAAGCCACTATCCTCTGCAAAACAGG 300 Qy 301 GGCTCTGCTTGTCAACGCGTCAGGGAAGGAGCTGGACAAGTTCATGGGCGAGATGCAGTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GGCTCTGCTTGTCAACGCGTCAGGGAAGGAGCTGGACAAGTTCATGGGCGAGATGCAGTA 360 Qy 361 TGGCCTTTTCCACGGAGAAGGCGTAAGGCAATGTGGGTTAGGAGCAAGGCCTTTCCGGTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGGCCTTTTCCACGGAGAAGGCGTAAGGCAATGTGGGTTAGGAGCAAGGCCTTTCCGGTT 420 Qy 421 CTCATTCTTCCCAGATTTGGTCCAAGCCATCCCCGTAAGCATCCACATCAATATTATTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CTCATTCTTCCCAGATTTGGTCCAAGCCATCCCCGTAAGCATCCACATCAATATTATTCT 480 Qy 481 CTTCTCCATGATTCTTGTCGTCTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CTTCTCCATGATTCTTGTCGTCTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGC 540 Qy 541 TTTTGGCAAGCCCTTTGAAACTCTTCATGGACCACTGGGGCTCTATCTGGTCAGCTTCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TTTTGGCAAGCCCTTTGAAACTCTTCATGGACCACTGGGGCTCTATCTGGTCAGCTTCAT 600 Qy 601 TTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAGTCCACCG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAGTCCACCG 660 Qy 661 CCTTTCAGAGAAAATTGCAAATTTTAAAGAAGGGACCTATGCCTACAGAACACAAAACGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CCTTTCAGAGAAAATTGCAAATTTTAAAGAAGGGACCTATGCCTACAGAACACAAAACGA 720 Qy 721 AAACTATACCACCTCATTCTGGGTTGTTTTCATTTGCTTTTTTGTTCATTTTTTGAATGG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AAACTATACCACCTCATTCTGGGTTGTTTTCATTTGCTTTTTTGTTCATTTTTTGAATGG 780 Qy 781 GCTCCTGATACGACTTGCTGGATTTCAGTTCCCTTTCACAAAATCTAAAGAAACAGAGAC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GCTCCTGATACGACTTGCTGGATTTCAGTTCCCTTTCACAAAATCTAAAGAAACAGAGAC 840 Qy 841 CACTAATGTAGCTTCAGATTTAATGTACTGAAAAGCAAATATCTTCATAATTTCTCAATA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CACTAATGTAGCTTCAGATTTAATGTACTGAAAAGCAAATATCTTCATAATTTCTCAATA 900 Qy 901 AGGATATGGACTTCCTTTGGCCACTTTTAATATGGGTGATTTCATCTGTGCATTTAGACT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AGGATATGGACTTCCTTTGGCCACTTTTAATATGGGTGATTTCATCTGTGCATTTAGACT 960 Qy 961 TCTTAAGTACCAAGCCCTCCTTATGTTATGTTTACAGAGCATGTAGTAAGGATTCAGGCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TCTTAAGTACCAAGCCCTCCTTATGTTATGTTTACAGAGCATGTAGTAAGGATTCAGGCT 1020 Qy 1021 GGAAAATAACAGAAGCAGGAGGA 1043 ||||||||||||||||||||||| Db 1021 GGAAAATAACAGAAGCAGGAGGA 1043 ADM80672 standard; DNA; 2072 BP. Human USH3A gene coding sequence SeqID1. WO2003097685-A1. Query Match 75.8%; Score 1783.2; DB 10; Length 2072; Best Local Similarity 98.6%; Matches 2070; Conservative 2; Mismatches 0; Indels 28; Gaps 26; Qy 250 GAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGAAAATCATTT 309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGAAAATCATTT 60 Qy 310 TTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAGCCTTGGGGA 369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAGCCTTGGGGA 120 Qy 370 CACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGTCAATGCCT 429 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CACC-TTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGTCAATGCCT 179 Qy 430 CAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGG 489 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Db 180 CAGGGCAGGAGCTGG-CAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGG 238 Qy 490 GTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTCCAGATTTGC 549 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Db 239 GTGTGAGGCAGTGTGGGTTGGGAG-AAGGCCCTTTCGGTTCTCATTTTTTCCAGATTTGC 297 Qy 550 TCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTG 609 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 298 TCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTG 357 Qy 610 TGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGAAA 669 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 358 TGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTT-GAAAACCTTTTGAAA 416 Qy 670 CTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTC 729 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 417 CTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTC 476 Qy 730 TTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAA 789 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 477 TTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAA 536 Qy 790 ATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCT 849 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 537 ATTAT-AAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCT 595 Qy 850 GGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATACGACTTGCTG 909 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Db 596 GGGTCATTTTCTTTTG-TTTTTTGTTCATTTTCTGAATGGGCTCCTAATACGACTTGCTG 654 Qy 910 GATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAGCTGCAGATC 969 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Db 655 GATTTCAGTTCCCTTTTGCAAAATCT-AAGACGCAGAAACAACTAATGTAGCTGCAGATC 713 Qy 970 TAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCA 1029 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 714 TAATGTACTGAAAGGCAAACCTTTCTATAATTTTAC-AGGGAGTAGACTTGCTTTGGTCA 772 Qy 1030 CTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGAC 1089 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Db 773 CTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATA-TAAAGCATCAGGAC 831 Qy 1090 CCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGC 1149 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 832 CCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAA-GGAAGC 890 Qy 1150 AGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCA 1209 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 891 AGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCA 950 Qy 1210 AAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTG 1269 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 951 AAGGC-GTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTG 1009 Qy 1270 TGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATA 1329 |||||||||||||||||||||||||:|||||||||||||||||||||||||||||||||| Db 1010 TGTGTGTGTGTGTGTAAGATGTCTTYCTATCAAAAAGATATCAAAGGCACATGGAATATA 1069 Qy 1330 TTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAA 1389 ||||||||||||||||||||||:||| ||||||||||||||||||||||||||||||||| Db 1070 TTTTAATAAAAACAAATAATATYTCT-ATATATCCACACATTTGTTGCCAGATTTCAGAA 1128 Qy 1390 AACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGT 1449 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 1129 AACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGT-TTAAATGAACATCTATAAAATGT 1187 Qy 1450 ATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTC 1509 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Db 1188 ATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCC-GGCGTGGTGACTC 1246 Qy 1510 ACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGT 1569 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 1247 ACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCA-GAGT 1305 Qy 1570 TCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAA 1629 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1306 TCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAA 1365 Qy 1630 TAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAA 1689 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1366 TAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAA 1425 Qy 1690 ATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCC 1749 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1426 ATC--CAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCC 1483 Qy 1750 GTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCA 1809 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1484 GT-CCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCA 1542 Qy 1810 CTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGG 1869 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Db 1543 -TGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTA-G 1600 Qy 1870 GGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAA 1929 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1601 GGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATA-TAA 1659 Qy 1930 ATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCA 1989 |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 1660 ATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCAC--AGCA 1717 Qy 1990 TGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACT 2049 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 1718 TGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGC-GCTGACT 1776 Qy 2050 AAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAG 2109 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 1777 AAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGC-GTCCTCCAG 1835 Qy 2110 AAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAG 2169 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 1836 AAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGG-CTCTGACCACAG 1894 Qy 2170 GTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACA 2229 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 1895 GTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTAC-CCTTAAAATAAAACA 1953 Qy 2230 CTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTG 2289 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Db 1954 CTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTA-ACCTGAGAAATAACTTG 2012 Qy 2290 CTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2013 CTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2072 Sequence 6169, Patent No. 9061059 Query Match 99.9%; Score 2349; DB 23; Length 2359; Best Local Similarity 100.0%; Matches 2349; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGAAGGCAGTTTGAAAGACTTGTTTTACAGATTCTTAGTCCAAAGATTTCCAATTAGGGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11 TGAAGGCAGTTTGAAAGACTTGTTTTACAGATTCTTAGTCCAAAGATTTCCAATTAGGGA 70 Qy 61 GAAGAAGCAGCAGAAAAGGAGAAAAGCCAAGTATGAGTGATGATGAGGCCTTCATCTACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 71 GAAGAAGCAGCAGAAAAGGAGAAAAGCCAAGTATGAGTGATGATGAGGCCTTCATCTACT 130 Qy 121 GACATTTAACCTGGCGAGAACCGTCGATGGTGAAGTTGCCTTTTCAGCTGGGAGCTGTCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 131 GACATTTAACCTGGCGAGAACCGTCGATGGTGAAGTTGCCTTTTCAGCTGGGAGCTGTCC 190 Qy 181 GTTCAGCTTCCGTAATAAATGCAGTCAAAGAGGCAGTCCCTTCCCATTGCTCACAAAGGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 191 GTTCAGCTTCCGTAATAAATGCAGTCAAAGAGGCAGTCCCTTCCCATTGCTCACAAAGGT 250 Qy 241 CTTGTTTTTGAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 251 CTTGTTTTTGAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGA 310 Qy 301 AAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 311 AAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAG 370 Qy 361 CCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 371 CCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCG 430 Qy 421 TCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 431 TCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCC 490 Qy 481 ACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 491 ACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTC 550 Qy 541 CAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 551 CAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCA 610 Qy 601 TCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 611 TCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAAC 670 Qy 661 CTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 671 CTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCT 730 Qy 721 GTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 731 GTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAA 790 Qy 781 AAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 791 AAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCA 850 Qy 841 CCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 851 CCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATAC 910 Qy 901 GACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 911 GACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAG 970 Qy 961 CTGCAGATCTAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 971 CTGCAGATCTAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTG 1030 Qy 1021 CTTTGGTCACTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1031 CTTTGGTCACTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAG 1090 Qy 1081 CATCAGGACCCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1091 CATCAGGACCCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGT 1150 Qy 1141 AAGGGAAGCAGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1151 AAGGGAAGCAGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCC 1210 Qy 1201 AGGTAGTCAAAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1211 AGGTAGTCAAAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGT 1270 Qy 1261 GTGTGTGTGTGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1271 GTGTGTGTGTGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACA 1330 Qy 1321 TGGAATATATTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1331 TGGAATATATTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAG 1390 Qy 1381 ATTTCAGAAAACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1391 ATTTCAGAAAACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCT 1450 Qy 1441 ATAAAATGTATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1451 ATAAAATGTATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCG 1510 Qy 1501 TGGTGACTCACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1511 TGGTGACTCACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAG 1570 Qy 1561 TTCAGGAGTTCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1571 TTCAGGAGTTCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAA 1630 Qy 1621 AAAATAAAATAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1631 AAAATAAAATAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTG 1690 Qy 1681 TTGGTCAAAATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1691 TTGGTCAAAATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATT 1750 Qy 1741 TTTCCTCCCGTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1751 TTTCCTCCCGTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTG 1810 Qy 1801 TTAGGACCACTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1811 TTAGGACCACTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGA 1870 Qy 1861 CTTATTAGGGGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1871 CTTATTAGGGGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAA 1930 Qy 1921 TTATATTAAATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1931 TTATATTAAATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGT 1990 Qy 1981 CACCAAGCATGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1991 CACCAAGCATGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTG 2050 Qy 2041 CAGCTGACTAAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2051 CAGCTGACTAAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCT 2110 Qy 2101 GTCCTCCAGAAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2111 GTCCTCCAGAAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTC 2170 Qy 2161 TGACCACAGGTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2171 TGACCACAGGTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAA 2230 Qy 2221 AATAAAACACTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2231 AATAAAACACTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGA 2290 Qy 2281 AATAACTTGCTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTT 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2291 AATAACTTGCTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTT 2350 Qy 2341 CCAGATGCT 2349 ||||||||| Db 2351 CCAGATGCT 2359 Sequence 6169, Patent No. 9220755 Query Match 100.0%; Score 699; Length 2359; Best Local Similarity 100.0%; Matches 699; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 292 ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGT 351 Qy 61 GCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 352 GCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGC 411 Qy 121 AAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 412 AAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAA 471 Qy 181 ATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 472 ATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCC 531 Qy 241 TTTCGGTTCTCATTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 532 TTTCGGTTCTCATTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAAT 591 Qy 301 GTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 592 GTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATG 651 Qy 361 TACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 652 TACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTG 711 Qy 421 AGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 712 AGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAA 771 Qy 481 ATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 772 ATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACG 831 Qy 541 CAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 832 CAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTT 891 Qy 601 CTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 892 CTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGAC 951 Qy 661 GCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA 699 ||||||||||||||||||||||||||||||||||||||| Db 952 GCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA 990 Sequence 6169, US/14105224 Patent No. 9220755 Query Match 99.8%; Score 1369; Length 2359; Best Local Similarity 100.0%; Matches 1369; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCACTTTTAGATGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 991 AAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCACTTTTAGATGT 1050 Qy 61 GGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGACCCTTCGTGACA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1051 GGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGACCCTTCGTGACA 1110 Qy 121 ATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGCAGAAGGAAGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1111 ATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGCAGAAGGAAGGC 1170 Qy 181 TTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCAAAGGCAGTTGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1171 TTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCAAAGGCAGTTGA 1230 Qy 241 CTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTGTGTGTGTGTGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1231 CTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTGTGTGTGTGTGT 1290 Qy 301 GTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATATTTTAATAAAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1291 GTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATATTTTAATAAAA 1350 Qy 361 ACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAAAACTGAGCTGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1351 ACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAAAACTGAGCTGC 1410 Qy 421 AATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGTATCAACACACA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1411 AATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGTATCAACACACA 1470 Qy 481 TTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTCACACCTGTAAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1471 TTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTCACACCTGTAAT 1530 Qy 541 TCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGTTCGAGTTACAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1531 TCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGTTCGAGTTACAG 1590 Qy 601 CCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAATAAATATAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1591 CCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAATAAATATAAAA 1650 Qy 661 TATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAAATCTGCAAACT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1651 TATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAAATCTGCAAACT 1710 Qy 721 CTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCCGTGCCTGAGTC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1711 CTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCCGTGCCTGAGTC 1770 Qy 781 CCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCACTGAGGAATCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1771 CCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCACTGAGGAATCA 1830 Qy 841 TGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGGGGCTGTTTTTC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1831 TGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGGGGCTGTTTTTC 1890 Qy 901 TAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAAATCTGGGATTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1891 TAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAAATCTGGGATTA 1950 Qy 961 TGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCATGACCCAGGTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1951 TGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCATGACCCAGGTC 2010 Qy 1021 AACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACTAAAGGCCACAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2011 AACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACTAAAGGCCACAG 2070 Qy 1081 CTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAGAAAGCACCAAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2071 CTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAGAAAGCACCAAG 2130 Qy 1141 GAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAGGTGCTGAGTAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2131 GAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAGGTGCTGAGTAC 2190 Qy 1201 TCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACACTGTTTCCCTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2191 TCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACACTGTTTCCCTT 2250 Qy 1261 TGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTGCTCTGGTGTCA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2251 TGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTGCTCTGGTGTCA 2310 Qy 1321 ATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 1369 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 2311 ATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2359
Read full office action

Prosecution Timeline

Nov 22, 2023
Application Filed
Feb 18, 2026
Non-Final Rejection mailed — §103, §112
Jun 18, 2026
Response Filed
Sep 02, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12697350
METHODS AND COMPOSITIONS FOR TREATING A PREMATURE TERMINATION CODON-MEDIATED DISORDER
4y 3m to grant Granted Aug 04, 2026
Patent 12680074
ANTIGEN PRESENTING T CELLS, SENSITIZED, MANUFACTURED T CELLS AND METHODS OF TREATMENT USING THE SAME
3y 8m to grant Granted Jul 14, 2026
Patent 12680076
METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPHY
3y 8m to grant Granted Jul 14, 2026
Patent 12673116
COMPOSITIONS AND METHODS FOR TREATING NON-AGE-ASSOCIATED HEARING IMPAIRMENT IN A HUMAN SUBJECT
5y 3m to grant Granted Jul 07, 2026
Patent 12655427
Recombinant Adeno-Associated Virus Delivery of Exon 2-Targeted U7SNRNA Polynucleotide Constructs
4y 6m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.6%)
4y 0m (~1y 2m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 750 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month