Prosecution Insights
Last updated: July 17, 2026
Application No. 18/542,950

METHODS AND COMPOSITIONS FOR TREATING AN ANGIOTENSINOGEN- (AGT-) ASSOCIATED DISORDER

Non-Final OA §103§112§DP
Filed
Dec 18, 2023
Priority
Jun 30, 2021 — provisional 63/216,758 +2 more
Examiner
GIBBS, TERRA C
Art Unit
Tech Center
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
1 (Non-Final)
64%
Grant Probability
Moderate
1-2
OA Rounds
1m
Est. Remaining
74%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
611 granted / 957 resolved
+3.8% vs TC avg
Moderate +10% lift
Without
With
+10.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
36 currently pending
Career history
995
Total Applications
across all art units

Statute-Specific Performance

§101
6.2%
-33.8% vs TC avg
§103
51.2%
+11.2% vs TC avg
§102
9.1%
-30.9% vs TC avg
§112
15.4%
-24.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 957 resolved cases

Office Action

§103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION This Office Action is a response to Applicant’s Preliminary Amendment filed March 15, 2024. Claims 2-24, 26-27, 29-32, 34-36, 38, 40-42, 46-51, 53-78, 80-83, 92-93, 96, 98-100, 103-106, 108-112, and 117-122 have been cancelled. Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84, 86, 90-91, 94-95, 97, 101, 107, 113-115, and 123 have been amended. Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107, 113-116, and 123 are pending in the application. Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107, 113-116, and 123 have been examined on the merits as detailed below: Information Disclosure Statement It is noted that Applicants have not filed an information disclosure statement under § 1.97(c). Applicant is reminded of 37 CFR § 1.56, which details Applicants duty to disclose all information known to be material to patentability. Drawings The Drawings filed on December 18, 2023 are acknowledged and have been accepted by the Examiner. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 123 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. The claim is indefinite because it is unclear whether parts following the term, “optionally” in claim 123 are actually a part of the claims. The term, “optionally” is ambiguous and confusing since the alternatives covered by the claims are not clear. See MPEP 2173.05(h) for further explanation. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 103 This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4.Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107, 113-116, and 123 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2021/096763 A1 (ALNYLAM PHARMACEUTICALS, INC.). The claims are drawn to a method selected from the group consisting of: (i) a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject, the method comprising administering to the subject a fixed dose of about 150 mg every six months, about 300 mg every six months, about 300 mg every three months, about 600 mg every six months, about 800 mg every three months, or about 800 mg every six months of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9, and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO: 10; wherein the double-stranded RNAi agent, or salt thereof, comprises at least one modified nucleotide; and wherein at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification, thereby inhibiting the expression of the AGT gene in the subject; (ii) a method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, the method comprising administering to the subject a fixed dose of about 150 mg every six months, about 300 mg every six months, about 300 mg every 3 months, about 600 mg every six months, about 800 mg every 3 months, or about 800 mg every six months of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9, and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQID NO: 10;wherein the double-stranded RNAi agent, or salt thereof, comprises at least one modified nucleotide; and wherein at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification, thereby treating the subject that would benefit from reduction in AGT expression; (iii) a method for treating a subject having an angiotensinogen (AGT) associated disorder, the method comprising administering to the subject a fixed dose of about 150 mg every six months, about 300 mg every six months, about 300 mg every 3 months, about 600 mg every six months, about 800 mg every 3 months, or about 800 mg every six months of a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9, and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO: 10; wherein the double-stranded RNAi agent, or salt thereof, comprises at least one modified nucleotide; wherein at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification, thereby treating the subject having the AGT associated disorder; and (iv) a method for decreasing blood pressure level in a subject, the method comprising administering to the subject a fixed dose of about 150 mg every six months, about 300 mg every six months, about 300 mg every 3 months, about 600 mg every six months, about 800 mg every 3 months, or about 800 mg every six months of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9, and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO: 10; wherein the double-stranded RNAi agent, or salt thereof, comprises at least one modified nucleotide; wherein at least one of the modifications on the nucleotides is a thermally destabilizing nucleotide modification, thereby decreasing the blood pressure level in the subject. The claims are also drawn to a method for treating a subject having mild-to-moderate hypertension, the method comprising administering to the subject a fixed dose of about 150 mg every six months, about 300 mg every six months, about 300 mg every 3 months, about 600 mg every six months, about 800 mg every 3 months, or about 800 mg every six months of a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12) of SEQ ID NO: 12; wherein a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'- fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine- 3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, thereby treating the subject having mild- to-moderate hypertension, or a kit therein comprising a) the RNAi agent, or salt thereof, and b) instructions for use, and c) optionally, means for administering the RNAi agent, or salt thereof, to the subject. ALNYLAM PHARMACEUTICALS teach a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject; a method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression; a method for treating a subject having an angiotensinogen (AGT) associated disorder; and a method for decreasing blood pressure level in a subject – the methods comprising administering a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9, and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO: 10. See claims 1-4, for example. ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. ALNYLAM PHARMACEUTICALS also teach a method for treating a subject having mild-to-moderate hypertension, the method comprising administering a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12) of SEQ ID NO: 12; wherein a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'- fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine- 3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, thereby treating the subject having mild- to-moderate hypertension. comprising a) the RNAi agent, or salt thereof, and b) instructions for use, and c) optionally, means for administering the RNAi agent, or salt thereof, to the subject. See claims 46, 47 and 81, for example. ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. See claims 81 and 87, for example. ALNYLAM PHARMACEUTICALS also teach their invention provides a kit for performing the methods of the invention. The kit comprises a) the RNAi agent, and b) instructions for use, and c) optionally, means for administering the RNAi agent to the subject. See claim 97, for example. Additionally, ALNYLAM PHARMACEUTICALS teach the double-stranded RNAi agents of their invention further comprise a ligand, including GalNAc derivatives. ALNYLAM PHARMACEUTICALS further teach the subjects of their invention are also administered antihypertensive agents, including ACE inhibitors. Regarding those claims that recite dosing schedules of the double-stranded RNAi agents of the invention or dosing schedules of the antihypertensive agents, Applicant is reminded where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See In re Aller, 105 USPQ 233. See also MPEP 2144.05. ALNYLAM PHARMACEUTICALS teach that those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the claimed invention. ALNYLAM PHARMACEUTICALS teach and suggest the full breadth of the inventions disclosed and claimed in the present application. Before the effective filing date of the claimed invention, the use of a double stranded ribonucleic acid (RNAi) agents, or salts thereof, in methods of inhibiting the expression of an angiotensinogen (AGT) gene, for treating a subject having an AGT associated disorder, and/or for decreasing blood pressure in a subject, by administering to the subject a fixed dose of about 150 mg every six months was taught and suggested by the prior art of ALNYLAM PHARMACEUTICALS. Before the effective filing date of the claimed invention, the use of a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) of SEQ ID NO: 11, and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12) of SEQ ID NO: 12; wherein a is 2'-O-methyladenosine-3'-phosphate, c is 2'-O-methylcytidine-3'-phosphate, g is 2'-O-methylguanosine-3'-phosphate, u is 2'-O-methyluridine-3'-phosphate, Af is 2'- fluoroadenosine-3'-phosphate, Cf is 2'-fluorocytidine-3'-phosphate, Gf is 2'-fluoroguanosine- 3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, (Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer, and s is a phosphorothioate linkage, thereby treating the subject having mild- to-moderate hypertension. comprising a) the RNAi agent, or salt thereof by administering to a subject a fixed dose of about 150 mg every six months was also taught and suggested by the prior art of ALNYLAM PHARMACEUTICALS. Provided with the teachings and suggestions of ALNYLAM PHARMACEUTICALS, a person of ordinary skill in the art would have been motivated to make and use the methods of the presently claimed invention and with a reasonable expectation of success. Therefore, the subject matter of claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107, 113-116, and 123 is obvious over ALNYLAM PHARMACEUTICALS. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107 and 113-116 in the instant application are provisionally rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1-5, 8, 18, 45, 70-75, 80, 81, 87, 91 and 98-104 of co-pending US application 17743498 (reference application) in view of WO 2021/096763 A1 (ALNYLAM PHARMACEUTICALS, INC). Claim 123 in the instant application is provisionally rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1, 3 and 5 of co-pending US application 18473829 (reference application) in view of WO 2021/096763 A1 (ALNYLAM PHARMACEUTICALS, INC.). Claims 1, 25, 28, 33, 37, 39, 43-45, 52, 79, 84-91, 94-95, 97, 101-102, 107 and 113-116 in the instant application are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1-65 of US Patent No. 11834661 in view of WO 2021/096763 A1 (ALNYLAM PHARMACEUTICALS, INC). Claim 123 in the instant application is rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1-15 of US Patent No. 11015201 in view of WO 2021/096763 A1 (ALNYLAM PHARMACEUTICALS, INC). Although the conflicting claims are not identical, they are not patentably distinct from each other because of the following reasons: The claims of the instant application and co-pending application 17743498 in view of ALNYLAM PHARMACEUTICALS are drawn to overlapping subject matter. Furthermore, ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. ALNYLAM PHARMACEUTICALS teach that those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the claimed invention. It would have been prima facie obvious to modify the teachings of U.S. Application 17743498 to include the dosing amounts and schedule of ALNYLAM PHARMACEUTICALS using nothing more than routine experimentation and optimization. Applicant is reminded where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See In re Aller, 105 USPQ 233. See also MPEP 2144.05. The claims of copending U.S. Application 17743498 in view of ALNYLAM PHARMACEUTICALS overlaps in scope and fully embraces that which is claimed in the instant invention. The limitations and structural requirements of the instant claims are provided in the supporting disclosure of the co-pending application as certain preferred embodiments. This is provisional obviousness-type double patenting rejection because the conflicting claims have not been patented yet. The claim of the instant application and co-pending application 18473829 are drawn to overlapping subject matter. Furthermore, ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. ALNYLAM PHARMACEUTICALS teach that those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the claimed invention. It would have been prima facie obvious to modify the teachings of U.S. Application 18473829 to include the dosing amounts and schedule of ALNYLAM PHARMACEUTICALS using nothing more than routine experimentation and optimization. Applicant is reminded where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See In re Aller, 105 USPQ 233. See also MPEP 2144.05. The claims of copending U.S. Application 18473829 in view of ALNYLAM PHARMACEUTICALS overlaps in scope and fully embraces that which is claimed in the instant invention. The limitations and structural requirements of the instant claims are provided in the supporting disclosure of the co-pending application as certain preferred embodiments. This is provisional obviousness-type double patenting rejection because the conflicting claims have not been patented yet. The claims of the instant application and US Patent No. 11834661 in view of ALNYLAM PHARMACEUTICALS are drawn to overlapping subject matter. Furthermore, ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. ALNYLAM PHARMACEUTICALS teach that those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the claimed invention. It would have been prima facie obvious to modify the teachings of U.S. Patent No. 11834661 to include the dosing amounts and schedule of ALNYLAM PHARMACEUTICALS using nothing more than routine experimentation and optimization. Applicant is reminded where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See In re Aller, 105 USPQ 233. See also MPEP 2144.05. The instant claims overlap in scope, embrace and encompass the claims of U.S. Patent No. 11834661 in view of ALNYLAM PHARMACEUTICALS. Furthermore, the limitations and structural requirements of the instant claims are provided in the supporting disclosure of the issued Patent as certain preferred embodiments. A terminal disclaimer disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of U.S. Patent No. 11834661 is required or some other appropriate action. The claim of the instant application and US Patent No. 11015201 in view of ALNYLAM PHARMACEUTICALS are drawn to overlapping subject matter. Furthermore, ALNYLAM PHARMACEUTICALS refer to administration of a fixed dose of 100 mg or 200 mg, respectively, once every six months. See claims 7, 11, 12, 51, 55 and 56, for example. The value of 150 mg about once every six months as recited in the present claims can be extrapolated as an obvious variation/embodiment from the subject matter of claims 7, 11, 12, 51, 55, 56 of ALNYLAM PHARMACEUTICALS. That is, the same therapeutic effect is claimed with the dosage of 100 mg and 200 mg, the same therapeutic effect is to be achieved also with a dosage exactly in between these two values. ALNYLAM PHARMACEUTICALS teach that those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the claimed invention. It would have been prima facie obvious to modify the teachings of U.S. Patent No. 11015201 to include the dosing amounts and schedule of ALNYLAM PHARMACEUTICALS using nothing more than routine experimentation and optimization. Applicant is reminded where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. See In re Aller, 105 USPQ 233. See also MPEP 2144.05. The instant claim overlaps in scope, embraces and encompasses the claims of U.S. Patent No. 11015201 in view of ALNYLAM PHARMACEUTICALS. Furthermore, the limitations and structural requirements of the instant claims are provided in the supporting disclosure of the issued Patent as certain preferred embodiments. A terminal disclaimer disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of U.S. Patent No. 11015201 is required or some other appropriate action. Conclusion No claims are allowable at this time. Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Terra C. Gibbs whose telephone number is 571-272-0758. The Examiner can normally be reached from 8 am - 5 pm M-F. If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Ram Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO's Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO's Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO's PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. /TERRA C GIBBS/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Dec 18, 2023
Application Filed
Jun 09, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12674163
COMB SHAPED ANTIVIRALS ENDING WITH OR WITHOUT CHAIN TERMINATING BASES
3y 4m to grant Granted Jul 07, 2026
Patent 12674164
CONDITIONAL-SIRNAS AND USES THEREOF IN TREATING ACUTE MYELOID LEUKEMIA
3y 3m to grant Granted Jul 07, 2026
Patent 12674169
COMPOSITIONS AND METHODS FOR MODULATING SCAP ACTIVITY
3y 2m to grant Granted Jul 07, 2026
Patent 12662671
CONSTRUCTS AND METHODS FOR PREPARING CIRCULAR RNA
2y 3m to grant Granted Jun 23, 2026
Patent 12655428
RNAi Agents for Inhibiting Expression of Beta-ENaC, Compositions Thereof, and Methods of Use
4y 1m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
64%
Grant Probability
74%
With Interview (+10.5%)
2y 8m (~1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 957 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month