Prosecution Insights
Last updated: April 19, 2026
Application No. 18/598,050

Regulatory Elements From Lamium Leaf Distortion Associated Virus (LLDAV)

Non-Final OA §102§DP
Filed
Mar 07, 2024
Examiner
KINGDON, CATHY
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Corteva Agriscience LLC
OA Round
1 (Non-Final)
80%
Grant Probability
Favorable
1-2
OA Rounds
2y 7m
To Grant
83%
With Interview

Examiner Intelligence

Grants 80% — above average
80%
Career Allow Rate
957 granted / 1192 resolved
+20.3% vs TC avg
Minimal +3% lift
Without
With
+2.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
1229
Total Applications
across all art units

Statute-Specific Performance

§101
3.4%
-36.6% vs TC avg
§103
18.4%
-21.6% vs TC avg
§102
20.9%
-19.1% vs TC avg
§112
39.5%
-0.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1192 resolved cases

Office Action

§102 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims Claims 1-10 are pending and are examined in this Office Action. Claim Interpretation When referring to a sequence identifier in a claim, the use of the article “a” renders the claim recitation inclusive of fragments of the recited sequence as small as a dinucleotide or a dipeptide whereas the use of the article “the” is interpreted to require the full-length of the sequence with no mismatches because this definitive article reflects that there is only one. For this reason, instant claims 1 and 6 are interpreted to require the full-length of one of the recited sequences with no mismatches; whereas claims 2-5 and 7-10 are interpreted to require only fragments of the recited sequences. If Applicant intends for claim 2 to be limited to the full-length of one of the recited sequences with no mismatches, they are advised to amend the claim to replace “a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5” with - -the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5- - as is recited in claim 1. Claims 6 and 7 each recite “stably transformed with” and this is interpreted to require the recombinant polynucleotide or DNA construct to be integrated into the genome of the cell or plant. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 2-5 and 7-10 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Maiti et al (US Patent No. 5,994,521; issued on Nov. 30, 1999). The claims are drawn to a DNA construct comprising a regulatory element having a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1, 2, 3, 4, and 5; wherein the regulatory element is operably linked to a heterologous transcribable polynucleotide; and to a cell, transgenic plant, plant cell, or seed stably transformed with such a construct. As discussed, above, in the claim interpretation, this is interpretated to allow for small fragments of the recited sequences. Maiti teaches a promoter from the figwort mosaic virus (FMV) (see entire document). The promoter taught by Maiti and referred to as SEQ ID NO: 2 ends in the dinucleotide “GT” which is the same dinucleotide at the end of instant SEQ ID NO: 1; therefore Maiti teaches a promoter “having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5” as is required in instant claim 2. Maiti claims an expression vector comprising this promoter operably linked to a heterologous nucleotide sequence (Maiti claim 8). Maiti reduced to practice transgenic plants expressing a CAT reporter gene under the control of this promoter (Id. col 18 and description of Figure 7) and plants expressing GUS under the control of this promoter (Id. col 10 Example 3) (claims 6 and 7). Maiti grew transgenic seedlings comprising the promoter-GUS construct (Id.) and this necessarily means Maiti had transgenic seeds comprising this construct (10). Maiti teaches that their promoter could be used in the production of plants with improved characters or traits such as insect resistance (which is of agronomic interest as required by claim 3), virus resistance, fungal resistance, herbicide resistance (claim 4), bacterial or nematode pathogen resistance (claim 5), cold or drought tolerance, improved nutritional value, seed oil modification, delayed fruit ripening, male sterility, modification of carbohydrate, and protein/peptides controlling human disease (Id. col 17). Maiti specifically suggests transforming the following plants with constructs that utilize their promoter: cotton, soybean, alfalfa, oilseed rape, flax, tomato, sugar beet, sunflower, potato, tobacco, maize, wheat, rice, lettuce and banana plants (Id. col 5 lines 51-54). This list of suggested plants includes both dicotyledon and monocotyledon plants (claims 8 and 9). Non-Statutory Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Double Patenting over US Patent No. 11,959,085 Claims 1-10 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of U.S. Patent No. 11,959,085. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘085 patent are more narrow than instant claims 1-10 with specific limitations regarding what the heterologous operably linked polynucleotides are required to be; however, the ‘085 claims fall completely within the genus of the scope of the instant claims. For this reason, the ‘085 claims are species that fall within the genus encompassed by the instant claims. Provisional Double Patenting over Application 18/055,019 Claims 1-3, 5-7,9, and 10 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 of copending Application No. 18/055,019 (reference application) now published as US 2023-0200335 A1. Although the claims at issue are not identical, they are not patentably distinct from each other because the ‘019 claims are directed to a corn plant and a seed comprising corn event DP-910521-2, and this event comprises a recombination fragment referred to as SEQ ID NO: 2 (‘019 Spec, 5, Fig 2). SEQ ID NO: 2 from the prior art comprises instant SEQ ID NO: 1 in its entirety with no mismatches. ALIGNMENT BETWEEN SEQ ID NO: 1 AND ‘019 SEQ ID NO: 2 RESULT 2 US-18-055-019-2 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 2, US/18055019 Publication No. US20230200335A1 GENERAL INFORMATION APPLICANT: PIONEER HI-BRED INTERNATIONAL, INC. (en) TITLE OF INVENTION: MAIZE EVENT DP-910521-2 AND METHODS FOR DETECTION THEREOF (en) FILE REFERENCE: 8763 CURRENT APPLICATION NUMBER: US/18/055,019 CURRENT FILING DATE: 2022-11-14 NUMBER OF SEQ ID NOS: 31 SEQ ID NO 2 LENGTH: 13917 TYPE: DNA FEATURE: NAME/KEY: misc_feature LOCATION: 1..13917 QUALIFIERS: note = Synthetic FEATURE: NAME/KEY: source LOCATION: 1..13917 QUALIFIERS: mol_type = other DNA organism = synthetic construct Query Match 100.0%; Score 1226; Length 13917; Best Local Similarity 100.0%; Matches 1226; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCTACGTTTTTAAGGATTATTATGTTGTTTTTAATGGTCCTCTTCCAGGTATCTATACCA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7231 CCTACGTTTTTAAGGATTATTATGTTGTTTTTAATGGTCCTCTTCCAGGTATCTATACCA 7290 Qy 61 ATTGGCCTGCAGCACAGCAAGCTACGAAGAATGTTTCGAATGTTCTACACAAGAAATACA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7291 ATTGGCCTGCAGCACAGCAAGCTACGAAGAATGTTTCGAATGTTCTACACAAGAAATACA 7350 Qy 121 AAGGCTTCATAGAAGCAAGAACGGCGGCAGATTTATACTGCAAAAATCATGGGTTAGAAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7351 AAGGCTTCATAGAAGCAAGAACGGCGGCAGATTTATACTGCAAAAATCATGGGTTAGAAC 7410 Qy 181 CTCTCAAGTTCTATTCTGAAGAAGCTACTCTTCAACCCAAGCAGCCTAAAAGAAAAGTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7411 CTCTCAAGTTCTATTCTGAAGAAGCTACTCTTCAACCCAAGCAGCCTAAAAGAAAAGTTC 7470 Qy 241 CATCCGGCGAACTACCCAGCTCTTCTCTCAAAGAAGCTGATACACCAGATGTAAACATTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7471 CATCCGGCGAACTACCCAGCTCTTCTCTCAAAGAAGCTGATACACCAGATGTAAACATTG 7530 Qy 301 TCATGGAAGACTTCATGAATGTCTACAAGGCTGCAAGAGCTCATTAAGATGAACGATTCT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7531 TCATGGAAGACTTCATGAATGTCTACAAGGCTGCAAGAGCTCATTAAGATGAACGATTCT 7590 Qy 361 TCATCGACCACTTCTTCACCACCGAGAAGAAAAATCTAAGCTTTTACAATTTCTGTGAAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7591 TCATCGACCACTTCTTCACCACCGAGAAGAAAAATCTAAGCTTTTACAATTTCTGTGAAT 7650 Qy 421 GTTCAGATCCTGAGATCGTAAAAGATGCCTATCTTTGTGGATTGATCAAAACAATCTACC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7651 GTTCAGATCCTGAGATCGTAAAAGATGCCTATCTTTGTGGATTGATCAAAACAATCTACC 7710 Qy 481 CAGGTCCTAATCTCTTGGAGATTTCTCTCCTTCCTAAAGAGATAAGAAGAAATGTCAAGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7711 CAGGTCCTAATCTCTTGGAGATTTCTCTCCTTCCTAAAGAGATAAGAAGAAATGTCAAGC 7770 Qy 541 TATTCAGACGAAAGTGCATTAAAGATCCAAGTAAGAAAATTTACTTGAAATTCTCCAGCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7771 TATTCAGACGAAAGTGCATTAAAGATCCAAGTAAGAAAATTTACTTGAAATTCTCCAGCA 7830 Qy 601 CTATTCCCAGATGGGGAAAAGAAGGTGAACAGGTTTACTGGCCACATCACCATATAACTA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7831 CTATTCCCAGATGGGGAAAAGAAGGTGAACAGGTTTACTGGCCACATCACCATATAACTA 7890 Qy 661 TGGGTGTTCGTTCCGAAGAAGAACAATACCAGCCTTCCAGACAAATGGAAGCCACACTTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7891 TGGGTGTTCGTTCCGAAGAAGAACAATACCAGCCTTCCAGACAAATGGAAGCCACACTTG 7950 Qy 721 AGGTTCAAGACCTTGAAGAACTAGCTGTTCAAAAAATTCAACAGTTCATCGAAAAGATGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7951 AGGTTCAAGACCTTGAAGAACTAGCTGTTCAAAAAATTCAACAGTTCATCGAAAAGATGT 8010 Qy 781 TTGAATTCAGCAAGGAAGATTAGACTTTTGTCAATCTTATCTGGAATAGGGTTTTGATAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8011 TTGAATTCAGCAAGGAAGATTAGACTTTTGTCAATCTTATCTGGAATAGGGTTTTGATAA 8070 Qy 841 CTTCAAAATCTTTCAAACCACTCAGCACAAGCCATGTGGAATTGATTCTTCTTTTTCAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8071 CTTCAAAATCTTTCAAACCACTCAGCACAAGCCATGTGGAATTGATTCTTCTTTTTCAAA 8130 Qy 901 AGAGGTTAAAGAATCATTATGACTTTGGACCCCACCATCCACTCATATGCAAAAGCATAG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8131 AGAGGTTAAAGAATCATTATGACTTTGGACCCCACCATCCACTCATATGCAAAAGCATAG 8190 Qy 961 AGAAAAAGTCAGTGGAATACAGCTGCCTCAACTGTAGCAAAGGCAAAAGGCCAAAGAAAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8191 AGAAAAAGTCAGTGGAATACAGCTGCCTCAACTGTAGCAAAGGCAAAAGGCCAAAGAAAG 8250 Qy 1021 ACGGACACGTAGAAGATTCTGCGACAACGTCGTCATCATCCAGCTAATGTAGTTAGTGGT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8251 ACGGACACGTAGAAGATTCTGCGACAACGTCGTCATCATCCAGCTAATGTAGTTAGTGGT 8310 Qy 1081 TGATTCGTCAGCAATGACGTAAAACATTTGTATCGATCCTCACTCCTTATCTATAAAAGG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8311 TGATTCGTCAGCAATGACGTAAAACATTTGTATCGATCCTCACTCCTTATCTATAAAAGG 8370 Qy 1141 TTGAGTTATTTTTCTTGGAAGGACATCTCGAAACTAGCAGTCCTCTCCTTTCAAAAAATT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8371 TTGAGTTATTTTTCTTGGAAGGACATCTCGAAACTAGCAGTCCTCTCCTTTCAAAAAATT 8430 Qy 1201 TATCTTTTTAAGTTTTTAGTCGTCGT 1226 |||||||||||||||||||||||||| Db 8431 TATCTTTTTAAGTTTTTAGTCGTCGT 8456 In the event claimed in the ‘019 claims, the instant SEQ ID NO: 1 appears to be in an expression cassette for expression of cry1B.34 (‘019 Spec, Fig 2). The expression cassette encodes an insect resistance protein. For this reason, the expression cassette contained within the event claimed in the ‘019 claims falls completely within the genus of recombinant polynucleotides and DNA constructs claims in instant claims 1-3 and 5, and the corn plant comprising this event falls completely within the genus of instant claims 6, 7, and 9, and the seed claimed in the ‘019 claims falls completely within the genus of seeds of instant claim 10. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Provisional Double Patenting over Application 18/710,321 Claims 1-3, 5-7,9, and 10 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 8-13, 16-23, 25, and 67-79 of copending Application No. 18/710,321 (reference application) now published as US 2025-0011807 A1. Although the claims at issue are not identical, they are not patentably distinct from each other because the ‘321 claims are directed to a corn plant and a seed comprising corn event DP-910521-2 or biological samples of extracts from said plant, and this event comprises a recombination fragment referred to as SEQ ID NO: 2 (‘321 Spec, 5, Fig 2). SEQ ID NO: 2 from the prior art comprises instant SEQ ID NO: 1 in its entirety with no mismatches. The alignment demonstrating this is a duplicate of the alignment shown, above. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1 and 6 are Free of the Prior Art Claims 1 and 6 are free of the prior art because they each require the full length sequence of one of the recited sequences with no mismatches. The closest art would be the combination of Maiti (for reasons set forth above) and Zhang et al. (GenBank Accession EU554423.1 (2008) pp. 1-4). Zhang teaches the genomic sequence of the Lamium Leaf Distortion Associated Virus (LLDAV) which comprises a homolog of the instant SEQ ID NO: 1. There are six mismatches between the instant SEQ ID NO: 1 and the sequence taught by Zhang, and even the smallest fragment claimed in instant claim 1 (SEQ ID NO: 5) has two mismatches. In the parent case (16/797,472, now issued as US Patent No. 11,959,085), in the response to a request for information in papers received on July 6, 2022, Applicant disclosed that instant SEQ ID NO: 1 was synthesized on the sequence found in NC_010737 which was derived from GenBank accession EU554423. There is no teaching, suggestion, or motivation to make the specific mismatches that are required by instant claims 1 and 6, therefore, these claims are free of the prior art. Summary Claims 1 and 6 are allowed and claims 2-5 and 7-10 are rejected. Examiner’s Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHY KINGDON whose telephone number is (571)272-8784. The examiner can normally be reached on M-F 9:00 - 5:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see https://ppair-my.uspto.gov/pair/PrivatePair. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CATHY KINGDON Primary Examiner Art Unit 1663 /CATHY KINGDON/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Mar 07, 2024
Application Filed
Mar 13, 2026
Non-Final Rejection — §102, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12593770
PLANTS AND SEEDS OF CORN VARIETY CV978472
2y 5m to grant Granted Apr 07, 2026
Patent 12593772
PLANTS AND SEEDS OF CORN VARIETY CV957366
2y 5m to grant Granted Apr 07, 2026
Patent 12593797
SOYBEAN CULTIVAR 29020100
2y 5m to grant Granted Apr 07, 2026
Patent 12593784
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010513
2y 5m to grant Granted Apr 07, 2026
Patent 12593786
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010524
2y 5m to grant Granted Apr 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
80%
Grant Probability
83%
With Interview (+2.6%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 1192 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month