Prosecution Insights
Last updated: July 17, 2026
Application No. 18/547,102

FOLLICULIN iRNA COMPOSITIONS AND METHODS THEREOF

Non-Final OA §101§102§103§112§DP
Filed
Aug 18, 2023
Priority
Feb 22, 2021 — provisional 63/152,143 +1 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
11m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
112 granted / 191 resolved
-1.4% vs TC avg
Strong +65% interview lift
Without
With
+65.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
67 currently pending
Career history
247
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
45.6%
+5.6% vs TC avg
§102
4.1%
-35.9% vs TC avg
§112
10.9%
-29.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 191 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status and Election Claims 2-3, 7-8, 11, 13, 23-24, 29, 82-85, 90-92, 96, 101, 114 and 125 are pending. Applicant’s election without traverse of group 1, encompassing claims directed to dsRNA agents and compositions comprising them, in the reply filed May 1, 2026 is acknowledged. Claims 90-92, 96, 101, 114 and 125 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Claims 2-3, 7-8, 11, 13, 23-24, 29 and 82-85 are under examination. Specification The disclosure is objected to because it contains two embedded hyperlinks and/or other form of browser-executable code on page 23. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms Lipofectamine®, Opti-MEM®, DYNABEADS®, LightCycler®, and HiTrap®, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 83 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 83 recites “A vector encoding at least one strand of the dsRNA agent of claim 2”. 35 CFR 1.75 states “One or more claims may be presented in dependent form, referring back to and further limiting another claim or claims in the same application.” Because claim 83 refers back claim 2, it is a dependent claim of claim 2. Claim 2 recites a dsRNA, i.e., an RNA molecule with two strands. Claim 83 appears to only require a single strand. Additionally, the vector needs to merely “encode” a strand of the dsRNA. The Specification describes “vectors” as being DNA or RNA vectors. As such, claim 83 doesn’t appear to even require the vector molecule to RNA. Therefore, claim 83 fails to include all the limitations of the claim from which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2-3, 7-8, 11, 13, 23-24, 29 and 82-85 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 2, 7, 8 and 29 reference Tables 2, 3, 4, 5, 6, 7, 8, or 9, either partially, i.e., “an antisense sequence listed in” the tables, or entirely, i.e., “an agent listed in” the tables Reference to tables in claims renders the claim indefinite when there is no practical way to define the invention in words. See MPEP 2173.05(s). Here, the tables contain exclusively text, and the appropriate text could simply be imported into the claim. Merely pasting the text into the claims, however, may not overcome this rejection. First, at least for claim 29, it is not clear what “agent” is referring to in each of the tables. Additionally, for the references to an “antisense sequence” it is not clear if the dsRNA strand should have the antisense sequence of merely be antisense to one of the sequences in the tables. To overcome this rejection, applicants must amend the claims to remove all references to tables. Additionally, since it appears that all references to sequences in the tables have SEQ ID NOs, it is recommended to use the SEQ ID NOs to claim the structure of the dsRNA sense and antisense strands. Claims 3, 11, 13, 23-24, and 82-85 are rejected for depending from claims 2 or 7 and not remedying the indefiniteness. Claim 29 also recites “The dsRNA agent of claim 2, wherein (a) the region of complementarity comprises any on of the antisense sequence in Table 2…” Table 2 includes a dsRNA agent named AD-1528061 with antisense sequence ACCAUCUGGACCAAGGUAUCCUC. Table 2 indicates that it targets nucleotides 1322-1344 (i.e., 23 nucleotides) of NM_144997.7, which is the mRNA sequence of FLCN transcript variant 1. However, an alignment of the reverse complement of NM_144997.7 and the antisense sequence of AD-1528061 is below. It appears as though the first nucleotide of the antisense strand is not complementary to the target sequence. As such, it is not clear what proportion of the antisense strand of the dsRNA agent must be in the region of complementarity. AD-1528061 antisense 1 ACCATCTGGACCAAGGTATCCTC 23 NM_144997.7 (rvs comp) 1344 TCCATCTGGACCAAGGTATCCTC 1322 Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 83 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. Claim 83 is drawn to a vector, which is a natural product. However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below. Subject Matter Eligibility Test for Products and Processes Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES. Claim 83 is directed to a vector, which is a product (i.e., a statutory category). Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES. Judicial Exceptions have been identified by the courts by way of example, including natural products. The claims recite a vector that encodes at least one strand of a dsRNA, which is a natural product. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). The courts have identified “isolated DNA” as one such natural product that may not be markedly different from their counterpart, DNA in cells. MPEP 2106.04(c) outlines the markedly different analysis. The claim recites a vector encoding at least one strand of the dsRNA agent. The Specification explains that a vector can be a DNA vector (page 142). The Specification indicates that each of the sense strands in Table 2 are identical to the FLCN mRNA. Thus, a DNA vector “encoding” the sense strand of the FLCN mRNA is identical to the DNA coding strand of FLCN gene. The closest naturally occurring counterpart to the claimed vector is the human FLCN chromosomal locus, specifically an exonic region. The claimed isolated nucleic acid is not markedly different than its naturally occurring counterpart and constitutes a judicial exception. Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO. The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, no additional element is recited in the claim, and therefore the judicial exception is not integrated into a practical application. Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO. The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, no additional elements are recited in the claim, and therefore the claim does not amount to something significantly more than the judicial exception. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 2, 13, 29, and 82-85 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Adanve (US 20230272401 A1, priority to June 11, 2020) as evidenced by Genbank (NM_144997.7, Homo sapiens folliculin (FLCN), transcript variant 1, mRNA, version available December 31, 2019). Adanve claims priority to Provisional application No. 63/037881, filed June 11, 2020. Each of the point citations from the ‘401 Pre-grant publication in the rejection below are fully supported in the provisional application. Regarding claim 2, Adanve teaches siRNAs are double stranded RNA (dsRNA) interfering oligonucleotides that comprise a sense and antisense strand that are 19-29 nucleotides in length and have perfect base pairing to their target mRNA ([0103]). Adanve teaches an siRNA agent “GI16” with sequence TCTGGACCAAGGTATCCTC (i.e., an antisense strand) (Table 1), which comprises 19 contiguous nucleotides (i.e., at least 15) that are 100% identical (i.e., differing by no more than 3 nucleotides) to the antisense sequence of agent AD-1528061 in Table 2 (last sequence of page 198) as shown below. Adanve teaches the GI16 siRNA is complementary to Exon 9 of the FLCN gene (i.e., complementary to an mRNA encoding FLCN) (Table 10). Genbank teaches the sequence of FLCN mRNA, which provides evidence that Adanve’s GI16 siRNA comprises a region of complementarity to the FLCN mRNA. AD-1528061 antisense sequence: ACCAUCUGGACCAAGGUAUCCUC Adanve GI16 antisense siRNA strand: UCUGGACCAAGGUAUCCUC NM_144997.7 (reverse complement): TCCAUCUGGACCAAGGUAUCCUC Regarding claim 13, Adanve teaches the siRNAs are 100% complementary ([0103]) and GI16 is 19 nucleotides in length (Table 10). Regarding claim 29, the claim is indefinite for the reasons recited above in paragraph 16. For the purpose of compact prosecution, claim 29, part (a) is interpreted as the region of complementarity comprises a sequence contained within any portion of the antisense sequences of the recited tables. As described above for claim 2, the GI16 siRNA agent of Adanve comprises a region of complementarity to the FLCN mRNA that comprises 19 of the 22 nucleotides of the antisense strand of AD-1528061 that is also complementary to the FLCN mRNA. Regarding claim 82, Adanve teaches delivering the GI16 siRNA dsRNA agent to cells ([0294]). Regarding claim 83, Adanve teaches siRNA agents can be introduced via viral vectors that transcribes the RNAi agents ([0103]). Regarding claim 84-85, Adanve teaches the siRNAs delivered as a pharmaceutical composition in Lipofectamine (i.e., an unbuffered or buffered solution) with other siRNAs to cells for inhibiting expression of FLCN ([0294]-[0295]). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 3, 7-8, 11 and 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Adanve (US 20230272401 A1, priority to June 11, 2020) as evidenced by Genbank (NM_144997.7, Homo sapiens folliculin (FLCN), transcript variant 1, mRNA, version available December 31, 2019) as applied to claims 2, 13, 29, and 82-85 above, and further in view of Nair (Nair et al., Nucleic Acids Research (2017), 45: 10969-10977) and Paquette (Paquette et al., "FLCN Gene Ablation Reduces Fibrosis and Inflammation in a Diet-Induced NASH Model." bioRxiv (2020): 2020-09). The teachings of Adanve and Genbank are recited above as for claims 2, 13, 29, and 82-85, and are incorporated here. Adanve also teaches additional RNAi agents that are antisense oligonucleotides comprising 2’-MOE modifications ([0289], Table 7). Adanve teaches siRNAs have been modified by including 2’-OMe modified nucleotides ([0013]). Adanve teaches RNAi agents can be conjugated to GalNAc residues which increases cellular uptake ([0012], [0143]). Adanve does not teach in a single embodiment, the siRNA having sequence GI16 (i.e., at least 15 nucleotides of AD-1528061 in Table 2) conjugated to a GalNAc ligand and/or having all or substantially all modified nucleotides. Nair teaches attaching a triantennary GalNAc ligand to chemically modified siRNAs has enabled targeted deliver to the liver (page 10969, ¶1). Nair teaches chemical modifications in the sugar-phosphate backbone, such as 2’-F and 2’-OMe sugar modifications and phosphorothioate linkages, stabilize siRNA-conjugates against nucleases (page 10970, ¶1). Nair teaches an siRNA in which all of the nucleotides of both the sense (S) and antisense (AS) strand are modified with either 2’-F or 2’-OMe groups, and in which a trivalent GalNAc ligand is conjugated to the 3’ end of the sense strand (Table 1). Nair teaches the siRNAs were successful at knocking down expression of the targeted mRNA by ~ 80% (Figure 1). Paquette teaches non-alcoholic steatohepatitis (NASH) is characterized by hepatocellular injury, immune cell-mediated inflammation, and progressive liver fibrosis (page 2, ¶2). Paquette teaches the accumulation of lipid intermediates within hepatocytes causes lipotoxicity, cellular stress, and eventually cell death. Paquette teaches knocking out FLCN specifically in liver protects mice from triglyceride accumulation, liver damage (page 5, ¶1), and liver fibrosis and inflammation (page 7, last ¶ through page 8, ¶1). Paquette suggests pharmaceutical intervention to achieve loss-of-function of FLCN for treating obesity and NASH. Regarding claims 3, 7-8, 11 and 23-24, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have modified Adanve’s GI16 siRNA agent by fully modifying each of the nucleotides and attaching a GalNAc ligand to the 3’ end of the sense strand according to Nair. It would have amounted to the simple combination of known prior art elements by known means to yield predictable results. The skilled artisan would have predicted that Nair’s siRNA modification pattern could be used to modify Adanve’s GI16 siRNA because 1) Adanve teaches RNAi agents can be modified at least with 2’-OMe and can be conjugated to GalNAc ligands and 2) Nair teaches highly modified siRNAs with 3’-conjugated ligands have already been widely used in the art. The skilled artisan would have been motivated to modify the GI16 siRNA with Nair’s modification pattern for the purpose of targeting the siRNA to the liver and decreasing FCLN expression to treat NASH as suggested by Paquette. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim 2-3, 11, 13, 23, 29, 82 and 84 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 9, 11-13, 15, 21, 23-25, 27-28, 31-34, 37-38 and 88 of copending Application No. 18631104 in view of Adanve (US 20230272401 A1, priority to June 11, 2020). Copending claim 1 recites A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of a target gene, comprising an antisense strand which is complementary to the target gene; a sense strand which is complementary to the antisense strand and forms a double stranded region with the antisense strand; and one or more C22 hydrocarbon chains conjugated to one or more internal positions on at least one strand (i.e., the dsRNA comprises one or more modified nucleotides). Copending claim 34 recites the dsRNA agent targets FLCN. Copending claim 37 recites A cell containing the dsRNA agent of claim 1. Copending claim 38 recites A pharmaceutical composition for inhibiting expression of the target gene, comprising the dsRNA agent of claim 1. Copending claim 88 recites a modified nucleotide in which a C22 alkyl group is attached to the 2’ carbon (i.e., the modified nucleotides is a 2’-O-alkyl-modified nucleotide). The copending claims do not recite specific sequences of or targeting sequence for the dsRNA. The teachings of Adanve are recited above in paragraphs 26-31 and 35 and are incorporated here. Briefly, Adanve teaches a “GI16” siRNA having 19 nucleotides of the AD-1528061 siRNA agent of table 2. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically used the sequence of Adanve’s GI16 siRNA for the copending dsRNA C-22 conjugated agent. It would have amounted to using a known siRNA targeting sequence by known means to yield predictable results. The skilled artisan would have predicted Adanve’s GI16 sequence could be used in the C-22 siRNA agent because Adanve teaches siRNAs can have other 2’-O modifications. The skilled artisan would have been motivated to use Adanve’s siRNA sequence because Adanve demonstrates it effectiveness at targeting FLCN mRNA for reduced expression. This is a provisional nonstatutory double patenting rejection. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Aug 18, 2023
Application Filed
May 18, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Patent 12673117
AAV-IDS VECTORS FOR TREATMENT OF MUCOPOLYSACCHARIDOSIS II
2y 9m to grant Granted Jul 07, 2026
Patent 12662663
USE OF A DEFICIENT FUSION PROTEIN FOR NUCLEASE ACTIVITY SO AS TO INDUCE MEIOTIC RECOMBINATIONS
3y 7m to grant Granted Jun 23, 2026
Patent 12630815
ARTIFICIAL GENE AND METHOD FOR MUTATING GENE
4y 3m to grant Granted May 19, 2026
Patent 12622931
COMPOSITIONS AND METHODS FOR TREATING ALPHA-1 ANTITRYPSIN DEFICIENCY
4y 9m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+65.0%)
3y 10m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 191 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month