DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1, 7-19, 30 and species of phosphate (cl. 12) are pending and examined here.
Priority
The claim to benefit of 63/224,901 and 63/293,851, filed on 07/23/2021 and 12/27/2021, respectively, via their CON applications of 18/405072 and PCT/US22/37794, filed on 01/05/2024 and 07/21/2022, is recognized.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed applications, provisional application Nos. 63/224,901 and 63/293,851, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Priority is a claim by claim analysis. Here, claims 1, 7-15 will receive the benefit of 07/23/2021, while claims 16-19, 30 will receive the benefit of 12/27/2021. The SEQ ID NO: 20 and 21 along with its modification pattern is disclosed in 63/224,901 (see pg. 140, AD-1548488.1) and cationic lipid as a drug delivery system is disclosed (pg. 96), while the lipid structure of claims 17-19, and 30 is not disclosed in the 63/224,901, but is claimed and disclosed in 63/293,851 (see cl. 66). While the biodegradable limitation is not disclosed in 63/224,901 and not all cationic lipids are biodegradable, thus claims 16 and their dependent claims (17-19) will receive the benefit of 12/27/2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 03/13/2026 were filed after the mailing date of prior Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 103
Rejection of claims 1, 7-19, 30 under 103 is maintained.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 7-14 are rejected under 35 U.S.C. 103 as being unpatentable over Flynn et al. (US20220387607, pub. 12/08/2022, EFD: 4/23/2021, referred as Flynn) and Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989).
The claimed SEQ ID NOs: 20 and 21 are the following sequences:
5′-usascuguugGfAfUfugauucgasasa-3′: SEQ ID NO: 20, a 21 nt. sense strand
5′-VPudTucdGadAucaadTcCfaacaguasgsc-3′: SEQ ID NO: 21, a 23 nt. antisense strand.
Flynn discloses glycan modified siRNAs targeting β-catenin (title, par. 41) and discloses SEQ ID NOS: 3 and 4 (Table 1, par. 151, see alignment below).
Instant SEQ ID NO: 21 1 uTucGaAucaaTccaacaguagc 23
|:|||||||||:|||||||||||
SEQ ID NO: 3 1 UUUCGAAUCAAUCCAACAGUAGC 23
Instant SEQ ID NO: 20 - 1 uacuguuggauugauucgaaa 21
|||||||||||||||||||||
SEQ ID NO: 4 1 UACUGUUGGAUUGAUUCGAAA 21
Flynn’s SEQ ID NO: 4 comprises the unmodified nucleobase sequence of the instant sense strand SEQ ID NO: 20, while Flynn’s SEQ ID NO: 3 has two nucleobase differences from instant antisense SEQ ID NO: 21, see 2nd and 12th T position of instant SEQ ID NO: 21 on alignment above, and also instant SEQ ID NO: 21 has internal DNAs (i.e. deoxynucleotide, underlined) at positions 2, 5, 7, 12 (all position #s in the action are from 5’ end of the sense or antisense strand, unless otherwise noted). Flynn discloses glycan modification aids in stability and delivery of the siRNA when bound at a terminal end (par. 10, 14); discloses optional alternating 2’-O-methyl (2OMe) and 2’-fluoro (2F) modification of the siRNA duplex along with 2 phosphorothioate (PS) linkage at both 5’ and 3’ ends of AS end and 2 PS linkages at 5’ end of the sense strand along with Cy5 and DBCO modification at each end (Table 1, par. 151); discloses pharmaceutical composition comprising modified RNA with an acceptable carrier (par. 247) (relevant to cl. 8); discloses water as sterile diluent or buffers of acetates, citrate, or phosphates (par. 249) (relevant to cl. 9-12); discloses PBS as carrier (par. 250) (relevant to cl. 13); although Flynn discloses that lipid nanoparticle (LNP) is not necessary (par. 46), Flynn also discloses a pharmaceutical composition with the use of LNP (par. 272) (relevant to cl. 14, 20-24). Further, Flynn’s Fig. 14 discloses that both conjugated and unconjugated “I-1 duplex” (apparently SEQ ID NO: 3/4) inhibited ~75% of β-catenin expression.
Flynn does not disclose the modification pattern of instant SEQ ID NO: 20 and 21, nor the 4 internal deoxyribonucleotides in the antisense strand, nor the VP at the 5’ end of the antisense strand.
Regarding the inclusion of DNA nt. in the dsRNA agent, Ui-Tei, conducting a systemic analysis of DNA substitution throughout a siRNA, discloses that similar to nonmodified siRNAs, “nearly all luc gene activity was abolished subsequent to transfection with modified siRNAs with dsDNA substitution < 10 bp (Figure 1C) or 8 bp in length from the 5’ end of the guide strand” (guide strand is equivalent to antisense strand) (pg. 2139). While, DNA substitution only of the passenger strand (i.e. sense strand) had a minimal silencing effect (Figure 1F, 1G, pg. 2139). Ui-Tei disclose that DNA-RNA hybrid is less stable thermodynamically than RNA duplex, and demonstrate that the calculated Tm in the ‘seed’ region of DNA modified siRNA was considerably lower than that of cognate nonmodified siRNA (pg. 2145). Fig. 1E also provides that nt. substitution with DNA up to position 12 from 5’ end of guide strand demonstrates ~80-50% inhibition depending on cell-type. Ui-Tei disclose a reduction in seed-sequence based off-target effect in gene silencing due to transfection with functional DNA-modified siRNAs and demonstrate the decreased off-target effect by genome-wide analysis (pg. 2145-2146. Fig. 6). Thus, replacing RNA with DNA within the seed region of the antisense strand can reduce off-target silencing effects.
Further although Ui-Tei does not specifically address substitution of U for T bases, one of skill in the art understands, U and T are obvious equivalents and not patentably distinct since one can be substituted for the other and either’s complementary base is adenine.
Regarding the differences in the modification pattern of the sense and antisense strands: Flynn and Ui-Tei do not disclose a sense strand with an exact modification pattern for the sense and antisense strands as instant SEQ ID NOs: 20/21.
Foster demonstrate substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the dsRNA siRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract). Foster highlights that modifying the 2’ position of RNA can significantly enhance the stability of oligonucleotides and that the bulky 2OMe has a greater stabilizing effect than the less bulky 2F modification, however, steric bulk, “if not applied judiciously” results in reduction of RNAi activity (pg. 708). Before conducting bench studies, they conducted an in silico analysis based on a dataset of 1,890 duplexes with varying 2F and 2OMe composition across five targets and 15 target sites. The in silico results describing impact of 2F relative to 2OMe at each position in the antisense strand (AS) and sense strand (SS) was generated (Foster’s fig. 1A, B is provided below, and indicates “Negative numbers indicate activity improvement with inclusion of 2’-F relative to 2’-OMe at that position, positive numbers reflect decreased activity. Asterisks (*) indicate significant differences between 20-F and 20-OMe at the noted positions” (pg. 709, 710, Fig. 1).
Foster also reduced the overall numbers of 2F with the rationale that 2OMe significantly enhances nuclease stability thus having a greater stabilizing effect while still maintaining inhibitory activity (pg. 708).
Foster: Fig. 1A, B, pg. 710.
PNG
media_image1.png
291
752
media_image1.png
Greyscale
Reviewing Foster’s sense strand data of Fig. 1B, it appears that although there are significant inhibition differences between 2OMe and 2F at various positions, except for position 11 of sense strand (Fig. 1B), which has a strong (and a significant) preference for 2F, there is not a strong preference for 2OMe or 2F along the sense strand. Here, both instant and Flynn’s sense strand have a 2F at position 11. Similarly reviewing the antisense strand data of Fig. 1A, there is a strong (and significant) preference for 2F at pos. 2 and 14, and a strong preference for 2OMe at position 21. Here Flynn’s antisense strands have 2F at pos. 2 and 14. Using the in silico data as a starting point, since even Foster points out enormous possible permutations for sense and antisense strands (221 and 223, respectively), Foster tested various sense and antisense strands pattern modifications in vitro and in vivo with the aim to identify an optimal 2OMe and 2F modification pattern, while maintaining a low 2F content of a siRNA targeting a murine transthyretin gene (abstract, Fig. 1C, D, and other figures) and antithrombin. Thus, it is known in the art that substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the dsRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract).
Instant antisense has a 2F at position 14, but a deoxyribose at position 2. It is known that deoxyribose lacking an hydroxyl at position 2 is also a less bulky ribose than a ribose with a bulky 2OMe modification, and thus is essentially similar to a 2F modification.
Regarding PS linkages, Foster introduced PS linkages in the antisense strand between positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23, and for sense strands between positions 1 and 2 and 2 and 3 from 5’ end (all nt. positions are from 5’ end unless indicated otherwise). Foster discloses that PS linkages provide additional protection against 3’ and 5’ exonucleases and thus are placed at terminal ends (pg. 708). Thus modifying with PS linkages at the terminal ends is known in the art.
Regarding the 5’-terminal vinyl-phosphonate (VP) at the antisense strand, Parmar discloses a fully modified siRNA duplex targeting several non-β-catenin genes and comprising an antisense strand with an E-vinylphosphonate (VP) modification at the 5’-end, mimicking a 5’-phosphate group, that is more stable and is critical for efficient RISC loading of the antisense strand, shown by improved 5’-VP loading (Table 3, pg. 987) and also enhances the potency of the siRNA, ranging from 3 to 20 fold increase in inhibition in vitro and up to 3-fold increase in inhibition in vivo (Table 2 and Fig. 2, pg. 987).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
First, regarding DNA placements in the siRNA, one of the issues regarding siRNAs is its off-target effects, and Ui-Tei provides that changes up to 12 nt. from the 5’ end of the guide strand results in target inhibition with reduced off-target effects. Thus, a skilled artisan can replace RNA with deoxyribose nucleotides and maintain similar inhibition levels and reduce off-target effects, thus a skilled artisan would introduce deoxyribose modifications within these finite positions of the siRNA duplex.
Second, regarding the modification pattern, Foster recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Also, Ui-Tei discloses that “DNA-RNA hybrid is generally less stable thermodynamically than RNA duplex” (pg. 2145), thus another reason to increase the 2OMe modification content in the siRNA duplex to overcome the decreased stability due to introduction of DNA into the siRNA. Thus, a skilled artisan would try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify the glycan-modified duplex SEQ ID NO: 3&4 targeting β-catenin of Flynn in view of Ui-Tei, Foster and Parmar and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Flynn’s SEQ ID NO: 3/4 to inhibit b-catenin expression, and of Ui-Tei to incorporate up to 12 nt. modified with deoxyribose in the guide strand from the 5’ end without interfering inhibition levels but reduce off-target effects, and of Foster to further optimize a modified siRNA-GalNac duplex, and Parmar for introducing a 5’-VP on a siRNA duplex to increase siRNA’s potency up to 3 fold in vivo, a skilled artisan would expect reasonable success in modifying the siRNA comprising SEQ ID NO: 3/4 targeting b-catenin of Flynn with 5’-VP to increase potency, introducing DNA within the siRNA to reduce off-target effects, and to try various modification patterns by increasing 2OMe, while reducing 2F content. Thus, claims 1, 7-14 are obvious.
Claims 15-19, 30 are rejected under 35 U.S.C. 103 as being unpatentable over Flynn et al. (US20220387607, pub. 12/08/2022, EFD: 4/23/2021, referred as Flynn) and Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989), as applied to claims 1, 7-14 above, and further in view of Jayaraman et al. (WO2020072324, pub. 04/09/2020, referred as Jayaraman).
Claims 15-19, 30 recite a limitation to pharmaceutical compositions, wherein the lipid is a cationic lipid, with cationic lipid comprising one or more biodegradable group; or lipid comprising the following structure:
PNG
media_image2.png
88
347
media_image2.png
Greyscale
, and a pharmaceutical composition comprising the structure noted earlier, cholesterol, DSPC, and PEG-DMG, and at various ratios, 50:12:36:2.
Disclosure of Flynn, Ui-Tei, Foster and Parmar are noted above.
Flynn, Ui-Tei and Foster and Parmar do not disclose cationic lipid, nor a biodegradable lipid, nor a pharmaceutical composition comprising the following structure
PNG
media_image2.png
88
347
media_image2.png
Greyscale
, cholesterol, DSPC, and PEG-DMG; nor composition with recited ratio of the lipids.
Regarding lipids, Jayaraman et al. (WO2020072324, pub. 04/09/2020) discloses lipid nanoparticles (LNP) composed of biodegradable cationic lipids and other lipid components, such as a neutral lipid, a sterol, and lipid capable of reducing aggregation (e.g. the preferred PEG-DMG) cholesterol, PEG lipids to facilitate transport of nucleic acid agents, such as siRNA (pg. 5) (relevant to instant claims 15, 16); discloses that combination of these lipids exhibit enhanced efficacy for the delivery of an active agent (pg. 6); discloses these LNPs protect the nucleic acid from degradation and clearance in serum, is suitable for systemic delivery, provide intracellular delivery of the nucleic acid and should be well-tolerated with reduced toxicity (pg. 5-6); disclose lipids that are biodegradable cationic lipids for delivery of active agents, including siRNA agents (pg. 5); discloses a formulation AF-070 (see below, a cationic lipid with the same structure as instant structure of claims 17, 18, 19, 30) and a very similar AF-068, which has 4 carbons in the polar amino head group (pg. 46); discloses preparation of LNP comprising AF-070, DSPC, PEG-DMG, and cholesterol, along with the ratios tested (see below for excerpt of Ex. 5, pg. 46) (relevant to instant claim 18, 19, 30).
PNG
media_image3.png
116
383
media_image3.png
Greyscale
PNG
media_image4.png
250
216
media_image4.png
Greyscale
The results demonstrated a dose-dependent inhibition with siRNA targeting factor VII protein (see Fig. 4, Example 4, excerpts of fig. 4 above); further testing of siRNA-LNP formulations (including AF-070) targeting liver-produced F12 protein in non-human primates also showed maximum inhibition of about 80-90% at day 15 after single-dose treatment (see Example 5, Figure 5); Jayaram discloses the molar lipid ratio with regard to mol% cationic lipid/DSPC/Chol/PEG-DMG ranging from approximately 40/10/30/5, 35/15/40/10 or 52/12/30/5 (pg. 31) (relevant to instant claim 19, 30).
MPEP 2144.05(I) provides that a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap but are merely close. Here, the claimed ratio is 50:12:36:2, which is close to ranges in Jayaram, therefore a prima facie case of obviousness.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the glycan-modified duplex targeting b-catenin of Flynn in view of Jayaraman and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Jayaraman, One of ordinary skill in the art would have been motivated to combine prior arts and deliver the modified ASO of Flynn using the LNP formulated with cationic lipid recited in claims 17, 18 and DSPC, PEG-DMG and cholesterol in the ratios recited for improved delivery to target cells in non-human primates as taught by Jayaraman. Thus, claims 15-19, 30 are obvious.
Response to Arguments
Applicant's arguments filed 03//31/3026 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks insist on the following:
The main contention is that none of the art cited by Examiner teaches or suggests the claimed invention comprising a specific combination of nucleobases and a specific combination of nucleotide modifications, and a skilled artisan would not reasonably expect success in modifying siRNA of Flynn to produce the claimed dsRNA agents based on the combined teachings of Ui-Tei, Foster and Palmar (pg. 18).
The Remarks point out the differences that are also noted in the action:
Pg. 10-11 point out the differences between instant claimed compound and that of the Flynn (although the Remarks indicate colored objects, they are not visible as so). But the arrows indicate the 23 differences between Flynn's dsRNA compound and claimed dsRNA compound (see pg. 11), including modification pattern comprising 2OMe, 2F, 2H, PS-linkages, and a phosphate mimic.
The Remarks also provide a comparison of a mixed RNA/DNA siRNA and dsRNA compound of same sequence. AD-1548488 (“AD-’488”) compound, which is the claimed dsRNA SEQ ID NO, is different from a similar compound AD70947 (“AD-’947”), which does not replaces the 4 DNA nt. of AD-1548488 with their respective equivalent RNA nt. The Remarks point out that the mixed DNA/RNA dsRNA compound "differ in their ability to inhibit CTNNB1 expression" in vitro (pg. 9, see Table of pg. 9).
The prior art references teaching would not have led to the claimed compound:
The rejection is based on "impermissible hindsight reconstruction" using the claimed product "as a blueprint to identify references" (pg. 11, 20-21).
Second, the Remarks argue that Ui-Tei teaches away. Ui-Tei reference teaches the effect of replacing RNA nucleotides with deoxynucleotides incrementally (in blocks) and after a certain point (position 10) on the antisense strand, a modification to deoxynucleotide results in "inferior activity" (pg. 12-13).
Compares Flynn's product v. instant cl. Product specifically focusing on 2OMe and 2F nt. modification pattern (pg. 13).
First, noting that since siRNA of Flynn already includes all three of the critical, preferred 2F modifications at positions AS2, AS14 and S11 as taught by Foster, there would have been "absolutely no motivation for one of ordinary skill in the art to 'optimize' or change the modifications of the Flynn siRNA based on the teachings of Foster" (pg. 14). The claimed product does not have a 2F at AS2 position but rather a 2’-H (a deoxyribonucleotide), which Foster does not teach.
Second, the modification pattern of instant claimed product is distinct from prior art references, and identifies 19 differences between instant claimed product and Flynn’s mostly alternating 2F/2OMe pattern (pg. 14, and see figure of pg. 10-11 for comparison).
Third, Foster does not teach replacing 2F modification with deoxyribonucleotide modification. Further the action’s claim that deoxyribose modification (2’-H or 2H) is 'essentially similar' to 2F has no basis in Foster or any other cited references, and then poses a rhetorical question (why not replace all nt. with DNA modifications if they are essentially similar), which will be ignored (pg. 14-15).
Fourth, the Remarks claim that "Examiner is making conclusory statements, based not on the teachings of the cited reference but, rather, on the Examiner's own scientific judgment" (pg. 15).
Regarding the vinylphosphonate (VP) modification at the 5' end of the guide strand, the Remarks insist that the art is unpredictable noting that 1) the Ago2 binding based on 5’-VP is sequence dependent, 2) a skilled artisan would not have been able to predict a priori that addition of a 5’-VP modification to the antisense strand of any siRNA would provide a benefit in activity since it is sequence dependent, by focusing on a conjugate 5 results (pg. 16).
The "obvious to try" standard is applied improperly (pg. 17).
The argument is that modifying Flynn's product to arrive at the claimed dsRNA agent, there were neither a "finite number of identified, predictable solutions" nor a "reasonable expectation of success", pointing to the 3 possible modification at each position and total of 44 nt., there are 344 (9.8 X 1020) permutations of siRNAs that are possible (pg. 17). Since the art is unpredictable, it would have been "to difficult to predict a priori the effect of a given combination of nucleotide modifications" (pg. 18).
The Remarks insist that the unexpected results are commensurate in scope.
Flynn's higher dose of 50 nM results in about 80% knockdown of CTNNB1, while a 500 fold lower dose of duplex AD-‘488 (0.1 nM) in Hep3b cells resulted in 90% knockdown and this improvement could not have been predicted based on the prior art references cited.
Regarding rejection of claims 15-19, focusing on Jayaraman reference, the Remarks reiterate the argument noted in prior action (pg. 18-19).
The argument is not persuasive.
First, addressing the improper hindsight argument and copied from previous action: In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Here, the disclosure of the secondary references in combination with the Flynn make the claimed subject matter obvious. Here, Flynn teaches similar siRNA complex comprising an identical sense sequence and similar antisense sequence that is able to bind to an accessible region of the β-catenin transcript through a Watson-Crick binding to silence its expression, which is the aim of the claimed subject matter. Ui-Tei teaches that replacing RNA with DNA in the siRNA duplex is a “powerful tool for mammalian gene silencing with significantly reduced off-target effect” (title). Foster teaches that even fully modified siRNA can be optimized to improve its in vivo potency. Parmar teaches the vinylphosphonate at 5’ end (5’-VP) of the antisense strand also improves potency. Jayaraman teaches a LNP comprising claimed lipids that aid in delivery of siRNA cargo. Since each of the art demonstrates efficiency of its teaching, i.e. Flynn demonstrates that siRNA of SEQ ID NOs: 3/4 is a potent inhibitor of CTNNB1 expression and the other modifications taught improve the siRNA, thus a skilled artisan would reasonably expect success when the teachings are combined. All the cited references predate the instant applicant’s disclosure.
The differences in AD-’947 and AD-’488 will be used as a basis to respond to the Remarks. Both AD-’947 and AD-’488 inhibit the expression of CTNNB1, although to a different degree. The difference in potency is not an issue of unpredictability but rather a variance in potency based on different modification patterns. It should be noted that AD-’947 has a sense strand with 1 more 2F modified nt. than that of AD-’488, while the antisense strand of AD-’947 have various differences in the modification pattern, including the lack of DNA modified nt., increased PS-linkages, and an increased 2F content (6 nt.) compared to AD-’488 (1nt.). The results of AD-‘488 support the observation of Foster, that increased 2OMe content and decreased 2F content improves potency (AD-‘488 has thirty-six 2OMe modifications, AD-’947 has thirty-four, see gray highlighted nt. represents 2OMe below).
PNG
media_image5.png
193
620
media_image5.png
Greyscale
Alternatively, the differences in the modification patterns between the two compounds raise another point: whether it was solely the incorporation of the DNA that increased the potency or are other changes that influenced the increased potency. It can be suggested that AD-’488’s two more 2OMe modifications than AD-’947 provided further stability, as taught by Foster, and thus a skilled artisan would reasonably expect success. Thus the increased activity was not unpredictable.
Here, although AD-’947 is less potent, it still inhibited the expression of the target transcript. Highlighting that the targeted region of the transcript is accessible and results in silencing of the transcript. The standard for obviousness is not an absolute certainty for expectation of success. Here a skilled artisan would reasonably expect success that modifying siRNA of Flynn based on the teachings of the cited references will result in comparable or even better inhibition of target transcript.
Addressing argument 3(a), Ui-Tei does not teach away. First, although the modification are “in-blocks,” Ui-Tei demonstrates synthesis of mixed DNA/RNA nucleotide siRNA compound and that any position of the siRNA can be modified with a DNA instead of a RNA, and that the incorporation can be beneficial by reducing off-target effects. Second, Ui-Tei synthesized six different types of siRNA constructs and thus the claimed product needs to be compared to the results of the appropriate construct.
The Remarks argue that based on Ui-Tei, a skilled artisan would make deoxyribose modifications in blocks of positions 1-8 of the guide strand and not beyond position 10. This is very narrow reading of Ui-Tei. Ui-Tei specifically notes “ribonucleotides were progressively replaced with cognate deoxyribonucleotide,” i.e. each individual position was progressively substituted, thus a skilled artisan understands that each position can be individually replaced. The extent of the “5’-end” of the guide (antisense) strand that can be successfully replaced would require review of Fig. 1E. When only the guide strand is modified with DNA, while the passenger (sense) strand remains RNA, the results are a bit different and depend on cell type. The results of Fig. 1E demonstrate ~50% inhibition can extend up to position 12 of progressive DNA replacement in all cell types, and even up to position 15 from the 5’ end depending on the cell type, see red line in Fig. 1E (also noted in the prior action, pg. 5).Then the Remarks point to where the siRNA activity is abolished following DNA substitution “with dsDNA substitution ≤10 bp (Figure 1C) or 8bp (Figure S1B),” which is the observation when both strands are simultaneous modified with DNA (see Fig. 1C and Fig. S1B). Here, the claimed product reflects the product of a single, antisense strand that is modified at 5’ end (i.e. of Fig. 1E, and not of Fig. 1C or Fig. S1B).
Addressing the argument of Parmar reference (3d), Parmar’s main contention is that a 5’-phosphate (5’-P) group at the 5’-end of antisense strand of a siRNA “is critical for efficient RISC loading” (abstract). Although the Remarks point out that for conjugate 6 the results of 5’-VP are comparable to control, for the majority of the conjugates, an addition of the 5’-phosphate mimic increases the inhibitory activity of conjugates (see Table 2, Fig. 2 of all 4 conjugates), increases the Ago2 loading (see Fig. 3B) and increases the overall liver amount of siRNA across all the conjugates (see Fig. 3A). Parmar observes that 5’-VP also “provides additional protection against exonucleases, thereby improving overall metabolic stability” (pg. 987, 1st full paragraph). Thus, a skilled artisan would reasonably expect success by addition of 5’-VP and, based on the results of Parmar, would not expect a loss of activity. Thus, its results are not unpredictable.
Addressing the Foster reference along with obvious to try arguments, the Remarks arguments are appreciated, as noted in Foster, that there is “a degree of chemistry interdependence” across the modified sense and antisense strands and that the position effect of 2’-modification on activity cannot be considered in isolation. Nevertheless, Foster demonstrates the ability to alter a modification pattern and still “further improve in vivo performance of GalNAc-siRNA conjugates” (title). As noted in previous action, Foster also recognized the “complexity of the design space even for two 2’ modifications (with 221 and 223 [244] possible permutations for sense and antisense, respectively” (pg. 709) but managed the complexity by leveraging in silico analysis and by conducting additional in vitro studies (Fig. 1C, D) to confirm the critical positions that prefer a 2F modification and the strand interdependence (Fig. 2). Foster demonstrates multiple new modification patterns that resulted in improved activity (i.e. designated as “DV18” and “DV22” patterns, see Fig. 2C, and Fig. 3, 4 for in vivo studies across different genes).
The Remarks argue that “there would have been absolutely no motivation” for a skilled artisan to “optimize” or change the modification of Flynn’s SEQ ID NOs: 3/4 since they already have the preferred 2F modification at the critical position of AS2/AS14 and S11. However, DV18/DV22 modification pattern have those critical features and increased the 2OMe content compared to parent and demonstrate improved activity. Thus, Foster teaches that a skilled artisan can adjust the 2’-ribose modification at non-critical positions to increase the content of 2OMe modifications and successfully achieve improved siRNAs.
Thus, the use of obvious to try rationale is appropriate since, as also noted by Foster, it is also the overall content of 2OMe content. Foster indicates a balance of increasing 2OMe content relative to 2F content to improve binding stability. Thus, the finite options are using only the 2OMe or 2F modification to increase the 2OMe content, while ensuring appropriate 2OMe and 2F preference at critical positions (AS2/AS14 and S11). Here, a skilled artisan would reasonably expect success by trying to increase the number of 2OMe content in a siRNA of Flynn.
The Remarks also raise the issue that Foster does not discuss DNA incorporation. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Here, Ui-Tei provides rationale for decreased off-target effects for using mixed DNA/RNA siRNA.
Addressing the “2H is essentially similar” to 2H, it is known in the art that fluoro size is in between to an oxygen and a hydrogen (pg. 7, 2004 Glen Research Report, 17, pg. 1-12). Foster’s statement that “2’-OMe, can have a greater stabilizing effect compared to less bulky modifications, such as 2’-F” (pg. 708); thus similar to 2F, a 2’-H (2H) modification would be less bulky than 2’-OMe. Thus, a 2H modification (i.e. DNA) is similar (“essentially similar”) to 2F in that it is less bulky than 2OMe, and similar to a 2F at position 2 of antisense strand, would allow for processing by RISC machinery. Here, the claimed SEQ ID NO: 21 has dT at position 2 in the seed region of the antisense strand and, based on Foster and known in the prior art, that position 2, between 2OMe and 2F, has 2F preference.
The issue regarding unexpected results are addressed in the prior action, see pg. 17-18 of prior action. However, regarding the dose, Foster also conducted their at 10 nM and 0.1 nM doses and achieved inhibitory activity. Thus, the use of 0.1 nM (i.e. 500 fold less) is within the range of the prior art teachings and therefore would be obvious. Further, a skilled artisan would reasonably expect increased potency by the addition of 5’-VP as taught by Parmar and increased stability by increasing 2OMe content as taught by Foster
“For the instant claimed SEQ ID NOs 20 and 21, the total 2OMe content is ~82% (36/44) while 2F is 9% (4/44). The claimed SEQ ID NOs: 20 and 21 are the following sequences: 5′-usascuguugGfAfUfugauucgasasa-3′: SEQ ID NO: 20, a 21 nt. sense strand (18 nt.=2OMe, 3 nt.=2F) and 5′-VPudTucdGadAucaadTcCfaacaguasgsc-3′: SEQ ID NO: 21, a 23 nt. antisense strand. (18 nt.=2OMe, 1 nt.=2F, 4 nt.=DNA).
Addressing arguments regarding Jayaraman, first, it is difficult to address the impact of LNP based on the data provided in the specification. The instant specification and Jayaraman reference do not compare a siRNA treatment with and without LNP of instant claimed subject matter to understand LNP impacts on either delivery or on potency of inhibition. Here, the data is in vitro (Table 4, single dose screen) and Fig. 1C provide results of a dose screen with claimed LNP, but no data is provided without the LNP and solely the siRNA to support for “unexpected results” based on the LNP. Thus, the closest prior art is of Jayaraman that teaches the use of LNP comprising instant cationic lipid (AF-070) and siRNA cargo and its “superior ability” to inhibit the target gene when compared to a LNP comprising a different cationic lipid (AF-068) with the same siRNA (see Fig. 4 above).
Thus the rejection of examined claims is maintained.
Double Patenting
The rejection of claims is maintained.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 7-19, 30 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 77, 45, 46, 55-60, 95 of copending Application No. 18/405,072 (“Alnylam”). Although the claims at issue are not identical, they are not patentably distinct from each other.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
Alnylam is not a divisional of instant application.
Alnylam claims 77, 45, 46 corresponds to instant cl. 1, 7, 8-13, since Alnylam claim 45 and 46 teaches SEQ ID NO: 20 and 21 that are identical to instant SEQ ID NO: 20 and 21. Phosphate buffers and sterile water are well known in the art as diluent or as pharmaceutical composition for RNA.
Alnylam claims 77, 55-60 correspond to instant cl. 14-19, 30, since Alnylam claim 55 teaches cationic lipid, and claim 60 teaches the following:
PNG
media_image6.png
133
499
media_image6.png
Greyscale
.
Claim 77 teaches a method of inhibition of CTNBB1 gene in a cell comprising contacting the cell with dsRNA within Tables 2, 3, 5, or 6 and one of the dsRNA in the claimed tables is of Alnylam claim 45.
Alnylam claim 95, reciting Table 3, which includes SEQ ID NO: 20 and 21, also corresponds to instant cl. 1, 7.
Response to Arguments
Applicant's arguments filed 03/13/2026 have been fully considered but they are not persuasive. The Remarks indicate that following a notice of allowance, the Applicant will consider submitting, if appropriate, a terminal disclaimer (pg. 24).
The argument is not persuasive and the rejection is maintained.
Allowable Subject Matter
No claim allowed.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights