DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 03/08/2024, 08/23/2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Status of Claims
This office action is in response to Applicant's Response to Election / Restriction filed on May 14, 2026. No claims amendment are made in the response filed on that date.
Claims 1-2, 4-6, 9-10, 14-15, 17, 19, 21, 23, 26-28, 30, 35 and 43 are currently pending, with claims 5, 14, 19, 27-28, 30 and 43 withdrawn.
Claims 1-2, 4, 6, 9-10, 15, 17, 21, 23, 26 and 35 are under examination. This is the first action on the merits.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-2, 4-6, 9-10, 14-15, 17, 19, 21, 23, 26-28, 30, 35) in the reply filed on May 14, 2026 is acknowledged 1.
Applicant’s election without traverse of the following species in the reply filed on May 14, 2026 is acknowledged:
Species of selective processing: A) selective sequencing as described according to Fig. 13 (claim 23, 26) 2;
Species of polynucleotide: E) 3at least one polynucleotide sequence comprising a first portion and a second portion (claim 1, 4) 4.
Claims 5, 14, 19, 27-28, 30 and 43 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1-2, 4, 6, 9-10, 15, 17, 21, 23, 26 and 35.
Priority
For the instant claims 1-2, 4, 6, 9-10, 15, 17, 21, 23, 26 and 35 in this U.S. Application, the applicant claims priority of the US provisional application NO. 63/269,383, which has a filling date on March 15, 2022.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
Under BRI, claim 1 is interpreted to encompass any method comprising selective processing a polynucleotide in a manner capable of yielding the claimed outcome of generating two signals from two portions of the polynucleotide, with one signal being greater than the other.
Claim 1 recites:
A method of preparing at least one polynucleotide sequence for identification, comprising:
selectively processing
at least one polynucleotide sequence comprising a first portion and a second portion, or
at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion,
such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal,
wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal.
Therefore, claim 1 comprises a single step of selectively processing a polynucleotide comprising a first and a second portion, such that the first portion is capable of generating a signal greater than the second portion is capable of generating. The application's disclosure does not define the terms "first portion" and "second portion" with any structural feature that directly support or relate to the recited functions.
The term "selectively processing" is not expressly defined in the application's disclosure.
Under BRI, "selectively processing" a polynucleotide is interpreted to encompasses any processing step that acts on a selected class of polynucleotides, rather than acting universally on all polynucleotide species. This includes, for example, selective hybridization in a microarray, selective digestion of DNA using DNase, selective separation using chromatography or immunoprecipitation, selective base modification via bisulfite treatment, selective amplification using target-specific primers, etc. A wide range of prior art discloses selectively processing polynucleotides.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 4, 6 and 9-10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Raj (Raj et al., Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 2008 Oct;5(10):877-9. doi: 10.1038/nmeth.1253. Epub 2008 Sep 21. PMID: 18806792; PMCID: PMC3126653.)
Regarding claim 1, Raj teaches a single RNA fluorescent probe hybridization method comprising selective processing a polynucleotide, capable of generating two signals from two portions of the polynucleotide, with one signal being greater than the other (Figure 1, first region being the 3' UTR region, capable of generating more fluorescent signal intensity than the GFP coding region as it can hybridize to more probes).
PNG
media_image2.png
534
322
media_image2.png
Greyscale
Regarding claim 2, Raj teaches a concentration of the first portions capable of generating the first signal is greater than a concentration of the second portions capable of generating the second signal, wherein the ratio between the concentration of the first portions capable of generating the first signal and the concentration of the second portions capable of generating the second signal is between 1.5:1 to 3:1 (Figure 1, 128:48 probes binding sites is 2.6:1).
Regarding claim 4, Raj teaches mRNA, which comprises forward strand sequence copy of a double-stranded DNA template, naturally, a first portion, such as a probe binding region in 3' UTR region, comprises sequence copies from the forward strand of DNA, and a probe binding region in the GFP coding region (second portion), also comprises sequence copies from the forward strand of DNA template, which is complementary to the DNA reverse strand.
Regarding claim 6, Raj teaches the first signal and the second signal are spatially unresolved (Figure 1).
Regarding claim 9, Raj teaches that the polynucleotide is attached to a solid support (Figure 1; supplementary method, page 3, the RNA is immobilized on a glass slide).
Regarding claim 10, it is anticipated by Raj because it does not further limit the claimed method.
Claim 10 depends from claim 1 and describes the polynucleotide "form a cluster on the solid support," but the method in base claim 1 does not require a solid support in its step.
Therefore, this claim language is interpreted as descriptive statement without any associated active steps and do not distinguish the claim from the prior art.
Claims 1-2, 4, 6, 9-10, 21, 23, 26 and 35 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Boutell (US20170298430A1 - Sequencing from multiple primers to increase data rate and density; Published on : 2017-10-19).
Boutell teaches a sequencing by synthesis method that is substantially the same as the embodiment disclosed in this application (Fig. 13; see page 54, para 2 in specification for description), which involves selective, concurrent sequencing of two regions of a polynucleotide strand using a mixture of blocked and unblocked primers ([0114]-[0124]).
Regarding claim 1, Boutell teaches a method comprising:
selectively processing at least one polynucleotide sequence comprising a first portion and a second portion (FIG.1; [0114] polynucleotide construct comprising SBS3 and SBS8 primer binding sites for sequencing two separate sequence regions simultaneously; [0120]; [0122]; [0124] “blocked and unblocked primers are used to chemically differentiate between extension reads .”), such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal ([0120]; [0122]; [0124]), wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal ([0120]; [0122]; [0124]).
Regarding claim 2, Boutell teaches a concentration of the first portions capable of generating the first signal is greater than a concentration of the second portions capable of generating the second signal, wherein the ratio between the concentration of the first portions capable of generating the first signal and the concentration of the second portions capable of generating the second signal is between 1.25:1 to 5:1 ([0124] 100% primer 1 extension site: 25% primer 2 extension site is 4:1).
Regarding claim 4, Boutell teaches selectively processing at least one polynucleotide sequence comprising a first portion and a second portion (FIG.1; [0114] polynucleotide construct comprising SBS3 and SBS8 primer binding sites for sequencing two separate sequence regions), wherein the at least one polynucleotide sequence comprises portions of a double-stranded nucleic acid template, and each of the first portions comprise a forward strand of the template, and each of the second portions comprise a reverse strand of the template or a forward complement strand of the template (FIG. 1).
Regarding claim 6, Boutell teaches the first signal and the second signal are spatially unresolved ([0120]; [0124] the signals are generated from sequencing the same strand polynucleotide strand thus they are colocalized).
Regarding claim 9, Boutell teaches the polynucleotide is attached to a solid support ([0154]; claim 23).
Regarding claim 10, it is anticipated by Boutell because it does not further limit the claimed method.
Claim 10 depends from claim 1 and describes the polynucleotide "form a cluster on the solid support," but the method in base claim 1 does not require a solid support in its step.
Therefore, this claim language is interpreted as descriptive statement without any associated active steps and do not distinguish the claim from the prior art.
Regarding claim 21, Boutell teaches conducting selective sequencing ([0114]-[0124]).
Regarding claim 23, Boutell teaches contacting first sequencing primer binding sites located after a 3'-end of the first portions with first primers and contacting second sequencing primer binding sites located after a 3'-end of the second portions with second primers, wherein the second primers comprises a mixture of blocked second primers and unblocked second primers (FIG. 1, SBS3 and SBS8 primer binding sites are after 3' ends of sequence portions of the polynucleotide; [0115-0118]; [0124]).
Regarding claim 26, Boutell teaches a second primer (SBS8’) hybridizing to the SBS8 sequence region ([0115-0117] SBS8 sequence is “TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGC”).
Therefore, a skilled artisan would readily understand that the sequence of SBS8’ primer is the reverse complement of SBS8 (SBS8’ : GCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGA), which comprises a fragment of SEQ ID NO: 11:
PNG
media_image3.png
98
304
media_image3.png
Greyscale
Regarding claim 35, Boutell teaches concurrently sequencing nucleobases in the first portion and the second portion based on the intensity of the first signal and the intensity of the second signal ([0114]-[0124]; claim 23).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 15 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Boutell (US20170298430A1 - Sequencing from multiple primers to increase data rate and density; Published on : 2017-10-19), in view of Singer (US20180334712A1 - Universal short adapters for indexing of polynucleotide samples; published on 2018-11-22) and as evidenced by
Launen (Loren Launen; Illumina Sequencing (for Dummies) -An overview on how our samples are sequenced; published February 13, 2017)
The teachings of Boutell are recited above and applied as for base claims 1 and 9.
A) Regarding claim 15, Boutell teaches a solid support comprises at least one first immobilised primer and at least one second immobilised primer by teaching bridge amplification ([0154]) and performing sequencing by synthesis using a flow cell with clustered array having standard construct comprising P5 and P7 as shown in FIG. 1 ([0114]).
A skilled artisan would readily understand that Boutell’s sequencing flow cell comprises P5 and P7 amplification primers immobilized on the flow cell to support cluster formation via bridge amplification, as Boutell’s construct comprises P5 and P7 sequences for hybridizing to their corresponding primers on the flow cell, and the uses of amplification primers such as P5 and P7 on sequencing flow cells is well known in the art, as evidenced by Singer and Launen.
Launen provides detailed teachings on bridge amplification and how the P5 and P7 primers, immobilized on the flow cell surface, captures sequencing library constructs (page 3):
"The flow cell (also called chip) has pre-attached short oligos (short sequences of DNA) poking up. I’m going to call them grafts, and they are the P7 and the P5 grafts. In our images P7 is black and P5 is red. Note that in the figure above, there are ends that are labelled as P5/P7 graft binding sites. That’s because those areas are complementary to the P7 and P5 grafts. So… base pairing will occur!
When you flow the single-stranded library across the flow cell your fragments will base pair with the grafts as shown in the figure below, and you’ll now have your library fragments attached to the flow cell."
PNG
media_image4.png
464
376
media_image4.png
Greyscale
Singer teaches:
"[0093]The terms “P5” and “P7” may be used when referring to amplification primers, e.g., universal primer extension primers. The terms “P5′” (P5 prime) and “P7′” (P7 prime) refer to the complement of P5 and P7, respectively. It will be understood that any suitable amplification primers can be used in the methods presented herein, and that the use of P5 and P7 are exemplary embodiments only. Uses of amplification primers such as P5 and P7 on flow cells is known in the art, as exemplified by the disclosures of WO 2007/010251, WO 2006/064199, WO 2005/065814, WO 2015/106941, WO 1998/044151, and WO 2000/018957. "
Singer also teaches that, SEQ ID NO: 1 is a P5 flow cell amplification primer binding sequence ([0204] SEQ ID NO: 8), and SEQ ID NO: 2 is a P7 flow cell amplification primer binding sequence ([0203] SEQ ID NO: 7).
While Boutell teaches different primer sequences for P5 and P7, a person of ordinary skill would understand that the P5 and P7 primer sequences and their corresponding binding sites in Boutell and Singer perform the same function of facilitating amplification on a sequencing flow cell.
Therefore, Modifying Boutell's sequencing method to utilize the specific P5 and P7 primers and corresponding primer binding sequences in the library construct, as taught in Singer would have been prima facie obvious as it represents the principle of KSR for a simple substitution of one known element for another to obtain predictable results, see MPEP 2141.
B) Regarding claim 17, Boutell teaches the limitations "polynucleotide sequence is attached to a first immobilised primer, wherein each polynucleotide sequence comprising the first portion and the second portion further comprises a second adaptor sequence, wherein the second adaptor sequence is substantially complementary to the second immobilized primer," by teaching bridge amplification ([0154]) and performing sequencing by synthesis using a flow cell with clustered array having standard construct comprising P5 and P7 as shown in FIG. 1 ([0114]).
As evidenced by Launen (pages 2-3) and discussed for claim 15 above, these claimed features are encompassed by bridge amplification using a flow cell for sequencing polynucleotide constructs comprising P5 and P7 regions.
Double Patenting- Obvious Type
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 6, 9-10, 21, 23 and 35 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 23-24 of U.S. Patent No. 11555218B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over claims of the '218 patent.
Instant claim 1 recites:
A method of preparing at least one polynucleotide sequence for identification, comprising:
selectively processing
at least one polynucleotide sequence comprising a first portion and a second portion (‘218 Patent, claim 1, 23), or
at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion,
such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal,
wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal.
Therefore, instant claims 1-2, 6, 9, 10, 21 and 35 are anticipated by claims 1 and 23 of the '218 patent. Instant claim 23 is anticipated by claim 24 of the '218 patent.
Claims 1-2, 6, 9, 10, 21, 23 and 35 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 10, 12 of copending Application No. 18/153,946 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by the claims (filed on 03/20/2026) of the '946 application.
Instant claim 1 recites:
A method of preparing at least one polynucleotide sequence for identification, comprising:
selectively processing
at least one polynucleotide sequence comprising a first portion and a second portion (‘946 Application, claim 1), or
at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion,
such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal,
wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal.
Therefore, instant claims 1-2, 6, 10, 21 and 35 are anticipated by claims 1 of the '946 application. Instant claims 9; 23 are anticipated by claims 12; 10 of the '946 application, respectively.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1-2, 6, 9-10, 21, 23 and 35 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 27, 30, 33, 35 of copending Application No. 18/850,983 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by the claims (filed on 09/25/2024) of the '983 application.
Instant claim 1 recites:
A method of preparing at least one polynucleotide sequence for identification, comprising:
selectively processing
at least one polynucleotide sequence comprising a first portion and a second portion (‘983 Application, claim 30), or
at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion,
such that a proportion of first portions are capable of generating a first signal and a proportion of second portions are capable of generating a second signal,
wherein the selective processing causes an intensity of the first signal to be greater than an intensity of the second signal.
Therefore, instant claims 1-2, 6,9,10 are anticipated by claim 30 of the '983 application. Instant claims 21; 23; 35 are anticipated by claims 33; 35; 27 of the '983 application, respectively.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Prior Art
Below are relevant prior art not used in rejection but pertinent to the claims or disclosure.
The following references also teach selective processing of polynucleotides:
US20060134633A1 - Double ended sequencing ; See FIG. 8;
US20180312917A1 - Orthogonal deblocking of nucleotides;
US20150031560A1- Sequencing by orthogonal synthesis;
Liu et al. Multiplex dosage pyrophosphorolysis-activated polymerization: application to the detection of heterozygous deletions. Biotechniques. 2006 May;40(5):661-8. doi: 10.2144/000112164. PMID: 16708764; See Figure 1
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Claim 43 is withdrawn as being drawn to non-elected group II.
2 Claims 27-28 and 30 are withdrawn as being drawn to non-elected species B-D.
3 Here is it noted that Applicant's remarks contain clerical error: in the remarks, page 2 (see below), Applicant cites the wrong species identifier for the elected species: the species which "at least one polynucleotide sequence comprising a first portion and a second portion (claim 1, 4)," is species E in the Requirement for Restriction/Election (mail date03/17/2026, page 4), not F.
PNG
media_image1.png
126
620
media_image1.png
Greyscale
For clarity of record here, the Examiner acknowledges that the elected species is "at least one polynucleotide sequence comprising a first portion and a second portion," identified in the last Office Action as Species E and encompassed by claims 1, 4 and 17.
4 Claims 5, 14 and 19 are withdrawn as being drawn to non-elected species F.
Prosecution Insights