Prosecution Insights
Last updated: October 02, 2026
Application No. 18/571,924

THERAPEUTIC NUCLEIC ACIDS AND METHODS OF USE THEREOF

Non-Final OA §101§102§103§112§DP
Filed
Dec 19, 2023
Priority
Jul 01, 2021 — provisional 63/202,970 +1 more
Examiner
BRETZ, COREY LANE
Art Unit
Tech Center
Assignee
Cedars-Sinai Medical Center
OA Round
1 (Non-Final)
0%
Grant Probability
At Risk
1-2
OA Rounds
0m
Est. Remaining
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 3 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
53 currently pending
Career history
36
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
29.9%
-10.1% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
18.6%
-21.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 3 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows: while the provisional application no. 63202970 filed 07/01/2021 provides support for instant claims 2-11, 23-25, 36, 39, 44, 48, 57, and 76, it does not provide support for instant claim 88 (a method of treating a condition associated with inflammation and/or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of a nucleic acid that specifically binds Translocated Promoter Region (TPR), thereby treating the condition associated with inflammation and/or fibrosis). Therefore, claims 2-11, 23-25, 36, 39, 44, 48, 57, and 76 are considered to have an effective filing date of 07/01/2021, while claim 88 is considered to have an effective filing date of 06/30/2022 corresponding to application no. PCT/US2022/035866. Status of Claims Claims 2-11, 23-25, 36, 39, 44, 48, 57, 76, and 88 are pending and are under examination in this Office Action. Claim Rejections - 35 USC § 101 Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 36 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 36 recites a macrophage comprising the nucleic acid of claim 2, wherein an anti-inflammatory activity of the macrophage is increased compared to a macrophage without the nucleic acid. The specification discloses that “the macrophage is in a subject, e.g., in peripheral blood, bone marrow, and/or at a site of tissue injury,” and “the macrophage is a human macrophage,” see [0011][0018][0137]. Furthermore, the specification defines “subject” as “a human subject,” see [0164]. Therefore, when the macrophage of claim 36 is present in vivo, it reads on a human organism, which is excluded from the scope of patentable subject matter under 35 U.S.C. 101 and section 33(a) of the America Invents Act. Applicant is advised to amend such that the claim recites “an isolated macrophage.” Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 88 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Adequate written description support for a claimed genus may be provided by describing sufficient identifying characteristics, describing a representative number of species, actual reduction to practice, disclosure of drawings or structural chemical formulas, complete or partial structure, physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure and any working examples, method of making the claimed invention, level of skill and knowledge in the art as well as predictability in the art are other determinants that are used to analyze whether applicants had possession of the claimed genus. The present specification fails to meet these requirements for several reasons. Claim 88 recites a method of treating a condition associated with inflammation and/or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of a nucleic acid that specifically binds Translocated Promoter Region (TPR), thereby treating the condition associated with inflammation and/or fibrosis. As written, applicant is claiming that any nucleic acid that binds to TPR treats any subject with any condition associated with any inflammation and/or any fibrosis. This is incredibly broad and applicant does not provide a representative number of species to support the breadth of the claim. The claim does not require the nucleic acid to have any effect on TRP, just that it binds, and the applicant has provided zero examples of such a nucleic acids that merely binds and has no antagonist or agonist effect on TRP, much less merely binding and being able to treat any condition associated with any inflammation and/or any fibrosis. The applicant does however provide examples of TY4 (a Y-RNA fragment) and siRNA binding to and inhibiting TRP. The applicant reports “animals treated with siRNA against TPR had significantly smaller infarct mass compared to animals treated with scramble siRNA (FIG. 46B),” and that “these results show that TPR knockdown alone is cardioprotective in a rat model of myocardial infarction.,” see [0344-0347]. Thus, based on the applicant’s own reported results and the lack of a representative number of species to demonstrate possession of the claimed genus, an artisan practicing the disclosure would not be able to visualize how a nucleic acid that merely binds to or binds to and serves as an agonist would recapitulate the therapeutic result of treating any subject with any condition associated with any inflammation and/or any fibrosis. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – Claim 2 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Spindler S. et al., (US20160024575A1). Regarding claim 2, Spindler teaches a 24-mer with SEQ ID NO: 24880, which is an isolated nucleic acid derived from the 5’end of Y-RNA, and comprises a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12 if the instant case), wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long. See alignment provided below: PNG media_image1.png 335 822 media_image1.png Greyscale Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 2 and 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Spindler S. et al., (US20160024575A1) as applied to claim 2 above, and further in view of Cambier L, et al., (EMBO Mol Med.;9(3):337-352, published 2017) and Bleicher K. et al., (US 20200332289 A1). As stated above in the 102 rejection, Spindler teaches SEQ ID NO: 24880, which is 95.8% identical to SEQ ID NO: 12, the only difference being the first guanine (G) in SEQ ID NO: 24880 is substituted with a cytosine (C). Thus, instant SEQ ID NO:12 has a one base change from the native 5’-derived 24 base Y-RNA fragment represented by Spindler’s SEQ ID NO: 24880. Regarding claims 23-24, Spindler teaches “polynucleotides (e.g., small RNA molecules) that each corresponds to a section of a YRNA having the polynucleotide sequence of the first 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides starting from the 5′ end of the YRNA sequence, or a complement thereof,” see [0013]. Spindler further teaches apoptosis induced circulating small YRNA fragments of 22-25 nt, Spindler further teaches Table 5, which provides a list of these YRNAs, see [0013]. Spindler further teaches polynucleotide sequences that are complementary to the YRNA sequences,” see [0013]. Spindler does not teach the first G being substituted with a C to arrive at SEQ ID NO: 12, nor does Spindler teach LNA modifications at positions 1, 3, 5, 20, 22, and 24 to arrive at SEQ ID NO: 2. Cambier teaches the abundance of “small RNA species in cardiosphere‐derived cells extracellular vesicles (CDC‐EVs)…following 5 days of serum‐free culture,” see FIG. 1 and 1A. Cambier further teaches a “sequence alignment of each full‐length human Y RNA (hY1, hY3, hY4, and hY5) with Y RNA fragments,” See FIG. 1E. In particular, Cambier teaches the sequence EV-YF1 (highlighted in orange in FIG. 1E) was most abundant in CDC-EVs and aligns exceptionally well full length hY4, aside from a single Thymine at position 16, see FIG. 3D and pg. 339 column 2. Based the alignment results, Cambier further teaches a consensus sequence, see FIG 1E and provided below for convenience: PNG media_image2.png 267 762 media_image2.png Greyscale The consensus sequence taught by Cambier comprises 20 core conserved bases, 15 of which are present in instant SEQ ID NO: 12 (cguCCGAuGGUagUGgGUUAUCag) as depicted by capital letters. Thus, the first base of SEQ ID NO: 12, which is the G->C substitution, is not a core conserved nucleotide part of the consensus. Cambier teaches that EV‐YF1 “confers cardioprotection via modulation of IL‐10 expression and secretion,” see title. Cambier further teaches that EV‐YF1’s “cardioprotection highlights the potential importance of diverse exosomal contents of unknown function, above and beyond the usual suspects (e.g., microRNAs and proteins),” see abstract. Cambier further suggests the EV-YF1 Y-RNA fragment cytoprotectiveeffect “motivates the search for other therapeutically active, non‐miR small non‐coding RNAs within EVs,” see limitations last sentence. Cambier does not teach LNA modifications at positions 1, 3, 5, 20, 22, and 24. However, Bleicher teaches “gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage,” and “modifications such as Locked Nucleic Acids (LNAs),” see title and [0001]. Bleicher teaches a LNA “is a 2′-modified nucleoside which comprises a biradical linking the C2′ and C4′ of the ribose sugar ring of said nucleoside (also referred to as a “2′-4′ bridge”), which restricts or locks the conformation of the ribose ring,” and that “the locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule,” see [0186-0196]. Thus, Bleicher teaches LNA is a modification to the backbone of a polynucleotide/oligonucleotide. Bleicher further teaches oligonucleotides comprising LNA nucleosides “have improved nuclease resistance such as improved biostability in blood serum,” see [0769]. Specifically, Bleicher teaches “in vitro rat serum stability of 3′ end protected LNA oligonucleotides,” see [0076] and FIG. 12. Briefly, Bleicher reports LNA modifications significantly increase the stability of oligonucleotides in serum. Bleicher further teaches “flanking regions may comprise both LNA and DNA nucleoside and are referred to as “alternating flanks” as they comprise an alternating motif of LNA-DNA-LNA nucleosides. Gapmers comprising such alternating flanks are referred to as “alternating flank gapmers”. “Alternative flank gapmers” are thus LNA gapmer oligonucleotides where at least one of the flanks (F or F′) comprises DNA in addition to the LNA nucleoside(s). In some embodiments at least one of region F or F′, or both region F and F′, comprise both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking region F or F′, or both F and F′ comprise at least three nucleosides, wherein the 5′ and 3′ most nucleosides of the F and/or F′ region are LNA nucleosides,” see [0314]. Bleicher further teaches “the alternating flank can be annotated as a series of integers, representing a number of LNA nucleosides (L) followed by a number of DNA nucleosides (D), for example: [L].sub.1-2-[D].sub.1-2-[L].sub.1-2-[D].sub.1-2-[L].sub.1-2,” see [0317]. Thus, when applied to a 24mer, Bleicher teaches a polynucleotide comprising LNA at positions 1, 3, 5, 20, 22, and 24. Bleicher further teaches providing LNA modified oligonucleotides in a pharmaceutical composition comprising … a therapeutically inert carrier” (i.e., a pharmaceutically acceptable excipient), see [0052]. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to substitute the first guanine (G) of the native 5’-derived 24 base Y-RNA fragment taught by Spindler with a cytosine (C), thereby arriving at SEQ ID NO: 12, and further modify the resulting oligonucleotide with LNA modifications at positions 1, 3, 5, 20, 22, and 24 as taught by Bleicher. A PHOSITA would have been motivated to do so because Cambier teaches that EV-YF1 comprises a highly conserved functional core sequence among Y-RNA derived fragments, and the first nucleotide of the native 5’-derived 24 base Y-RNA fragment taught by Spindler is not part of this conserved core, thereby suggesting that limited variation at the 5’ terminal nucleotide would be tolerated while maintaining or even potentially enhancing biological function. Furthermore, Bleicher teaches that incorporation of LNA residues into oligonucleotides significantly improves nuclease resistance and serum stability, making such modifications desirable for therapeutic oligonucleotides. Accordingly, a PHOSITA would have been motivated to optimize the known naturally occurring Y-RNA fragment of Spindler by making routine single nucleotide substitution outside the conserved core while incorporating conventional LNA modifications to improve pharmaceutical properties. PHOSITA would have had a reasonable expectation of success because Cambier’s alignment suggests biological activity is associated with a conserved sequence motif rather than absolute identity at every nucleotide position, indicating certain substitutions at a non-conserved residue would be at least tolerated if not confer additional advantages. Thus, a PHOSITA would have a reasonable expectation of success to screen a finite number substitutions that result in enhanced function(s) over the native counterpart. Furthermore, LNA was an established, routine oligonucleotide modification with known functional benefits and thus one would reasonably expect LNA modifications to yield an oligonucleotide possessing improved pharmaceutical stability. Claims 3-11 and 25 are rejected under 35 U.S.C. 103 as being unpatentable over Spindler S. et al., (US20160024575A1) as applied to claim 2 above, and further in view of Bleicher K. et al., (US 20200332289 A1). The teachings of Spindler are incorporated herein by reference to the 102 rejection above. Regarding claims 3-10, Spindler teaches that “because the YRNA fragments are stable in the circulation, but not encapsulated in exosomes, they are most likely complexed to carrying factors (e.g., proteins that protect them from degradation),” see [0175]. Regarding claim 11, the isolated nucleic acid taught by Spindler, SEQ ID NO: 24880, derived from the 5’-end of Y-RNA is a 24-mer. Spindler further teaches that “5′ YRNA fragments are present in both serum and plasma,” and that “plasma displays the same peak pattern (20-24 nt, 27 nt and 30-33 nt peaks) found in serum,” see [0175]. Spindler does not teach modifying the isolated 5’-derived Y-RNA 24-mer fragment that has 95.8% identity to SEQ ID NO: 12, such that: the nucleic acid comprises at least one chemically-modified nucleotide; the nucleic acid comprises between 1-10 chemically-modified nucleotides; the nucleic acid comprises at least one chemically-modified nucleotide within positions 1-12 and/or at least one chemically- modified nucleotide within positions 13-24 of the nucleotide sequence; the chemically-modified nucleotide comprises a backbone modification; the backbone modification comprises a backbone sugar modification; the nucleic acid comprises the at least one chemically-modified nucleotide at one or more of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence; the chemically-modified nucleotide is a locked nucleic acid (LNA), and/or the nucleotide sequence comprises the LNA at positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence. The teaching of Bleicher are incorporated herein by reference to the preceding 103 rejection pertaining to the LNA modifications. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to modify the 5’-derived Y-RNA 24 base fragment of Spindler such that it comprises LNA modifications at positions 1, 3, 5, 20, 22, and 24, and by satisfying LNA modifications at positions 1, 3, 5, 20, 22, and 24, one necessarily satisfies all other required modifications recited in the instant dependent claims that are broader than the former modification. It would have further been obvious to a PHOSITA to create a composition comprising the LNA modified oligonucleotide and a pharmaceutically acceptable excipient. A PHOSITA would have been motivated to do so because LNA modifications improve the stability of oligonucleotides in serum by increasing resistance to serum nucleases, and since the oligonucleotide is created with the intended purpose as a therapeutic, one would be motivated to look at LNA modification because LNA can provide similar protection as the endogenous carrying factors. Furthermore, in order to administer the LNA modified oligonucleotide, one would necessarily be motivated to create a pharmaceutical composition comprising it and an acceptable excipient. A PHOSITA would have had a reasonable expectation of success because LNA modifications were a well-established, proven oligonucleotide protective modification, pharmaceutical compositions of modified oligonucleotides are common practice, and Bleicher explicitly teaches the exact LNA modification formula, which when applied to a 24-mer oligonucleotide, results in LNA modifications at positions 1, 3, 5, 20, 22, and 24. Therefore, the LNA configuration as instantly claimed is a mere application of routine oligonucleotide modifications known in the art. Claims 36, 44, 48, and 76 are rejected under 35 U.S.C. 103 as being unpatentable over Spindler S. et al., (US20160024575A1) as applied to claim 2 above, and further in view of Cambier L, et al., (EMBO Mol Med.;9(3):337-352, published 2017). The teachings of Spindler are incorporated herein by reference to the preceding 102 and 103 rejections above. Spindler does not teach a macrophage comprising a 5’-derived Y-RNA fragment with at least 95% sequence identity to SEQ ID NO:12, wherein an anti-inflammatory activity of the macrophage is increased compared to a macrophage without the nucleic acid. Nor does Spindler teach methods of treating a condition associated with inflammation and/or fibrosis, a heart condition or symptom thereof, or promoting anti-inflammatory activity of macrophages comprising administering to a subject or macrophage a therapeutically effective amount of the 5’-derived Y-RNA fragment with at least 95% sequence identity to SEQ ID NO:12; Cambier teaches transfecting bone marrow derived macrophages (BMDMs) with “EV‐YF1 or a scrambled oligoribonucleotide control [Ys] (sequence in Table 3).” Cambier further teaches “that EV‐YF1 induced an 18‐fold increase in Il10 gene expression relative to Ys within 18 h of transfection (Fig 5C), an effect sustained for at least 72 h (Appendix Fig S4A),” see section: IL‐10 expression is induced by EV‐YF1. Cambier further extends these teachings into rat subjects with myocardial infarction (MI) and demonstrates “that EV‐YF1, which induces IL‐10 expression in Mϕ and suppresses cardiomyocyte death in vitro, elicits a similar cardioprotective response in vivo by reducing infarct size.” Cambier further teaches that these results “support the notion that a focal, concentrated release of IL‐10 is required to elicit a cytoprotective anti‐apoptotic response,” see discussion second to last paragraph. Cambier further teaches that “IL‐10 is a potent anti‐inflammatory cytokine and an enticing candidate for the treatment not only of MI, but perhaps also of other inflammatory diseases,” see discussion last paragraph. Cambier further suggests that using EV-YF1 in macrophages has benefits over employing recombinant proteins because they are expensive to purify at high concentrations and macrophage infiltration delivered IL-10 in a more targeted manner. Thus, Cambier encourages “future testing of EV‐YF1 alone, or within EVs, as cell‐free off‐the‐shelf therapeutic candidates to confer cytoprotection,” see discussion last paragraph. EV-YF1 of Cambier and the 5’-derived Y-RNA fragment taught by Spindler are members of the same class of naturally occurring 5’-derived Y-RNA fragments and share substantial sequence homology, differing from the instant SEQ ID NO: 12 by no more than a single nucleotide. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to contact macrophages with the 5’-derived Y-RNA fragment taught by Spindler, thereby producing a macrophage comprising the nucleic acid and having increased ani-inflammatory activity, and to administer the 5’-dereived y-RNA fragment to treat inflammatory conditions and heart conditions by promoting anti-inflammatory activity of macrophages. A PHOSITA would have been motivated to do so because Cambier teaches that transfection of macrophages with the highly homologous EV-YF1 5’-Y-RNA fragment induces substantial IL-10 expression, thereby increasing the anti-inflammatory activity of the macrophages, and further demonstrates that administration of EV-YF1 reduces infarct size following myocardial infarction through macrophage-mediated cardioprotection. Cambier further teaches that IL-10 is a potent anti-inflammatory cytokine useful for treatment of myocardial infarction and other inflammatory diseases and encourages future testing of EV-YF1 alone, or within extracellular vesicles, as an off-the-shelf therapeutic candidate. Furthermore, Cambier suggest testing alternative 5’-derived Y-RNA fragments. Therefore, a PHOSITA would have been motivated to use the highly similar naturally occurring 5’-derived Y-RNA fragment taught by Spindler for the same known anti-inflammatory and cardioprotective purposes. A PHOSITA would have had a reasonable expectation of success because the 24-mer taught by Spindler and EV-YF1 taught by Cambier both comprise the same consensus sequence found among the 5’-Y-RNA fragments and hY4 RNA, and given that Cambier had already demonstrated the benefits of EV-YF1 as a therapeutic agent, a PHOSITA would reasonably expect that employing the highly similar fragment of Spindler in macrophages or administering it to subjects would likewise promote anti-inflammatory macrophage activity and provide therapeutic benefit in inflammatory and heart conditions. Thus, utilizing an alternative truncated 5’-derived Y-RNA fragment according to the therapeutic teachings of Cambier represents the predictable use of a known prior art composition for it expected biological activity. Claims 39 is rejected under 35 U.S.C. 103 as being unpatentable over Spindler S. et al., (US20160024575A1) as applied to claim 2 above, and further in view of Olson E. et al., (US 20100285073 A1). The teachings of Spindler are incorporated herein by reference to the preceding 102 and 103 rejections above. Spindler does not teach a kit comprising the 5’-derived Y-RNA fragment with at least 95% sequence identity to SEQ ID NO:12 and a transfection reagent. Olson teaches “any of the compositions described herein may be comprised in a kit. In a non-limiting example, an individual miRNA is included in a kit. The kit may further include water and hybridization buffer to facilitate hybridization of the two strands of the miRNAs. In some embodiments, the kit may include one or more oligonucleotides for inhibiting the function of a target miRNA. The kit may also include one or more transfection reagent(s) to facilitate delivery of the miRNA or miRNA antagonists to cells,” see [0198]. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to provide the 5’-derived Y-RNA fragment taught by Spindler as part of a kit comprising a transfection reagent. A PHOSITA would have been motivated to do so because Olsen teaches kits of this exact nature and to provide the end user with a convenient means facilitate cellular delivery of the RNA therapeutic. A PHOSITA would have had a reasonable expectation of success because transfection reagents were routinely used to deliver RNAi and kits are common practice. Claim 57 is rejected under 35 U.S.C. 103 as being unpatentable over Spindler S. et al., (US20160024575A1) as applied to claim 2 above, and further in view of Cambier L, et al., (EMBO Mol Med.;9(3):337-352, published 2017) and Marban E. et al., (WO2016054591A1). The teachings of Spindler are incorporated herein by reference to the preceding 102 and 103 rejections above. Spindler does not teach a method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the 5’-derived Y-RNA fragment with at least 95% sequence identity to SEQ ID NO:12. The teachings of Cambier are incorporated herein by reference to the preceding 103 rejections above. Marbon teaches “cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy,” see title. Marban further teaches “these cells and their secreted vesicles contain a unique milieu of biological factors, including cytokines, growth factors, transcription factors, nucleic acids including non-coding nucleic acids such as microRNAs, that serve to initiate and promote many therapeutic effects,” and that “exosomes and their "cargo" contents, such as microRNAs can favorably modulate apoptosis, inflammation and fibrosis…” see abstract. Marban proposes “CDC-derived exosomes represent a novel "cell-free" therapeutic candidate for tissue repair,” see abstract. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to administer the 5’-derived Y-RNA fragment taught by Spindler to a subject in need of treatment for a muscle disorder or symptom thereof. A PHOSITA would have been motivated to do so because Marban teaches that CDC-derived exosomal nucleic acid cargo mediates therapeutic effects in muscular dystrophy through modulation of inflammation and fibrosis, while Cambier teaches that the highly homologous EV-YF1 Y-RNA fragment confers anti-inflammatory and cytoprotective effects, thereby suggesting its use as a cell-free therapeutic agent. A PHOSITA would have had a reasonable expectation of success because Spindler teaches a highly similar naturally occurring 5’-derived Y-RNA fragment, Cambier demonstrates that such Y-RNA fragments possess therapeutic anti-inflammatory activity, and Marban teaches that CDC-derived nucleic acid cargo is effective for treating muscular dystrophy, such that employing the known Y-RNA fragment for the known therapeutic purpose would have yielded predictable results according to established functions. Claim 88 is rejected under 35 U.S.C. 103 as being unpatentable over Dewi FRP, et al., (Autophagy.;17(4):1001-1012, published April 2021) in view of Qian M, et al., (Clin Transl Med.;6(1):24, published Dec 2017) and Griesinger A, et al., Neuro Oncol.;17(Suppl 3):iii16, published June 2015). Dewi teaches “that TPR may act as a biomarker for ependymoma, and pharmacological interventions targeting TPR-HSF1-MTOR may have therapeutic potential for ependymoma treatment,” see abstract. Dewi further teaches “TPR expression is high in ependymoma patients,” see results. Dewi further teaches “knockdown of TPR” with an shRNA “induces autophagy,” see discussion 2nd paragraph and FIG. 1E. Dewi does not explicitly teach targeting TPR to treat a condition associated with inflammation and/or fibrosis. However, Griesinger teaches “inflammation has been identified as a hallmark of high-risk Group A ependymoma (EPN),” see abstract. Furthermore, Qian teaches “modulation of autophagy might lead to therapeutic interventions for diseases associated with inflammation,” see abstract. It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to target TPR with an oligonucleotide that specifically binds to it in a subject having a condition associated with inflammation, thereby treating the inflammatory condition. A PHOSITA would have been motivated to do so because Dewi teaches that TPR knockdown via shRNA is a therapeutic strategy for ependymoma through induction of autophagy. Griesinger teaches that ependymoma is characterized by inflammation, and Qian teaches that modulation of autophagy provides therapeutic benefit for inflammatory diseases. A PHOSITA would have had a reasonable expectation of success because Dewi demonstrates that TPR knockdown with shRNA successfully induces autophagy, and in view of Qian’s teaching that autophagy modulation is therapeutically beneficial in inflammatory diseases and Griensinger’s teaching that ependymoma is an inflammatory disease, a PHOSITA would have reasonably expected TPR targeting to provide therapeutic benefit through the predicted modulation of inflammation via autophagy induces by TPR knockdown. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 2-11, 23-25, 44, 48, and 57 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 26, 55, 64, and 87 of copending Application No. 18/572,067 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the reference application claims the same oligonucleotide sequences with the same SEQ ID NOs: 2 and 12. Thus, the reference application also claims every modification limitation recited in instant claims 3-10 because SEQ ID NO: 2 comprised LNA at positions, 1, 3, 5, 20, 22, and 24. Regarding instant claim 11, reference application SEQ ID NO: 2 is 24 bases. Regarding claims 23-24, reference application SEQ ID NO: 2 is the same sequence instantly claimed with the same LNA modification in the same positions. Regarding claim 25, the composition of reference application claim261 comprises the nucleic acid and a pharmaceutically acceptable excipient. Regarding instant method claims 44, 48, and 57, the reference application claims treating the same conditions with the same LNA modified oligonucleotide. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 2-11, 23-25, 36, 39, 44, 48, 57, and 76 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-25 of U.S. Patent No. US12146137B2 in view of Spindler S. et al., (US20160024575A1) and Bleicher K. et al., (US 20200332289 A1). The teachings of Spindler and Bleicher are incorporated herein by reference to the rejections set forth above. US12146137B2 teaches therapeutic use of EV-YF1 and truncated forms thereof for increasing macrophage IL-10 expression and treating inflammatory and fibrotic conditions, including heart and muscle. As discussed above in the 103 rejections, it would have been obvious to a person having ordinary skill in the art to substitute the homologous Spindler fragment for the EV-YF1 fragment taught by US12146137B2 and further incorporate the conventional LNA modifications taught by Bleicher to improve pharmaceutical stability. A PHOSITA would have been motivated for the same reasons as discussed above in the 103 rejections, and would have had a reasonable expectation of success also for the same reasons as discussed above. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to COREY LANE BRETZ whose telephone number is (571)272-7299. The examiner can normally be reached M-F 7:30am - 6:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /COREY LANE BRETZ/Patent Examiner, 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Dec 19, 2023
Application Filed
Jun 30, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
2y 7m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 3 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month