7441DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1, 7-19, 30 and species of phosphate (cl. 12) are pending and examined here.
The interview of 06/26/26 summarizes that the Examiner agrees with Applicant’s contention that the Flynn reference was a post-filing reference, since the priority document did not disclose the noted sequence.
Thus, the prior final rejection was withdrawn. This is a non-final action.
Priority
The claim to benefit of 63/224,901 and 63/293,851, filed on 07/23/2021 and 12/27/2021, respectively, via their CON applications of 18/405072 and PCT/US22/37794, filed on 01/05/2024 and 07/21/2022, is recognized.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed applications, provisional application Nos. 63/224,901 and 63/293,851, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Priority is a claim by claim analysis. Here, claims 1, 7-15 will receive the benefit of 07/23/2021, while claims 16-19, 30 will receive the benefit of 12/27/2021. The SEQ ID NO: 20 and 21 along with its modification pattern is disclosed in 63/224,901 (see pg. 140, AD-1548488.1) and cationic lipid as a drug delivery system is disclosed (pg. 96), while the lipid structure of claims 17-19, and 30 is not disclosed in the 63/224,901, but is claimed and disclosed in 63/293,851 (see cl. 66). While the biodegradable limitation is not disclosed in 63/224,901 and not all cationic lipids are biodegradable, thus claims 16 and their dependent claims (17-19) will receive the benefit of 12/27/2021.
Information Disclosure Statement
One of the information disclosure statement (IDS) submitted on 07/15/2026 was filed before the mailing date of instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
The other information disclosure statement, i.e. the “Supplemental IDS,” filed 07/15/2026 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because a) it appears to be a duplicate of an earlier filed Supplemental IDS of 03/13/2026 and b) it provides a list of pending U.S. applications, U.S. Patents and U.S. Publications without noting inventors and publication date of U.S. Publication and/or are duplicate(s) and have been noted in earlier IDSes (e.g., U.S. Pat. ‘907, ‘623, ‘420, ‘491, ‘714 are in 2/20/24 IDS). See MPEP 609.01(B)(1)(e)(i-iii). The Foreign application is missing the corresponding publication; the “FOR” pub. provided on 7/15/26 is a WO2019 pub.
It has been placed in the application file, but the information referred to therein has not been considered as to the merits. Applicant is advised that the date of any re-submission of any item of information contained in this information disclosure statement or the submission of any missing element(s) will be the date of submission for purposes of determining compliance with the requirements based on the time of filing the statement, including all certification requirements for statements under 37 CFR 1.97(e). See MPEP § 609.05(a).
Claim Rejections - 35 USC § 103
Rejection of claims 1, 7-19, 30 under 103 is withdrawn since, as noted above in the Claim Status section, the Flynn reference is a post-filing reference. Upon further consideration, the claims have been rejected as noted below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 7-15 are rejected under 35 U.S.C. 103 as being unpatentable over Brown et al. (US20130109740, pub. 05/02/2013, “Brown”), as evidenced by The Glen Research Report (2004, 17, 1-12, of record) in view of Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei, of record), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster, of record) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989, of record).
The claimed SEQ ID NOs: 20 and 21 are the following sequences:
5′-usascuguugGfAfUfugauucgasasa-3′: SEQ ID NO: 20, a 21 nt. sense strand
5′-VPudTucdGadAucaadTcCfaacaguasgsc-3′: SEQ ID NO: 21, a 23 nt. antisense strand.
Regarding instant cl. 7, Brown discloses the full sequence of instant claims. Brown discloses Dicer substrate siRNAs (dsiRNAs) that target beta-catenin (title/abstract). The dsiRNAs comprise longer sense and antisense strands with a duplex region of at least 25 bp (in excerpt of Fig. 1 below: “DsiRNA 25/27mer” has a 25 nt. sense strand (top) and 27 nt. antisense strand (bottom) of different SEQ ID NOs than ones cited in this action). The fig. 1 illustrates Dicer cleavage site with arrowheads (par. 101). Thus dsiRNAs are longer and can be considered a modified (also non-canonical) type of a siRNA compared to a canonical siRNAs of 21 nt. with a duplex region of 19 nt. but are processed by Dicer into a 21 nt. sense and antisense strands with 2 nt. overhangs (par. 164, see “siRNA 21mer” below).
PNG
media_image1.png
358
1033
media_image1.png
Greyscale
Brown discloses a dsiRNA comprising an antisense strand sequence of SEQ ID NO: 1152, a 27 nt. sequence, and a sense strand sequence of SEQ ID NO: 43, a sequence of 25 nt. (the duplex is designated βc-1816, since its target start site begins at position 1816 on the transcript). Brown’s βc-1816, comprising SEQ ID NOs: 43 and 1152 comprises instant SEQ ID NOs: 20 and 21, respectively (the bold sequence in Brown’s SEQ ID NO: 43/1152 below represent the matching sequence of instant SEQ ID NOs:20/21). Another dsiRNA, designated βc-1821, comprises SEQ ID NOs: 238/1347, which targets 5 nt. downstream of βc-1816.
(S)-Instant SEQ ID NO: 20 - uacuguuggauugauucgaaa
(AS)- Instant SEQ ID NO: 21 UUUCGAAUCAAUCCAACAGUAGC
(S) Brown: SEQ ID NO: 43: ggcuacuguuggauugauucgaaat
(AS)Brown: SEQ ID NO: 1152 -5’ AUUUCGAAUCAAUCCAACAGUAGCCUU
(S) Brown SEQ ID NO: 238 sense: cuguuggauugauucgaaaucuugc
(AS) Brown SEQ ID NO: 1347 (AS): 1 gcaagauuucgaaucaauccaacagua 27
Table 14 (see figure below, right panel) indicates that treatment of dsiRNAs βc-1816 and βc-1821 resulted in ~ 5% of the transcript remaining in human HeLa cells (some dsiRNAs also have corresponding sites in mice CTNNB1 transcript, thus are able to be tested in both mice and humans, such as βc-1821).
PNG
media_image2.png
396
822
media_image2.png
Greyscale
An excerpt of Fig. 3 chart (left panel) shows dsiRNAs oligowalk, i.e. overlapping dsiRNAs tested across a region of CTNNB1 transcript, and each dsiRNA treatment’s respective % mRNA remaining. The chart indicates that there is an accessible region between positions ~1800 - ~2140 (boxed region) of CTNNB1 transcript that allows for dsiRNA binding with very effective inhibition (at least 80% inhibition across the region).
Thus Brown discloses that treatment with βc-1816 and βc-1821 (and βc-1820) result in an efficient inhibition of CTNNB1 transcript and βc-1816 and βc-1821 target the same region targeted by instant SEQ ID NO: 20/21. Fig. 3 indicates that the region between position 1800-2140 of the CTNNB1 transcript that is accessible for binding and consequent inhibition of the transcript.
Further Brown discloses that the dsiRNA can be modified at the 2’-position of the ribose sugar with 2’-fluoro (2F) or 2’-O-methyl (2OMe) modifications and indicates that the “heavily modified duplexes” can be a potent triggers of RNAi in vitro and can improve performance and extend duration of action when used in vivo (par. 298).
Brown does not disclose the inclusion of DNA in βc-1816 and βc-1821, nor the specific 23 nt. antisense length and 21 nt. sense strand, nor the motif of 2OMe, 2F, 2’-deoxy, phosphorothioate, and 5’-vinyl-phosphonate modifications of instant claims.
Regarding the differences in the modification pattern of the sense and antisense strands: Brown does not disclose a specific 23 nt. length antisense strand nor specific 21 nt. length sense strand, nor an exact modification pattern for the sense and antisense strands as instant SEQ ID NOs: 20/21.
Foster demonstrate substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both 23 nt. antisense and 21 nt. sense strands of the siRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract). Foster highlights that modifying the 2’ position of RNA can significantly enhance the stability of oligonucleotides and that the bulky 2OMe has a greater stabilizing effect than the less bulky 2F modification, however, steric bulk, “if not applied judiciously” results in reduction of RNAi activity (pg. 708). Before conducting bench studies, they conducted an in silico analysis based on a dataset of 1,890 duplexes with varying 2F and 2OMe composition across five targets and 15 target sites. The in silico results describing impact of 2F relative to 2OMe at each position in the antisense strand (AS) and sense strand (SS) was generated (Foster’s fig. 1A, B is provided below, and indicates “Negative numbers indicate activity improvement with inclusion of 2’-F relative to 2’-OMe at that position, positive numbers reflect decreased activity. Asterisks (*) indicate significant differences between 2’-F and 2’-OMe at the noted positions” (pg. 709, 710, Fig. 1).
Foster also reduced the overall numbers of 2F with the rationale that 2OMe significantly enhances nuclease stability thus having a greater stabilizing effect while still maintaining inhibitory activity (pg. 708).
Foster: Fig. 1A, B, pg. 710.
PNG
media_image3.png
291
752
media_image3.png
Greyscale
Foster briefly summarizes the in silico data: “Relative to the 5’ end of the respective strand, antisense strand positions 2, 6, and 14 (AS2, AS6, and AS14) as well as sense strand position 11 (S11) were found to exhibit the highest apparent preference for 2’-F” (pg. 709). Using the in silico data as a starting point, since even Foster points out enormous possible permutations for sense and antisense strands (221 and 223, respectively), Foster tested various sense and antisense strands pattern modifications in vitro and in vivo with the aim to identify an optimal 2OMe and 2F modification pattern, while maintaining a low 2F content of a siRNA targeting a murine transthyretin gene (abstract, Fig. 1C, D, and other figures) and antithrombin. Thus, it is known in the art that substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the dsRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract).
Instant antisense has a 2F at position 14, but a deoxyribose at position 2. It is known that deoxyribose, i.e. a H at 2’ position, is a less bulky ribose than a ribose with a 2OMe modification, as evidenced by a Glen Research Report that size of fluorine is between oxygen and hydrogen (pg. 7, 2004 Glen Research Report, 17, pg. 1-12), thus a deoxy modification is less bulky than a 2’ methoxy modification (OCH3) and size wise, closer to a 2F modification.
Regarding PS linkages, Foster introduced PS linkages in the antisense strand between positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23, and for sense strands between positions 1 and 2 and 2 and 3 from 5’ end (all nt. positions are from 5’ end unless indicated otherwise). Foster discloses that PS linkages provide additional protection against 3’ and 5’ exonucleases and thus are placed at terminal ends (pg. 708). Thus modifying with PS linkages at the terminal ends is known in the art.
Regarding the inclusion of DNA nt. in the dsRNA agent, Ui-Tei, conducting a systemic analysis of DNA substitution throughout a siRNA, discloses that similar to nonmodified siRNAs, “nearly all luc gene activity was abolished subsequent to transfection with modified siRNAs with dsDNA substitution < 10 bp (Figure 1C) or 8 bp in length from the 5’ end of the guide strand” (guide strand is equivalent to antisense strand) (pg. 2139). While, DNA substitution only of the passenger strand (i.e. sense strand) had a minimal silencing effect (Figure 1F, 1G, pg. 2139). Ui-Tei disclose that DNA-RNA hybrid is less stable thermodynamically than RNA duplex, and demonstrate that the calculated Tm in the ‘seed’ region of DNA modified siRNA was considerably lower than that of cognate nonmodified siRNA (pg. 2145). Fig. 1E also provides that nt. substitution with DNA up to position 12 from 5’ end of guide strand demonstrates ~80-50% inhibition depending on cell-type. Ui-Tei disclose a reduction in seed-sequence based off-target effect in gene silencing due to transfection with functional DNA-modified siRNAs and demonstrate the decreased off-target effect by genome-wide analysis (pg. 2145-2146. Fig. 6). Thus, replacing RNA with DNA within the seed region of the antisense strand can reduce off-target silencing effects.
Further although Ui-Tei does not specifically address substitution of U for T bases, as evidenced by instant specification that U and T bind to A (pg. 42, line 10), thus U and T are obvious equivalents and not patentably distinct since one can be substituted for the other in terms of base pairing with adenine.
Regarding the 5’-terminal vinyl-phosphonate (VP) at the antisense strand, Parmar discloses a fully modified siRNA duplex targeting several non-β-catenin genes and comprising an antisense strand with an E-vinylphosphonate (VP) modification at the 5’-end, mimicking a 5’-phosphate group, that is more stable and is critical for efficient RISC loading of the antisense strand, shown by improved 5’-VP loading (Table 3, pg. 987) and also enhances the potency of the siRNA, ranging from 3 to 20 fold increase in inhibition in vitro and up to 3-fold increase in inhibition in vivo (Table 2 and Fig. 2, pg. 987).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
First, regarding the length of 23 nt. antisense and 21 nt. sense strand, it would be obvious to try substituting any of the dsiRNA βc-1816 or βc-1821 or βc-1821of Brown and test a 23 nt. antisense and 21 nt. sense duplex in a similar oligowalk method conducted by Brown to identify optimal binding region to the target transcript.
Second, regarding the DNA placements in the siRNA, one of the issues regarding siRNAs is its off-target effects, and Ui-Tei provides that changes up to 12 nt. from the 5’ end of the guide strand results in target inhibition with reduced off-target effects. Thus, a skilled artisan can replace RNA with deoxyribose nucleotides and maintain similar inhibition levels and reduce off-target effects, thus a skilled artisan would introduce deoxyribose modifications within these finite positions of the siRNA duplex.
Third, regarding the modification pattern, Foster recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Also, Ui-Tei discloses that “DNA-RNA hybrid is generally less stable thermodynamically than RNA duplex” (pg. 2145), thus another reason to increase the 2OMe modification content in the siRNA duplex to overcome the decreased stability due to introduction of DNA into the siRNA. Thus, a skilled artisan would try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify dsiRNA βc-1816 or βc-1821of Brown in view of Ui-Tei, Foster and Parmar and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Brown’s βc-1816 or βc-1821 dsiRNA to inhibit β-catenin expression, and of Foster to further optimize a modified siRNA-GalNac duplex with 23 nt. antisense and 21 nt. sense lengths, and of Ui-Tei to incorporate up to 12 nt. modified with deoxyribose in the guide strand from the 5’ end without interfering inhibition levels but reduce off-target effects, and Parmar for introducing a 5’-VP on a siRNA duplex to increase siRNA’s potency up to 3 fold in vivo, a skilled artisan would expect reasonable success in trying to modify the siRNA comprising antisense and sense sequence of βc-1816 and βc-1821 to target CTNNB1 of Brown with 5’-VP of Parmar to increase potency, to try introducing DNA within the siRNA to reduce off-target effects of Ui-Tei, and to try various modification patterns by increasing 2OMe, while reducing 2F content in a 23 nt. antisense and 21 sense strands of Foster. Thus, claim 7 is obvious.
Regarding instant cl. 1, Disclosure concerning cl. 7-15 is noted above. Further Brown discloses in Fig. 1 designing a canonical 21 nt. siRNA. Also Brown contemplates a siRNA molecule consisting of a sense region and an antisense region, where the sense region and the antisense region together forming a duplex of 19-23 base pairs with overhangs (par. 51). Further, along the region spanning the sequence of CTNNB1 targeted by βc-1816 and βc-1821, there is highly efficient inhibition of target transcript.
Brown does not demonstrate a functionality of 23 nt. antisense strand and a 21 nt. sense strand.
Foster discloses efficient functionality of a 23 nt. antisense strand and a 21 nt. sense strand.
Thus, it would be prima facie obvious to substitute the length of modify the βc-1816 and βc-1821 dsiRNAs of Brown to a 23 nt. and 21 nt. antisense and sense strands of Foster and reasonably expect a successful inhibition of CTNNB1 transcript.
Regarding instant cl. 8, Brown discloses a pharmaceutical composition comprising the dsiRNA agent of the invention (par. 347).
Regarding instant cl. 9, 10, 11, 12, 13, Brown discloses a pharmaceutical composition comprising the dsiRNA to be formulated with its intended route of administration and can include sterile diluent such as water or in buffers with acetates, or citrates, including PBS (par. 349-350).
Regarding instant cl. 14, Brown discloses that the dsiRNA is delivered via a lipid nanoparticle formulation (par. 130).
Regarding instant cl. 15, Brown discloses cationic lipids have been shown to enhance the bioavailability of oligonucleotides to cells in culture and dsiRNAs can be complexed with cationic lipids (par. 386).
Claims 16-19, 30 are rejected under 35 U.S.C. 103 as being unpatentable over Brown et al. (US20130109740, pub. 05/02/2013, “Brown”), as evidenced by The Glen Research Report, 2004, 17, 1-12, in view of Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989), as applied to claims 1, 7-14 above, and further in view of Jayaraman et al. (WO2020072324, pub. 04/09/2020, referred as Jayaraman).
Claims 16-19, 30 recite a limitation to pharmaceutical compositions, wherein the lipid is a cationic lipid, with cationic lipid comprising one or more biodegradable group; or lipid comprising the following structure:
PNG
media_image4.png
88
347
media_image4.png
Greyscale
, and a pharmaceutical composition comprising the structure noted earlier, cholesterol, DSPC, and PEG-DMG, and at various ratios, 50:12:36:2.
Disclosure of Brown, Ui-Tei, Foster and Parmar are noted above.
Brown, Ui-Tei and Foster and Parmar do not disclose a cationic lipid comprising biodegradable groups, nor a pharmaceutical composition comprising the following structure
PNG
media_image4.png
88
347
media_image4.png
Greyscale
, cholesterol, DSPC, and PEG-DMG; nor composition with recited ratio of the lipids.
Regarding lipids, Jayaraman et al. (WO2020072324, pub. 04/09/2020) discloses lipid nanoparticles (LNP) composed of biodegradable cationic lipids and other lipid components, such as a neutral lipid, a sterol, and lipid capable of reducing aggregation (e.g. the preferred PEG-DMG) cholesterol, PEG lipids to facilitate transport of nucleic acid agents, such as siRNA (pg. 5) (relevant to instant claims 16); discloses that combination of these lipids exhibit enhanced efficacy for the delivery of an active agent (pg. 6); discloses these LNPs protect the nucleic acid from degradation and clearance in serum, is suitable for systemic delivery, provide intracellular delivery of the nucleic acid and should be well-tolerated with reduced toxicity (pg. 5-6); disclose lipids that are biodegradable cationic lipids for delivery of active agents, including siRNA agents (pg. 5); discloses a formulation AF-070 (see below, a cationic lipid with the same structure as instant structure of claims 17, 18, 19, 30) and a very similar AF-068, which has 4 carbons in the polar amino head group (pg. 46); discloses preparation of LNP comprising AF-070, DSPC, PEG-DMG, and cholesterol, along with the ratios tested (see below for excerpt of Ex. 5, pg. 46) (relevant to instant claim 18, 19, 30).
PNG
media_image5.png
116
383
media_image5.png
Greyscale
PNG
media_image6.png
250
216
media_image6.png
Greyscale
The results demonstrated a dose-dependent inhibition with siRNA targeting factor VII protein (see Fig. 4, Example 4, excerpts of fig. 4 above); further testing of siRNA-LNP formulations (including AF-070) targeting liver-produced F12 protein in non-human primates also showed maximum inhibition of about 80-90% at day 15 after single-dose treatment (see Example 5, Figure 5); Jayaram discloses the molar lipid ratio with regard to mol% cationic lipid/DSPC/Chol/PEG-DMG ranging from approximately 40/10/30/5, 35/15/40/10 or 52/12/30/5 (pg. 31) (relevant to instant claim 19, 30).
MPEP 2144.05(I) provides that a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap but are merely close. Here, the claimed ratio is 50:12:36:2, which is close to ranges in Jayaram, therefore a prima facie case of obviousness.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the dsiRNA of βc-1816 or βc-1821 targeting β-catenin into a canonical siRNA as taught by Brown in view of Jayaraman and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Jayaraman, one of ordinary skill in the art would have been motivated to combine prior arts and deliver a siRNA or dsiRNA of Brown using the LNP formulated with cationic lipid recited in claims 17, 18 and DSPC, PEG-DMG and cholesterol in the ratios recited for improved delivery to target cells in non-human primates as taught by Jayaraman. Thus, claims 16-19, 30 are obvious.
Response to Arguments
Applicant’s arguments, see pg. 7-13, filed 07/15/2026, with respect to the rejection(s) of claims 1, 7-30 under 103 have been fully considered and are persuasive. Therefore, the rejection in view of Flynn has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made as noted above.
The Remarks indicate that the secondary references fail to teach the specific sequence since Flynn does not apply.
Here, the Brown reference teaches the specific sequence and based on the teaching of Brown a skilled artisan would try to modify the dsiRNA based on the teachings of Ui-Tei, Foster, and Parmar.
Citation of Relevant Prior Art
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Canonical: US8518907B2, issued 8/27/2013, to Sirna Therapeutics, a subsidiary of Alnylam, in IDS.
‘907 discloses sense strand SEQ ID NO: 5: cuguuggauugauucgaaa (a 19 nt. sequence matching instant SEQ ID NO: 20 from position 3-21) and antisense strand SEQ ID NO: 4918: uuucgaaucaauccaacag (a 19 nt. sequence matching instant SEQ ID NO: 21, pos. 1-19). ‘907 discloses testing siRNAs comprising SEQ ID NO: 5/4918 with various different modification patterns, and is designated as R-008362791-000B, or R-008380929-000H or R-008488882-000B, depending on the modification pattern (they tested various other ones too). This duplex is a preferred siRNA since its successful in vitro, in vivo in mice and rhesus monkey.
Canonical: US9,850,491B2, issued 12/26/2017, in IDS.
‘491 claims SEQ ID NO: 5 and 4918, noted above.
Modified form: WO2019217459, pub. 11/14/2019, of Alnylam, in IDS: sequences in Table 1a targeting CTNNB1 (pg. 220-222, and its results illustrated in Fig. 4): these are all variants of the sense strand: uacuguuggauugauucgaaatt; and antisense strand of tuucgaaucaauccaacaguagc; both are 23 nt. in length.
Modified/non-canonical: US9896688A1, issued 02/20/2018, SEQ ID NO: 1-40, which are all a variant of uuucgaaucaauccaacaguu and are single-stranded siRNAs of 21 nt. The patent compares the effects of 2’-5’ internucleotide linkage along with serial DNA substitution at each site, and various 5’-cap moieties, including 5’-VP (see Tables 1-6, 14).
Double Patenting
The rejection of claims is maintained.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
App: 18/405,072
Claims 1, 7-19, 30 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 77, 45, 46, 55-60, 95 of copending Application No. 18/405,072 (“Alnylam”). Although the claims at issue are not identical, they are not patentably distinct from each other.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
Alnylam is not a divisional of instant application.
Alnylam claims 77, 45, 46 corresponds to instant cl. 1, 7, 8-13, since Alnylam claim 45 and 46 teaches SEQ ID NO: 20 and 21 that are identical to instant SEQ ID NO: 20 and 21. Phosphate buffers and sterile water are well known in the art as diluent or as pharmaceutical composition for RNA.
Alnylam claims 77, 55-60 correspond to instant cl. 14-19, 30, since Alnylam claim 55 teaches cationic lipid, and claim 60 teaches the following:
PNG
media_image7.png
133
499
media_image7.png
Greyscale
.
Claim 77 teaches a method of inhibition of CTNBB1 gene in a cell comprising contacting the cell with dsRNA within Tables 2, 3, 5, or 6 and one of the dsRNA in the claimed tables is of Alnylam claim 45.
Alnylam claim 95, reciting Table 3, which includes SEQ ID NO: 20 and 21, also corresponds to instant cl. 1, 7.
App: 19/467,969
Claims 1, 7, 8-10, 14 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 10,11, 68 of copending Application No. 19/467,969 (‘969). Although the claims at issue are not identical, they are not patentably distinct from each other.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Regarding instant cl. 1, 7, claim 1 of ‘969 teaches a method of treating a subject with cancer by administering following dsRNA targeting CTNNB1:
PNG
media_image8.png
146
550
media_image8.png
Greyscale
SEQ ID NOs: 823 and 1164 are identical to instant SEQ ID NOs: 20 and 21, respectively. Since a subject comprises of cells, the claim 1 of ‘969 corresponds to instant cl. 1, 7 and method claims administering a product are not patentably distinct from said product.
Regarding instant cl. 8, pharmaceutically acceptable carrier is broadly defined by instant specification to include “pharmaceutically-acceptable composition” and that “each carrier must be ‘acceptable’ in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject” (pg. 24, line 37 to pg. 25, line 4) and carrier includes (i) at least one “backbone attachment point” and one “tethering attachment point” (TAP), which, respectively, include sulfur containing backbone of a ribonucleic acid and a constituent ring atom of the cyclic carrier, i.e. a RNA with a sulfur containing internucleotide linkage (pg. 49, lines 5-28). Here, the dsRNA agent (SEQ ID NO: 823/1164) comprises multiple internucleotide linkages comprising phosphorothioate linkages bound to a RNA.
Regarding instant cl. 9, 10, pharmaceutical composition of ‘969 includes diluent such as sterile water (pg. 89, line 38, spec of 04/23/26).
Regarding instant cl. 14, cl. 11 of ‘969 teaches a pharmaceutical composition comprises a lipid.
Regarding instant cl. 11, 12, 13,
Claims 11-13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 8 of copending Application No. 19/467,969 in view of Brown et al. (US20130109740, pub. 05/02/2013, “Brown”).
‘969 claims do not teach specific buffer solution.
The buffers claimed are known in the art and are common, including PBS. Brown discloses a pharmaceutical composition comprising the dsiRNA to be formulated with its intended route of administration and can include sterile diluent such as water or in buffers with acetates, or citrates, including PBS (par. 349-350). Thus, the claims would be prima facie obvious.
Regarding instant cl. 15-19, 30,
Claims 15-19, 30 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 8 of copending Application No. 19/467,969 in view of Jayaraman et al. (WO2020072324, pub. 04/09/2020, referred as Jayaraman).
‘969 claims do not teach the composition of cl. 15-19, and 30.
Regarding the lipids, Jayaraman et al. (WO2020072324, pub. 04/09/2020) discloses lipid nanoparticles (LNP) composed of biodegradable cationic lipids and other lipid components, such as a neutral lipid, a sterol, and lipid capable of reducing aggregation (e.g. the preferred PEG-DMG) cholesterol, PEG lipids to facilitate transport of nucleic acid agents, such as siRNA (pg. 5) (relevant to instant claims 15, 16); discloses that combination of these lipids exhibit enhanced efficacy for the delivery of an active agent (pg. 6); discloses these LNPs protect the nucleic acid from degradation and clearance in serum, is suitable for systemic delivery, provide intracellular delivery of the nucleic acid and should be well-tolerated with reduced toxicity (pg. 5-6); disclose lipids that are biodegradable cationic lipids for delivery of active agents, including siRNA agents (pg. 5); discloses a formulation AF-070 (see below, a cationic lipid with the same structure as instant structure of claims 17, 18, 19, 30) and a very similar AF-068, which has 4 carbons in the polar amino head group (pg. 46); discloses preparation of LNP comprising AF-070, DSPC, PEG-DMG, and cholesterol, along with the ratios tested (see below for excerpt of Ex. 5, pg. 46) (relevant to instant claim 18, 19, 30).
PNG
media_image5.png
116
383
media_image5.png
Greyscale
PNG
media_image6.png
250
216
media_image6.png
Greyscale
The results demonstrated a dose-dependent inhibition with siRNA targeting factor VII protein (see Fig. 4, Example 4, excerpts of fig. 4 above); further testing of siRNA-LNP formulations (including AF-070) targeting liver-produced F12 protein in non-human primates also showed maximum inhibition of about 80-90% at day 15 after single-dose treatment (see Example 5, Figure 5); Jayaram discloses the molar lipid ratio with regard to mol% cationic lipid/DSPC/Chol/PEG-DMG ranging from approximately 40/10/30/5, 35/15/40/10 or 52/12/30/5 (pg. 31) (relevant to instant claim 19, 30).
MPEP 2144.05(I) provides that a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap but are merely close. Here, the claimed ratio is 50:12:36:2, which is close to ranges in Jayaram, therefore a prima facie case of obviousness.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the dsRNA agent of ‘969 in view of Jayaraman and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Jayaraman, one of ordinary skill in the art would have been motivated to combine dsRNA taught by ‘969 using the LNP formulated with cationic lipids, DSPC, PEG-DMG and cholesterol in the ratios showing improved delivery to target cells in non-human primates as taught by Jayaraman. Thus, claims 15-19, 30 would be prima facie obvious.
This is a provisional nonstatutory double patenting rejection.
Response to Arguments
Applicant's arguments filed 07/15/2026 have been fully considered but they are not persuasive. The Remarks indicate that following a notice of allowance, the Applicant will consider submitting, if appropriate, a terminal disclaimer (pg. 13).
The argument is not persuasive and the rejection is maintained.
Allowable Subject Matter
No claim allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights