Prosecution Insights
Last updated: April 19, 2026
Application No. 18/517,080

COMPOSITIONS AND METHODS OF TREATING USHER SYNDROME III

Non-Final OA §103§112
Filed
Nov 22, 2023
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Case Western Reserve University
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
3y 11m
To Grant
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
280 granted / 734 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
65 currently pending
Career history
799
Total Applications
across all art units

Statute-Specific Performance

§101
1.9%
-38.1% vs TC avg
§103
37.9%
-2.1% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
27.8%
-12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 734 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The preliminary amendment filed on 03/01/2024 has been entered. Amended claims 1, 5-14 and new claims 16-35 are pending in the present application; and they are examined on the merits herein. Claim Objections Claim 1 is objected to because of the phrase “the 5’UTR nucleic acid sequence and the 3’UTR nucleic acid enhance”. This is because of the omission of the term “sequence” between the terms “acid” and “enhance” in the above phrase. Claim 26 is objected to because of the lack of an article “a” in front of the phrase “full-length 3’UTR nucleic acid sequence” on lines 3-4 of the claim. Claim Rejections - 35 USC § 112 (Lack of Written Description) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 5-14 and 31 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116. Claims 1 and 5-14 encompass a polynucleotide comprising a nucleic acid sequence that includes a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with a 5’UTR of any length (e.g., 10, 20, 50, 100, 150, 250, 500, 750, 1000, 1500, 2000 nucleotides or more) as long as it is derived from a 5’UTR of any clarin-1 gene from any animal species, and a 3’UTR nucleic acid sequence of any length (e.g., 10, 20, 50, 100, 150, 250, 500, 750, 1000, 1500, 2000 nucleotides or more) as long as it is derived from a 3’UTR of any clarin-1 gene from any animal species (e.g., the mouse 2107-nucleotide 3’UTR of SEQ ID NO: 5 or the human 1372-nucleotide 3’UTR of SEQ ID NO: 6), wherein the 5’UTR nucleic acid sequence and the 3’UTR nucleic acid sequence enhance expression of clarin-1 in a cell transfected with the polynucleotide compared to a cell transfected with a similar polynucleotide devoid of the 5’UTR nucleic acid sequence and the 3’UTR nucleic acid sequence, including the polynucleotide comprising a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 1 (the mouse 2978-nucleotide sequence) or SEQ ID NO: 2 (the human 2353-nucleotide sequence); a nucleic acid construct or a vector comprising a polynucleotide of claim 1, and a pharmaceutical composition comprising the same vector. Claim 31 encompasses a vector for transfecting a cell comprising: a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with a full-length 5’UTR nucleic acid sequence of any clarin-1 gene derived from any animal species and at the 3’ end with a full length 3’UTR nucleic acid sequence of any clarin-1 gene from any animal species, wherein the 5’UTR and the 3’UTR nucleic acid sequences enhance expression of clarin-1 in ocular cells and/or cells of the inner ear of a mammalian subject having Usher syndrome III that are transfected with the vector compared to a cell transfected with a vector that includes a wild-type clarin-1 cDNA coding sequence devoid of the 5’UTR and 3’UTR nucleic acid sequences. Apart from disclosing transfecting cochlear hair cells of the KO-TgAC1 mice at P1-P3 (postnatal day 1-3) through the round window membrane (RWM) using rAAV2-Clrn1-UTR vector or rAAV8-Clrn1-UTR vector, wherein each of the recombinant AAV vectors comprises the wild-type murine Clrn1 cDNA (699 bp) flanked by the mouse Clrn1 full-length 5’-UTR (172 bp) and the mouse Clrn1 full-length 3’-UTR of SEQ ID NO: 5 (2107 bp) in the polynucleotide sequence of SEQ ID NO: 1 (2978 bp), and being fused downstream of the Atoh1 enhancer and beta-globin basal promoter sequence, that resulted in a robust and sustained preservation of hearing through adult life compared to KO-TgAC1 mice transfected with Clrn1 without the 3’ UTR or untransfected KO-TgAC1 mice (see at least paragraphs [0099], [00108]-[00111]; Figs. 1, 3 and 5A); the instant specification fails to provide sufficient written description for any other clarin-1 polynucleotide/vector containing a clarin-1 cDNA coding sequence and a clarin-1 gene derived 3’-UTR nucleic acid sequence of any length and/or any modified clarin-1 3’-UTR nucleic acid, along with any other clarin-1 derived 5’-UTR nucleic acid sequence of any length and/or modified clarin-1 5’-UTR nucleic acid sequence to enhance expression of clarin-1 in a transfected cell relative to a similar polynucleotide/vector devoid of the 5’UTR nucleic acid sequence and the 3’UTR nucleic acid sequence as claimed broadly. For example, what are the minimal essential core/critical elements and/or the minimal length that a clarin-1 gene derived 3’-UTR nucleic acid sequence must possess to enhance clarin-1 expression in a transfected cell as required by the instant claims? Which particular sequence(s) and/or which particular nucleotide residues in the mouse full-length 3’-UTR of SEQ ID NO: 5 (the 2,107-nucleotide sequence) are amenable for modifications (e.g., insertion(s), deletion(s), substitution(s) and/or a combination thereof), such that the modified 3’-UTR nucleic acid still possesses an ability to enhance clarin-1 expression as required by the instant claims; including up to around 210 nucleotide modifications or 21 nucleotide modifications in the sequence of SEQ ID NO: 5 for a clarin-1 derived 3’UTR sequence having at least around 90% or 99% sequence identity of SEQ ID NO: 5, respectively. Which particular at least about 1000 consecutive nucleotides of SEQ ID NO: 5 (the 2,107-nucleotide sequence) that are responsible for the observed and desired enhanced clarin-1 expression as encompassed by the instant claims? More importantly, the instant specification stated explicitly and clearly “Previous studies on other eukaryotic genes show that UTRs could play crucial roles in posttranscriptional regulation of gene expression by modulating mRNA localization, stability, and translation. We hypothesized that 3’ UTR sequence of Clrn1 is critical non-coding element of the gene and thus included that sequence in the transgene rescue experiment” (paragraph [00104]). Based on the same disclosure of this application, Geng et al (Scientific Reports 7:13480; doi:10.1038/s41598-017-13620-9; 2017) still stated in 2017 “We surmise that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. Although these immunofluorescence images (Figs 6 and 8) were captured under similar settings, we note that our interpretations are not based on quantitative data. Rigorous quantitative analyses are required to test the hypothesis that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. We will test this hypothesis in future experiments” (page 11, bottom of second full paragraph); and “Although we cannot rule out an essential role for the 5’UTR in Clrn1 gene rescue at this time, since the viral vector that rescued function in the KO-TgAC1 mice contains both 5’ and 3’ UTR (Fig. 6B), we strongly suspect that the 3’UTR is critical for a robust gene rescue effect” (page 11, fourth full paragraph). Although the specification also discloses the full-length human clarin-1 3’-UTR of SEQ ID NO: 6 (1372 bp), however, there is no homology whatsoever between SEQ ID NO: 6 with the mouse clarin-1 3’UTR of SEQ ID NO: 5 (less than 12.8% according sequence searches of record for both SEQ ID NOs. 5-6). There is also no evidence of record that the human clarin-1 3’-UTR sequence of SEQ ID NO: 6 is capable of increasing stability of the transcript and/or efficiency of translation to result in an enhance expression of clarin-1 in a transfected cell as demonstrated for the mouse clarin-1 3’UTR of SEQ ID NO: 5 (2107 bp), let alone any human clarin-1 derived 5’-UTR nucleic acid sequence of any length and/or modified human clarin-1 5’-UTR nucleic acid sequence as encompassed by the instant claims. Even 3 years after the effective filing date of the present application (11/06/2014), Applicant still cannot rule out an essential role for the 5’UTR in Clrn1 gene rescue since the viral vector that rescued function in the KO-TgAC1 mice contains both full-length mouse 5’ and 3’ UTR sequences. However, apart from the full-length mouse 5’ and 3’ UTR sequences in a polynucleotide comprising the sequence of SEQ ID NO: 1 (2978 bp) the instant specification also fails to provide sufficient written description for any mouse clarin-1 gene derived 5’-UTR nucleic acid sequence of any length and/or any modified mouse clarin-1 5’-UTR nucleic acid sequence that is capable of enhancing expression clarin-1 in a transfected cell, let alone any 5’UTR nucleic acid sequence derived from a clarin-1 gene obtained from any source (e.g., human, dog, cat, cattle, whale, or fish), as encompassed broadly by the instant claims. With respect to a polynucleotide comprising a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 1 (the mouse 2978-bp sequence) or SEQ ID NO: 2 (the human 2352-bp sequence), once again the instant specification also fails to describe sufficiently which particular sequence(s) and/or which particular nucleotide residues in the mouse SEQ ID NO: 1 or the human SEQ ID NO: 2 are amenable for modifications (e.g., insertion(s), deletion(s), substitution(s) and/or a combination thereof), such that the modified polynucleotide possesses an ability to enhance clarin-1 expression; including up to 298 nucleotide modifications in SEQ ID NO: 1 or up to 235 nucleotide modifications in SEQ ID NO: 2. There is also no evidence of record indicating that the human SEQ ID NO: 2 is capable of enhancing clarin-1 expression in a transfected cell as the mouse SEQ ID NO: 1, and especially there is no homology whatsoever between the human clarin-1 3’UTR of SEQ ID NO: 6 with the mouse clarin-1 3’UTR of SEQ ID NO: 5. Since the prior art failed to provide adequate description for the above issues as evidenced at least by the teachings of Lancet et al (WO 03/097685), Knop et al (US 2011/0229971), Mallet et al (US 2006/0051331), Chakraborty et al (US 9,061,059) and Geng et al (Scientific Reports 7:13480; doi:10.1038/s41598-017-13620-9; 15 pages; 2017); it is incumbent upon the instant specification to do so. The present application also fails to provide at least a representative number of species for a broad genus of a polynucleotide/vector that enhances expression of clarin-1 in a transfected cell as claimed broadly. The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision at least the complete detailed structure of a representative number of species for a broad genus of a polynucleotide/vector that enhances expression of clarin-1 in a transfected cell as claimed broadly, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). Claim Rejections - 35 USC § 112 (Scope of Enablement) Claims 26-35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for: A vector for transfecting a cell comprising the nucleotide sequence of SEQ ID NO: 1, and a pharmaceutical composition comprising the same vector; does not reasonably provide enablement for other vectors as claimed broadly. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. The factors to be considered in the determination of an enabling disclosure have been summarized as the quantity of experimentation necessary, the amount of direction or guidance presented, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art and the breadth of the claims. Ex parte Forman, (230 USPQ 546 (Bd Pat. Appl & Unt, 1986); In re Wands, 858 F.2d 731, 8 USPQ 2d 1400 (Fed. Cir. 1988)). When read in light of the specification, the sole purpose of a vector comprising a wild-type clarin-1 cDNA coding sequence having flanking full-length 5’UTR and full-length 3’UTR of a clarin-1 gene is for the treatment of a subject having Usher syndrome III, particularly for the treatment of hearing and/or vision loss associated with Usher syndrome III (see at least Abstract, paragraphs [0002], [0005]-[0006]; and Example). The instant specification is not enabled for the make and use of the instant broadly claimed vector for the following reasons. 1. The breadth of the claims The instant claims encompass a vector (e.g., a non-viral or viral vector such as a plasmid or an AAV vector) for transfecting a cell comprising a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with full-length 5’UTR nucleic acid sequence of a clarin-1 gene from any animal species (e.g., mouse, human, cattle, dog, whale, fish) and at the 3’ end with full-length 3’UTR nucleic acid sequence of a clarin-1 gene from any animal species (e.g., mouse, human, cattle, dog, whale, fish), including the 3’UTR nucleic acid comprising at least 90% sequence identity to SEQ ID NO: 5 (the mouse 2,107-bp sequence) or human SEQ ID NO: 6 (the human 1372-bp sequence); or the vector comprising a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 1 (the mouse 2978-bp sequence) or SEQ ID NO: 2 (the human 2352-bpsequence); and a pharmaceutical composition comprising the same vector. 2. The state and unpredictability of the prior art Before the effective filing date of the present application (11/06/2014), virtually nothing was known about the effect of a full-length clarin-1 5’UTR and/or a full-length clarin-1 3’UTR on clarin-1 expression/production; and little was known about a gene therapy vector comprising a wild-type clarin-1 cDNA coding sequence having flanking full-length 5’UTR and full-length 3’UTR of a clarin-1 gene, particularly for the treatment of hearing and/or vision loss associated with Usher syndrome III as evidenced at least by the teachings of Lancet et al (WO 03/097685), Knop et al (US 2011/0229971), Mallet et al (US 2006/0051331), Chakraborty et al (US 9,061,059) and Geng et al (Scientific Reports 7:13480; doi:10.1038/s41598-017-13620-9; 15 pages; 2017). The instant specification stated clearly “[t]he precise function of CLRN1 in the inner ear is not known. There is no treatment or cure for ear or eye disease in USHIII at this time” (last two sentences of paragraph [0004]); and “Previous studies on other eukaryotic genes show that UTRs could play crucial roles in posttranscriptional regulation of gene expression by modulating mRNA localization, stability, and translation. We hypothesized that 3’ UTR sequence of Clrn1 is critical non-coding element of the gene and thus included that sequence in the transgene rescue experiment” (paragraph [00104]). 3. The amount of direction or guidance provided Apart from disclosing transfecting cochlear hair cells of the KO-TgAC1 mice at P1-P3 (postnatal day 1-3) through the round window membrane (RWM) using rAAV2-Clrn1-UTR vector or rAAV8-Clrn1-UTR vector, wherein each of the recombinant AAV vectors comprises the wild-type murine Clrn1 cDNA (699 bp) flanked by the mouse Clrn1 full-length 5’-UTR (172 bp) and the mouse Clrn1 full-length 3’-UTR of SEQ ID NO: 5 (2107 bp) in the polynucleotide sequence of SEQ ID NO: 1 (2978 bp), and being fused downstream of the Atoh1 enhancer and beta-globin basal promoter sequence, that resulted in a robust and sustained preservation of hearing through adult life compared to KO-TgAC1 mice transfected with Clrn1 without the 3’ UTR or untransfected KO-TgAC1 mice (see at least paragraphs [0099], [00108]-[00111]; Figs. 1, 3 and 5A); the instant specification fails to provide sufficient guidance for a skilled artisan on how to make and use other vectors as encompassed broadly by the instant claims, particularly such vectors are capable of mediating a useful expression of clarin-1 for the treatment of a subject having Usher syndrome III, particularly for the treatment of hearing and/or vision loss associated with Usher syndrome III. Apart from a recombinant AAV vector comprising the mouse polynucleotide sequence of SEQ ID NO: 1 that mediates a robust and sustained preservation of hearing through adult life, the specification fails to provide sufficient guidance for a skill artisan on which particular sequence(s) and/or which particular nucleotide residues in the mouse SEQ ID NO: 1, particularly in its 3’UTR nucleic acid sequence and/or its 5’UTR nucleic acid sequence, are amenable for modifications (e.g., insertion(s), deletion(s), substitution(s) and/or a combination thereof), such that the modified polynucleotide sequence still retains the same properties as those of SEQ ID NO: 1; including up to 298 nucleotide modifications in SEQ ID NO: 1 for a polynucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1. Please note that the specification stated explicitly “We hypothesized that 3’ UTR sequence of Clrn1 is critical non-coding element of the gene and thus included that sequence in the transgene rescue experiment” (paragraph [00104]). Based on the same disclosure of this application, 3 years after the effective filing date of the present application Geng et al still stated “We surmise that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. Although these immunofluorescence images (Figs 6 and 8) were captured under similar settings, we note that our interpretations are not based on quantitative data. Rigorous quantitative analyses are required to test the hypothesis that Clrn1 UTR sequences increase stability of the transcript and efficiency of translation. We will test this hypothesis in future experiments” (page 11, bottom of second full paragraph); and “Although we cannot rule out an essential role for the 5’UTR in Clrn1 gene rescue at this time, since the viral vector that rescued function in the KO-TgAC1 mice contains both 5’ and 3’ UTR (Fig. 6B), we strongly suspect that the 3’UTR is critical for a robust gene rescue effect” (page 11, fourth full paragraph). Although the specification also discloses the full-length human clarin-1 3’-UTR of SEQ ID NO: 6 (1372 bp) in the polynucleotide of SEQ ID NO: 2 (2352 bp), however, there is no homology whatsoever between SEQ ID NO: 6 with the mouse clarin-1 3’UTR of SEQ ID NO: 5 (less than 12.8% according sequence searches of record for both SEQ ID NOs. 5-6) in the polynucleotide sequence of SEQ ID NO: 1 (2978 bp). There is also no evidence of record that the human clarin-1 3’-UTR sequence of SEQ ID NO: 6 is capable of increasing stability of the transcript and/or efficiency of translation as demonstrated for the mouse clarin-1 3’UTR of SEQ ID NO: 5 (2107 bp), let alone a full-length 3’UTR of a clarin-1 gene from any other animal species as encompassed broadly by the instant claims. The specification also fails to provide sufficient guidance for a skill artisan on which particular sequence(s) and/or which particular nucleotide residues in the human SEQ ID NO: 2, particularly in its 3’UTR nucleic acid sequence and/or its 5’UTR nucleic acid sequence, are amenable for modifications (e.g., insertion(s), deletion(s), substitution(s) and/or a combination thereof), such that the modified polynucleotide sequence possesses the same properties as those of the mouse polynucleotide sequence of SEQ ID NO: 1; including up to 235 nucleotide modifications in SEQ ID NO: 2 for a polynucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2. Once again, there is also no evidence of record indicating that the human SEQ ID NO: 2 has the same properties as the mouse SEQ ID NO: 1, and especially there is no homology whatsoever between the human clarin-1 3’UTR of SEQ ID NO: 6 with the mouse clarin-1 3’UTR of SEQ ID NO: 5. Since the prior art before the effective filing date of the present application did not provide sufficient guidance for the aforementioned issues, it is incumbent upon the instant specification to do so. The physiological art is recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires: That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved. Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maizel.). Accordingly, due to the lack of sufficient guidance provided by the specification regarding to the issues set forth above, the unpredictable state of the relevant art, and the breadth of the claims, it would have required undue experimentation for one skilled in the art to make and use the instant broadly claimed invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 5-8, 10-14, 26-33 and 35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Independent claim 1 recites the limitation "the clarin-1 gene" in lines 4-5 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because prior to this limitation, there is no recitation of a clarin-1 gene and therefore it is unclear exactly which particular "the clarin-1 gene” that Applicant refers to. Clarification is requested because the metes and bounds of the claim are not clearly determined. Similarly, independent claim 26 recites the limitation "the clarin-1 gene" in lines 3-4 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because prior to this limitation, there is no recitation of a clarin-1 gene and therefore it is unclear exactly which particular "the clarin-1 gene” that Applicant refers to. Clarification is requested because the metes and bounds of the claim are not clearly determined. Claim 29 recites the limitation "the mammalian cells" in line 1 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because prior to this limitation and in independent claim 26 from which claim 29 is dependent upon, there is no recitation of any mammalian cells. Accordingly, it is unclear which particular “the mammalian cells” does the limitation refer to. Once again, clarification is requested because the metes and bounds of the claim are not clearly determined. In claim 31, it is unclear what is encompassed by the limitation “enhance expression of clarin-1 in the mammalian cell transfected with the vector”. Which particular mammalian cell transfected with the vector? This is because in claim 29 from which claim 31 is dependent upon, there are ocular cells and/or cells of the inner year of a mammalian subject are transfected with the vector. Once again, clarification is requested because the metes and bounds of the claim are not clearly determined. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 28-30 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is because independent claim 26 is drawn to a vector (a composition claim), and dependent claims 28-30 further recite limitations that fail to further limit the vector in claim 26 from which they are dependent upon. None of the limitations in dependent claims 28-30 further limit the structure and/or elements of the vector in independent claim 26. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 26, 28-30 and 32-34 are rejected under 35 U.S.C. 103 as being unpatentable over Chakraborty et al (US 9,061,059) in view of Lancet et al (WO 03/097685). The instant claims are drawn to a vector for transfecting a cell (an intended use) comprising a wild-type clarin-1 cDNA coding sequence having a 5’ end and a 3’ end that is flanked at the 5’ end with full-length 5’UTR nucleic acid sequence of the clarin-1 gene and at the 3’ end with full-length 3’UtR nucleic acid sequence of the clarin-1 gene; the same vector wherein the 3’ UTR nucleic acid sequence comprises at least 90% sequence identity to SEQ ID NO: 6, or the clarin-1 cDNA has at least 90% sequence identity to SEQ ID NO: 4; or the vector comprising a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 2. Chakraborty et al already disclosed the human Clarin-1 DNA of SEQ ID NO: 6169 (2359 bp) that is 99.9% identical to SEQ ID NO: 2 of the present application, and the DNA contains the sequence of nucleotides 292-990 that is 100% identical to the sequence of SEQ ID NO: 4 of the present application and the sequence of nucleotides 991-2359 that is 99.8% identical to SEQ ID NO: 6 of the present application (Particularly col. 3, lines 41-48; col. 135, lines 42-67; Table 6; SEQ ID NO: 6169; and attached sequence searches below). It is apparent that SEQ ID NO: 6169 contains a wild type human clarin-1 cDNA sequence with its flanking complete 5’UTR and complete 3’UTR. Chakraborty et al also stated “The polypeptides of interest or “Targets” of the present invention are listed in Lengthy Table 6. Shown in Lengthy Table 6, in addition to the name and description of the gene encoding the polypeptide of interest (Target Description)…It will be appreciated by those of skill in the art that disclosed in the Table are potential flanking regions. These are encoded in each ENST transcript either to the 5’ (upstream) or 3’ (downstream) of the ORF or coding sequence” (col. 135, lines 46-60). Chakraborty et al did not teach that the human Clarin-1 DNA of SEQ ID NO: 6169 is in the form of a vector. Before the effective filing dated of the present application (11/06/2014), Lancet et al already disclosed at least an isolated polynucleotide comprising a nucleic acid sequence encoding a USH3A/clarin-1 polypeptide, that includes the nucleic acid sequence of SEQ ID NO: 1 that is 75.8% identical to SEQ ID NO: 2 of the present application (apparently with a truncated 5’UTR relative to SEQ ID NO:2), or the mouse nucleic acid sequence of SEQ ID NO: 3 that is 35% identical to SEQ ID NO: 1 of the present application (apparently without 3’UTR relative to SEQ ID NO: 1) (see at least Abstract; particularly page 3, first two complete paragraphs; and attached sequence searches below). Lancet et al also taught that the isolated polynucleotide is in the form of a nucleic acid construct (e.g., pcDNA3, a retroviral vector) with a promoter, and a positive or negative selection markers (a vector); and a host cell or an animal comprising the nucleic acid construct (last complete paragraph at page 3 continues to fourth paragraph at page 4; and page 18, lines 14-29). Accordingly, it would have been obvious for an ordinary skill in the art to modify the teachings Chakraborty et al by also preparing the human Clarin-1 DNA of SEQ ID NO: 6169 in the form of a vector for expression in a host cell or an animal, in light of the teachings of Lancet et al as presented above. An ordinary skill in the art would have been motivated to carry out the above modification because Lancet et al already taught a nucleic acid construct/vector comprising an isolated nucleic acid sequence encoding a USH3A/clarin-1 polypeptide, and a host cell or an animal comprising the same nucleic acid construct/vector. An ordinary skill in the art would have a reasonable expectation of success in light of the teachings of Chakraborty et al and Lancet et al as set forth above, coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified vector resulting from the combined teachings of Chakraborty et al and Lancet et al is indistinguishable from the claimed vector of the present application. With respect to the “intended use” limitations recited in dependent claims 28-30, the modified vector would also promote expression of wild-type clarin-1 in mammalian cells, including ocular cells and/or cells of the inner ear of a mammalian subject having Usher syndrome III, when it is placed or administered into the requisite environment. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claim 27 is rejected under 35 U.S.C. 103 as being unpatentable over Chakraborty et al (US 9,061,059) in view of Lancet et al (WO 03/097685) as applied to claims 26, 28-30 and 32-34 above, and further in view of Xiao et al (WO 96/40272). The combined teachings of Chakraborty et al and Lancet et al were presented above. However, none of the cited references teach specifically the use of an adeno-associated viral vector for clarin-1 expression. Before the effective filing dated of the present application (11/06/2014), Xiao et al already taught that recombinant AAV vectors were well known and were known to be able to transduce a number of cells and tissues; and they demonstrated long-term transgene expression in muscle cells, up to 5 months, in an animal using a recombinant AAV vector (Abstract; Summary of the Invention; and last full paragraph at page 15). Xiao et al also taught that AAV vectors have certain advantages over other vector systems (e.g., naked DNA, adenovirus and retrovirus) such as an extremely stable, and efficient vector for infection of non-dividing cells; a safer vector relative to an Ad vector and a retroviral vector due to the elimination of all AAV viral genes in an AAV vector and AAV integration into a specific region of human chromosome 19 (first paragraph at page 13). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings Chakraborty et al and Lancet et al by also selecting a recombinant AAV vector for expressing clarin-1 in a host cell or in an animal, in light of the teachings of Xiao et al as presented above. An ordinary skill in the art would have been motivated to further carry out the above modification because Xiao et al taught that recombinant AAV vectors were well known and were known to be able to transduce a number of cells and tissues, including promoting a long-term transgene expression in muscle cells of an animal, along with certain advantages over other vector systems. An ordinary skill in the art would have a reasonable expectation of success in light of the teachings of Chakraborty et al, Lancet et al and Xiao et al as set forth above, coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified vector resulting from the combined teachings of Chakraborty et al, Lancet et al and Xiao et al is indistinguishable from the claimed vector of the present application. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Conclusions No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/ Primary Examiner, Art Unit 1631 Mouse USH3A family gene sequence SeqID3. WO2003097685-A1. Query Match 35.0%; Score 1042.6; DB 10; Length 1043; Best Local Similarity 99.9%; Matches 1042; Conservative 1; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTGGGTGAGGAAGGATGCTTCACGGACTGGCGTTCTGCCTGGTGGAACCACTGTAAGGA 60 |||||||||||||||||||||||||||:|||||||||||||||||||||||||||||||| Db 1 AGTGGGTGAGGAAGGATGCTTCACGGAMTGGCGTTCTGCCTGGTGGAACCACTGTAAGGA 60 Qy 61 AGGGCAGTGTTTTTCAGCTGCTGTGATAAATGCAGCCGACGGGGCAGTCGCTACTTGATG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGGGCAGTGTTTTTCAGCTGCTGTGATAAATGCAGCCGACGGGGCAGTCGCTACTTGATG 120 Qy 121 CTCACAAAGGTCTTTGTTTTCAAGTTTGTCTTTACCGAAGCCTTTTCTCGTCATGCCAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTCACAAAGGTCTTTGTTTTCAAGTTTGTCTTTACCGAAGCCTTTTCTCGTCATGCCAAG 180 Qy 181 CCAGCAGAAGAAGATCATCTTTTGCATGGCTGGCGTACTGAGCTTTCTCTGTGCTCTTGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCAGCAGAAGAAGATCATCTTTTGCATGGCTGGCGTACTGAGCTTTCTCTGTGCTCTTGG 240 Qy 241 AGTGGTGACAGCAGTGGGCACCCCACTGTGGGTTAAAGCCACTATCCTCTGCAAAACAGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AGTGGTGACAGCAGTGGGCACCCCACTGTGGGTTAAAGCCACTATCCTCTGCAAAACAGG 300 Qy 301 GGCTCTGCTTGTCAACGCGTCAGGGAAGGAGCTGGACAAGTTCATGGGCGAGATGCAGTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GGCTCTGCTTGTCAACGCGTCAGGGAAGGAGCTGGACAAGTTCATGGGCGAGATGCAGTA 360 Qy 361 TGGCCTTTTCCACGGAGAAGGCGTAAGGCAATGTGGGTTAGGAGCAAGGCCTTTCCGGTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGGCCTTTTCCACGGAGAAGGCGTAAGGCAATGTGGGTTAGGAGCAAGGCCTTTCCGGTT 420 Qy 421 CTCATTCTTCCCAGATTTGGTCCAAGCCATCCCCGTAAGCATCCACATCAATATTATTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CTCATTCTTCCCAGATTTGGTCCAAGCCATCCCCGTAAGCATCCACATCAATATTATTCT 480 Qy 481 CTTCTCCATGATTCTTGTCGTCTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CTTCTCCATGATTCTTGTCGTCTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGC 540 Qy 541 TTTTGGCAAGCCCTTTGAAACTCTTCATGGACCACTGGGGCTCTATCTGGTCAGCTTCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TTTTGGCAAGCCCTTTGAAACTCTTCATGGACCACTGGGGCTCTATCTGGTCAGCTTCAT 600 Qy 601 TTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAGTCCACCG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAGTCCACCG 660 Qy 661 CCTTTCAGAGAAAATTGCAAATTTTAAAGAAGGGACCTATGCCTACAGAACACAAAACGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CCTTTCAGAGAAAATTGCAAATTTTAAAGAAGGGACCTATGCCTACAGAACACAAAACGA 720 Qy 721 AAACTATACCACCTCATTCTGGGTTGTTTTCATTTGCTTTTTTGTTCATTTTTTGAATGG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AAACTATACCACCTCATTCTGGGTTGTTTTCATTTGCTTTTTTGTTCATTTTTTGAATGG 780 Qy 781 GCTCCTGATACGACTTGCTGGATTTCAGTTCCCTTTCACAAAATCTAAAGAAACAGAGAC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GCTCCTGATACGACTTGCTGGATTTCAGTTCCCTTTCACAAAATCTAAAGAAACAGAGAC 840 Qy 841 CACTAATGTAGCTTCAGATTTAATGTACTGAAAAGCAAATATCTTCATAATTTCTCAATA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CACTAATGTAGCTTCAGATTTAATGTACTGAAAAGCAAATATCTTCATAATTTCTCAATA 900 Qy 901 AGGATATGGACTTCCTTTGGCCACTTTTAATATGGGTGATTTCATCTGTGCATTTAGACT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AGGATATGGACTTCCTTTGGCCACTTTTAATATGGGTGATTTCATCTGTGCATTTAGACT 960 Qy 961 TCTTAAGTACCAAGCCCTCCTTATGTTATGTTTACAGAGCATGTAGTAAGGATTCAGGCT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TCTTAAGTACCAAGCCCTCCTTATGTTATGTTTACAGAGCATGTAGTAAGGATTCAGGCT 1020 Qy 1021 GGAAAATAACAGAAGCAGGAGGA 1043 ||||||||||||||||||||||| Db 1021 GGAAAATAACAGAAGCAGGAGGA 1043 ADM80672 standard; DNA; 2072 BP. Human USH3A gene coding sequence SeqID1. WO2003097685-A1. Query Match 75.8%; Score 1783.2; DB 10; Length 2072; Best Local Similarity 98.6%; Matches 2070; Conservative 2; Mismatches 0; Indels 28; Gaps 26; Qy 250 GAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGAAAATCATTT 309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGAAAATCATTT 60 Qy 310 TTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAGCCTTGGGGA 369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAGCCTTGGGGA 120 Qy 370 CACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGTCAATGCCT 429 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CACC-TTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGTCAATGCCT 179 Qy 430 CAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGG 489 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Db 180 CAGGGCAGGAGCTGG-CAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGG 238 Qy 490 GTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTCCAGATTTGC 549 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Db 239 GTGTGAGGCAGTGTGGGTTGGGAG-AAGGCCCTTTCGGTTCTCATTTTTTCCAGATTTGC 297 Qy 550 TCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTG 609 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 298 TCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTG 357 Qy 610 TGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGAAA 669 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 358 TGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTT-GAAAACCTTTTGAAA 416 Qy 670 CTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTC 729 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 417 CTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTC 476 Qy 730 TTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAA 789 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 477 TTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAA 536 Qy 790 ATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCT 849 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 537 ATTAT-AAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCT 595 Qy 850 GGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATACGACTTGCTG 909 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Db 596 GGGTCATTTTCTTTTG-TTTTTTGTTCATTTTCTGAATGGGCTCCTAATACGACTTGCTG 654 Qy 910 GATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAGCTGCAGATC 969 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Db 655 GATTTCAGTTCCCTTTTGCAAAATCT-AAGACGCAGAAACAACTAATGTAGCTGCAGATC 713 Qy 970 TAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCA 1029 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 714 TAATGTACTGAAAGGCAAACCTTTCTATAATTTTAC-AGGGAGTAGACTTGCTTTGGTCA 772 Qy 1030 CTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGAC 1089 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Db 773 CTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATA-TAAAGCATCAGGAC 831 Qy 1090 CCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGC 1149 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 832 CCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAA-GGAAGC 890 Qy 1150 AGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCA 1209 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 891 AGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCA 950 Qy 1210 AAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTG 1269 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 951 AAGGC-GTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTG 1009 Qy 1270 TGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATA 1329 |||||||||||||||||||||||||:|||||||||||||||||||||||||||||||||| Db 1010 TGTGTGTGTGTGTGTAAGATGTCTTYCTATCAAAAAGATATCAAAGGCACATGGAATATA 1069 Qy 1330 TTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAA 1389 ||||||||||||||||||||||:||| ||||||||||||||||||||||||||||||||| Db 1070 TTTTAATAAAAACAAATAATATYTCT-ATATATCCACACATTTGTTGCCAGATTTCAGAA 1128 Qy 1390 AACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGT 1449 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 1129 AACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGT-TTAAATGAACATCTATAAAATGT 1187 Qy 1450 ATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTC 1509 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Db 1188 ATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCC-GGCGTGGTGACTC 1246 Qy 1510 ACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGT 1569 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 1247 ACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCA-GAGT 1305 Qy 1570 TCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAA 1629 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1306 TCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAA 1365 Qy 1630 TAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAA 1689 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1366 TAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAA 1425 Qy 1690 ATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCC 1749 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1426 ATC--CAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCC 1483 Qy 1750 GTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCA 1809 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1484 GT-CCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCA 1542 Qy 1810 CTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGG 1869 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Db 1543 -TGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTA-G 1600 Qy 1870 GGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAA 1929 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1601 GGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATA-TAA 1659 Qy 1930 ATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCA 1989 |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 1660 ATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCAC--AGCA 1717 Qy 1990 TGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACT 2049 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 1718 TGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGC-GCTGACT 1776 Qy 2050 AAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAG 2109 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 1777 AAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGC-GTCCTCCAG 1835 Qy 2110 AAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAG 2169 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 1836 AAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGG-CTCTGACCACAG 1894 Qy 2170 GTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACA 2229 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 1895 GTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTAC-CCTTAAAATAAAACA 1953 Qy 2230 CTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTG 2289 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Db 1954 CTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTA-ACCTGAGAAATAACTTG 2012 Qy 2290 CTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2013 CTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2072 Sequence 6169, Patent No. 9061059 Query Match 99.9%; Score 2349; DB 23; Length 2359; Best Local Similarity 100.0%; Matches 2349; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGAAGGCAGTTTGAAAGACTTGTTTTACAGATTCTTAGTCCAAAGATTTCCAATTAGGGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 11 TGAAGGCAGTTTGAAAGACTTGTTTTACAGATTCTTAGTCCAAAGATTTCCAATTAGGGA 70 Qy 61 GAAGAAGCAGCAGAAAAGGAGAAAAGCCAAGTATGAGTGATGATGAGGCCTTCATCTACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 71 GAAGAAGCAGCAGAAAAGGAGAAAAGCCAAGTATGAGTGATGATGAGGCCTTCATCTACT 130 Qy 121 GACATTTAACCTGGCGAGAACCGTCGATGGTGAAGTTGCCTTTTCAGCTGGGAGCTGTCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 131 GACATTTAACCTGGCGAGAACCGTCGATGGTGAAGTTGCCTTTTCAGCTGGGAGCTGTCC 190 Qy 181 GTTCAGCTTCCGTAATAAATGCAGTCAAAGAGGCAGTCCCTTCCCATTGCTCACAAAGGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 191 GTTCAGCTTCCGTAATAAATGCAGTCAAAGAGGCAGTCCCTTCCCATTGCTCACAAAGGT 250 Qy 241 CTTGTTTTTGAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 251 CTTGTTTTTGAACCTCGCCCTCACAGAAGCCGTTTCTCATCATGCCAAGCCAACAGAAGA 310 Qy 301 AAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 311 AAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAG 370 Qy 361 CCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 371 CCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCG 430 Qy 421 TCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 431 TCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCC 490 Qy 481 ACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 491 ACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTC 550 Qy 541 CAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 551 CAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCA 610 Qy 601 TCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 611 TCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAAC 670 Qy 661 CTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 671 CTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCT 730 Qy 721 GTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 731 GTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAA 790 Qy 781 AAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 791 AAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCA 850 Qy 841 CCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 851 CCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATAC 910 Qy 901 GACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 911 GACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAG 970 Qy 961 CTGCAGATCTAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 971 CTGCAGATCTAATGTACTGAAAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTG 1030 Qy 1021 CTTTGGTCACTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1031 CTTTGGTCACTTTTAGATGTGGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAG 1090 Qy 1081 CATCAGGACCCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1091 CATCAGGACCCTTCGTGACAATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGT 1150 Qy 1141 AAGGGAAGCAGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1151 AAGGGAAGCAGAAGGAAGGCTTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCC 1210 Qy 1201 AGGTAGTCAAAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1211 AGGTAGTCAAAGGCAGTTGACTAGAATCGACAAATTGTTACTCCATATATATATATGTGT 1270 Qy 1261 GTGTGTGTGTGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1271 GTGTGTGTGTGTGTGTGTGTGTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACA 1330 Qy 1321 TGGAATATATTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1331 TGGAATATATTTTAATAAAAACAAATAATATCTCTAATATATCCACACATTTGTTGCCAG 1390 Qy 1381 ATTTCAGAAAACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1391 ATTTCAGAAAACTGAGCTGCAATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCT 1450 Qy 1441 ATAAAATGTATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1451 ATAAAATGTATCAACACACATTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCG 1510 Qy 1501 TGGTGACTCACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1511 TGGTGACTCACACCTGTAATTCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAG 1570 Qy 1561 TTCAGGAGTTCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1571 TTCAGGAGTTCGAGTTACAGCCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAA 1630 Qy 1621 AAAATAAAATAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1631 AAAATAAAATAAATATAAAATATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTG 1690 Qy 1681 TTGGTCAAAATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1691 TTGGTCAAAATCTGCAAACTCTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATT 1750 Qy 1741 TTTCCTCCCGTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1751 TTTCCTCCCGTGCCTGAGTCCCAATTACATTCACGACAGTACTTTCAATGAACATAATTG 1810 Qy 1801 TTAGGACCACTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1811 TTAGGACCACTGAGGAATCATGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGA 1870 Qy 1861 CTTATTAGGGGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1871 CTTATTAGGGGCTGTTTTTCTAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAA 1930 Qy 1921 TTATATTAAATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1931 TTATATTAAATCTGGGATTATGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGT 1990 Qy 1981 CACCAAGCATGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1991 CACCAAGCATGACCCAGGTCAACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTG 2050 Qy 2041 CAGCTGACTAAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2051 CAGCTGACTAAAGGCCACAGCTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCT 2110 Qy 2101 GTCCTCCAGAAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2111 GTCCTCCAGAAAGCACCAAGGAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTC 2170 Qy 2161 TGACCACAGGTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2171 TGACCACAGGTGCTGAGTACTCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAA 2230 Qy 2221 AATAAAACACTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2231 AATAAAACACTGTTTCCCTTTGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGA 2290 Qy 2281 AATAACTTGCTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTT 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2291 AATAACTTGCTCTGGTGTCAATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTT 2350 Qy 2341 CCAGATGCT 2349 ||||||||| Db 2351 CCAGATGCT 2359 Sequence 6169, Patent No. 9220755 Query Match 100.0%; Score 699; Length 2359; Best Local Similarity 100.0%; Matches 699; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 292 ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGT 351 Qy 61 GCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 352 GCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGC 411 Qy 121 AAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 412 AAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAA 471 Qy 181 ATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 472 ATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCC 531 Qy 241 TTTCGGTTCTCATTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 532 TTTCGGTTCTCATTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAAT 591 Qy 301 GTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 592 GTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATG 651 Qy 361 TACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 652 TACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTG 711 Qy 421 AGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 712 AGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAA 771 Qy 481 ATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 772 ATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACG 831 Qy 541 CAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 832 CAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTT 891 Qy 601 CTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 892 CTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGAC 951 Qy 661 GCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA 699 ||||||||||||||||||||||||||||||||||||||| Db 952 GCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA 990 Sequence 6169, US/14105224 Patent No. 9220755 Query Match 99.8%; Score 1369; Length 2359; Best Local Similarity 100.0%; Matches 1369; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCACTTTTAGATGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 991 AAGGCAAACCTTTCTATAATTTTACAAGGGAGTAGACTTGCTTTGGTCACTTTTAGATGT 1050 Qy 61 GGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGACCCTTCGTGACA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1051 GGTTAATTTTGCATATCCTTTTAGTCTGCATATATTAAAGCATCAGGACCCTTCGTGACA 1110 Qy 121 ATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGCAGAAGGAAGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1111 ATGTTTACAAATTACGTACTAAGGATACAGGCTGGAAAGTAAGGGAAGCAGAAGGAAGGC 1170 Qy 181 TTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCAAAGGCAGTTGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1171 TTTGAAAAGTTGTTTTATCTGGTGGGAAATTGCTTGACCCAGGTAGTCAAAGGCAGTTGA 1230 Qy 241 CTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTGTGTGTGTGTGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1231 CTAGAATCGACAAATTGTTACTCCATATATATATATGTGTGTGTGTGTGTGTGTGTGTGT 1290 Qy 301 GTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATATTTTAATAAAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1291 GTGTAAGATGTCTTCCTATCAAAAAGATATCAAAGGCACATGGAATATATTTTAATAAAA 1350 Qy 361 ACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAAAACTGAGCTGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1351 ACAAATAATATCTCTAATATATCCACACATTTGTTGCCAGATTTCAGAAAACTGAGCTGC 1410 Qy 421 AATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGTATCAACACACA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1411 AATCGCTTTCCTAAAACAGTAGTGTATTAAATGAACATCTATAAAATGTATCAACACACA 1470 Qy 481 TTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTCACACCTGTAAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1471 TTTTAAAAAATTTGTTTAAAGTATACTCTTAGGCCAGGCGTGGTGACTCACACCTGTAAT 1530 Qy 541 TCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGTTCGAGTTACAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1531 TCCAGCACTTCAGGAGGCCAAGGTGGGAAGATCATTTGAGTTCAGGAGTTCGAGTTACAG 1590 Qy 601 CCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAATAAATATAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1591 CCTGGGCAATAAAGTGAGACCCTGTCACTAACAAAATTAAAAAATAAAATAAATATAAAA 1650 Qy 661 TATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAAATCTGCAAACT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1651 TATAGGCTTTAAAAAAGCATAGTCTTATTAACCATGTCTGTTGGTCAAAATCTGCAAACT 1710 Qy 721 CTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCCGTGCCTGAGTC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1711 CTAAAAGAAGAAAAGAAGAAAAAACCAAGCTTAGGGTATTTTTCCTCCCGTGCCTGAGTC 1770 Qy 781 CCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCACTGAGGAATCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1771 CCAATTACATTCACGACAGTACTTTCAATGAACATAATTGTTAGGACCACTGAGGAATCA 1830 Qy 841 TGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGGGGCTGTTTTTC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1831 TGAAAAATGATCTCTGCTTAGTACATTTGATGCAAAATGACTTATTAGGGGCTGTTTTTC 1890 Qy 901 TAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAAATCTGGGATTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1891 TAGCTATAGTGTCTCGAGTACTAATATGCAATTATGAAAATTATATTAAATCTGGGATTA 1950 Qy 961 TGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCATGACCCAGGTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1951 TGACGGTATCACTGTATCATCTTGGTCTTGTTCTGGCTGTCACCAAGCATGACCCAGGTC 2010 Qy 1021 AACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACTAAAGGCCACAG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2011 AACTTTTTTTTTCCCCTGAATTACCCATCAAATTGATCTGCAGCTGACTAAAGGCCACAG 2070 Qy 1081 CTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAGAAAGCACCAAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2071 CTGAGCCTGGAACTGACCCTTCCTTCATCCTCAACCTGCTGTCCTCCAGAAAGCACCAAG 2130 Qy 1141 GAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAGGTGCTGAGTAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2131 GAAAAAGCAGAGAATGACAGCAAACAGATCACTAGGCCTCTGACCACAGGTGCTGAGTAC 2190 Qy 1201 TCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACACTGTTTCCCTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2191 TCAGCAGCCCTCATATAATAGGTTTGAAAGTACTCCTTAAAATAAAACACTGTTTCCCTT 2250 Qy 1261 TGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTGCTCTGGTGTCA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2251 TGGAACTATTTACAAGGATGAAACAACCGTATACCTGAGAAATAACTTGCTCTGGTGTCA 2310 Qy 1321 ATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 1369 ||||||||||||||||||||||||||||||||||||||||||||||||| Db 2311 ATTCGCTATTCGCCAGCAGACATCAGAACACACCGAGTTTCCAGATGCT 2359
Read full office action

Prosecution Timeline

Nov 22, 2023
Application Filed
Feb 08, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454689
INTEGRATION OF MESA RECEPTORS AND PROMOTORS TO IMPLEMENT CUSTOMIZED CELLULAR FUNCTION
2y 5m to grant Granted Oct 28, 2025
Patent 12454702
MINIGENE THERAPY
2y 5m to grant Granted Oct 28, 2025
Patent 12448426
CHIMERIC ANTIGEN RECEPTORS WITH MYD88 AND CD40 COSTIMULATORY DOMAINS
2y 5m to grant Granted Oct 21, 2025
Patent 12385048
CONSTRUCT AND SEQUENCE FOR ENHANCED GENE EXPRESSION
2y 5m to grant Granted Aug 12, 2025
Patent 12371474
RECOMBINANT ADENO-ASSOCIATED VIRAL VECTORS FOR TREATING BIETTI CRYSTALLINE DYSTROPHY
2y 5m to grant Granted Jul 29, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.7%)
3y 11m
Median Time to Grant
Low
PTA Risk
Based on 734 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month