DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The amended claims filed August 26, 2024 is acknowledged. Claims 3, 5-8, 12, 16-17, 25, 31-32, 37, 115-116, 119, 122, 124, 130 and 139 are pending and under examination.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 37 and 139 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 37 recites the pharmaceutical combination of claim 3, wherein the RNAi oligonucleotide targeting HBV… are in the form of a transgene engineered to express the oligonucleotide in a cell. However, the RNAi oligonucleotide targeting HBV in claim 3 must be an siRNA, which is not in the form of transgene. Therefore, claim 37 does not include all the limitations from claim 3, from which it depends.
Claim 139 recites “the method of claim 115”, which requires “the pharmaceutical combination of claim 3”. For the reasons described above for claim 37, claim 139 does not require the siRNA of claim 3 and therefore fails to include all the limitations from claim 3, from which it indirectly depends.
Claim Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 17, 37, 116, 124 and 130 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 17 recites “the pharmaceutical combination of claim 3, wherein (a) the RNAi oligonucleotide targeting HBV is present in an amount which will result in a dose of at least about 0.1 mg/kg to about 12 mg/kg… and/or (b) the anti-PDL1 antisense oligonucleotide is present in an amount which will result in a dose of at least about 0.1 mg/kg to about 35 mg/kg…” Claim 17 is indefinite for two reasons.
First, the juxtaposition of “at least” and “about” renders the claim indefinite because it is not clear what values are included. For instance, 0.09 mg/kg is “about 0.1 mg/kg” but is not “at least 0.1 mg/kg” while 50 mg/kg is “at least 9 mg/kg” but is not “about 9 mg/kg”. It is not clear whether 0.09 mg/kg and 50 mg/kg are included in the ranges. To remedy this issue, it is suggested that “at least about” be deleted before the ranges, and “about” be deleted before the single values, e.g., 9 mg/kg.
Second, it is unknown how the recited dose ratios limit the actual mass in the combination. The dose provided to the subject is dependent on the mass (kg) of the subject. The mass in the combination can be diluted or concentrated further to provide any dose to a subject. Furthermore, the claim is directed to a combination and not a method, so there is no subject actually involved. Therefore, it is not clear how the dosing limits the pharmaceutical composition.
Claim 37 recites “The pharmaceutical combination, composition or kit of claim 3…” Claim 37 is confusing because claim 3 only recites a pharmaceutical combination. Therefore “the composition” and “the kit” lacks clear antecedent basis.
Claims 116, 124 and 130 recites “at least about two weeks, at least about…” and “at least about 3 mg/kg…” For the reasons described above for claim 17, “at least about” renders the claim indefinite because it is not clear what time periods and what doses are included in the administration schedule.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 3, 12 and 31 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Pedersen (US 20170283496 A1) as evidenced by Bartz (WO 2012024170 A2) and GenBank (X02763.1, Hepatitis B virus genome (serotype ayw2), available April 18, 2005).
Regarding claims 3, 12 and 31, Pedersen teaches “the oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective again HBV such as… the siRNA molecules described in… WO2012/024170” (i.e., a pharmaceutical combination, a composition) ([0304]). Pedersen teaches the oligonucleotide comprising cctatttaacatcagac (i.e., SEQ ID NO 11) knocked down PDL1 expression by 85-98% (Tables 10 and 11). Therefore, Pedersen teaches an anti-PDL1 antisense oligonucleotide comprising SEQ ID NO 11 is “an oligonucleotide of the present invention” combined with an siRNA effective against HBV (i.e., an RNAi oligonucleotide targeting HBV).
Pedersen is silent as to the siRNAs in WO2012024170 that target an HBsAg mRNA and whether they are effective at reducing the expression of HBsAg mRNA.
Bartz teaches siNA duplex R-008351268-000C targeting HBV site 1663 as referenced by the X02763.1 GenBank Accession number (Table 1c, row 1; [0324]). Bartz teaches the R-008351268-000C comprises a sequence that is 21 nucleotides in length (Table 1c) and is highly effective at reducing HBV mRNA levels in HepG2 cells (Table 5). GenBank teaches the sequence of the HBV genome referenced in Bartz. Genbank teaches site 1663 is in the surface antigen (HBsAg) mRNA sequence (page 2).
Therefore, Pedersen inherently teaches a combination of an anti-PDL1 antisense oligonucleotide comprising SEQ ID NO 11 in combination with an HBV siRNA that target HBsAg RNA and is capable of reducing its expression.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 3, 5-8, 12, 17, 25, 31-32, 115-116, 119, 122, 124 and 130 are rejected under 35 U.S.C. 103 as being unpatentable over Koser (US 20200171069 A1, published June 4, 2020) in view of Pedersen (US 20170283496 A1, published October 5, 2017).
The siRNA sequence in claims 5-6 are claimed by what sequences they are complementary to, rather than what the siRNA sequences comprise. Claim 5 recites “the antisense strand comprises a region complementary to ACAANAAUCCUCACAAUA”, which is equivalent to the antisense strand comprising a sequence within 5’ – UAUUGUGAGGAUUNUUGU. Likewise, claim 6 recites the sense strand has a region of complementarity to UUNUUGUGAGGAUUN, which is equivalent to the sense strand comprising a sequence within 5’ – NAAUCCUCACAANAA.
Regarding claims 3, 5-7 and 31, Koser teaches oligonucleotides for reducing expression of HBsAg comprising a sense strand forming a duplex region and comprising GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 8), wherein the antisense strand comprises a sequence as set forth in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID 5) (i.e., an RNAi oligonucleotide that is an siRNA that targets HBsAg mRNA) ([0010], [0028]). Koser’s HBsAg-targeting siRNA is 100% identical and/or comprises the claimed sequences in examined claims 5-7 as shown here:
Koser (sense): GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC
Claimed sense (claim 7): GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC
Claimed sense (claim 6): NAAUCCUCACAANAA
Koser (antisense): UUAUUGUGAGGAUUUUUGUCGG
Claimed antisense (claim 7): UUAUUGUGAGGAUUNUUGUCGG
Claimed antisense (claim 5): UAUUGUGAGGAUUNUUGU
Koser also teaches the sense strand with SEQ ID NO 8 comprises a GalNAc moiety conjugated to the GAAA sequence ([0028]; FIG 19). Koser also teaches previous work has used combinations of siRNA agents ([0005]). Koser also teaches combination therapy using HBV(s)-219P2, which comprises the sense/antisense strands and conjugated GalNAc moiety described above (Table 1), and another HBV-targeting siRNA ([0208]-[0209] or an antiviral nucleoside analog ([0205]-[0207]).
Koser does not teach the HBsAg siRNAs in combination with a PDL1 antisense oligonucleotide.
Pedersen teaches an oligonucleotide comprising cctatttaacatcagac (i.e., SEQ ID NO 11) is capable of knocking down PDL1 expression by 85-98% (i.e., an anti-PDL antisense oligonucleotide) (Tables 10 and 11). Pedersen teaches the anti-PDL1 siRNAs are relevant for treating chronic HBV infections ([0002]). Pedersen teaches administering the anti-PDL1 siRNAs to mice infected with HBV ([0507]), which reduced the load of HBV DNA, HBsAg and HBeAg ([0511]; FIG 13). Pedersen teaches “the oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective again HBV such as… siRNA molecules” ([0304]).
Regarding claims 3, 5-7 and 31, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have combined the HBsAg siRNA taught in Koser with the anti-PDL1 siRNAs taught in Pedersen in a pharmaceutical combination and composition for the purpose of treating an HBV infection. It would have amounted to the simple combination of known siRNAs by known means to yield predictable results. The skilled artisan would have predicted that the siRNAs could be combined because Koser teaches siRNA combination therapies have been used for HBV treatment before. The skilled artisan would have been motivated to have combined the two siRNAs because Pedersen suggests combining the anti-PDL1 siRNA specifically with HBV-targeted siRNAs.
Regarding claim 8, as indicated above for claims 5-7, Koser teaches the HBV(s)-219 siRNA comprise the sequences having SEQ ID NO 9 and 6. Koser also teaches the siRNA HBV(s)-219 comprises (a) 2’-fluoro modified nucleotides at position 3, 8-10, 12, 13, and 17, 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36; and a phosphorothioate internucleotide linkage between nucleotides at positions 1 and 2, and (i) each of the GAAA nucleotides conjugated to a GalNAc ([0196]). Koser also teaches the siRNA HBV(s)-219 comprises (b) the antisense strand having 2'-fluoro modified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22; and phosphorothioate internucleotide linkages between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22 and has (i) 5'-Methoxy, Phosphonate-4'-oxy-2'O-methyluridine phosphorothioate at position 1 (i.e., a MOP on the 4’ sugar of the 5’ nucleotide) ([0196]).
Regarding claim 12, as indicated above for claim 1, Pedersen’s anti-PDL1 siRNA comprises (a) the sequence cctatttaacatcagac (i.e., SEQ ID NO 11) (Tables 10-11).
Regarding claim 17, Koser teaches providing the HBsAg-targeting siRNA to mice at 9 mg/kg ([0208]). Pedersen teaches providing the anti-PDL1 siRNA to mice for the treatment of HBV at 5 mg/kg (at least 3 mg/kg) ([0507]).
Regarding claim 25, Koser teaches a combination therapy of the HBsAg-targeting siRNA with entecavir (i.e., a nucleotide analogue) ([0205]-[0207]). Pedersen teaches a combination of antiviral drugs and immune stimulators (i.e., the anti-PDL1 siRNAs) are recommended including entecavir ([0303]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have additionally added the nucleotide analogue entecavir in the combination rendered obvious above. It would have amounted to the simple combination of known HBV therapeutics by known means to yield predictable results. The skilled artisan would have predicted that the siRNAs could be combined with entecavir because Koser demonstrates a combination with the HBsAg-targeting siRNA. The skilled artisan would have been motivated to have included entecavir because Pedersen suggests that combination therapies are needed to treat HBV and suggests using a combination therapy including entecavir.
Regarding claim 32, option (A), the specification defines “kit” or “kit of parts” as an assembly of materials that are used in performing the treatment of an infected individual, including a description of how to conduct the treatment (page 77). Pedersen teaches using a variety of kits and following the manufacturer’s instructions for the use of the contents (e.g., [0456], [0490], [0524]).
It would have been obvious to have combined the siRNA combination rendered obvious above with instructions on how to use the combination for treatment of HBV infection because, as evidenced by Pedersen, providing biotechnology and pharmaceutical reagents in kits with their instructions of use was routine in the art.
Regarding claim 115, the teachings of Koser and Pedersen and the obviousness of using the siRNA combinations for treatment of an HBV infection are recited above for claim 3.
Regarding claim 116, Pedersen teaches “when the oligonucleotides or oligonucleotide conjugates of this invention are administered in combination therapies with other agents, they may be administered sequentially” (i.e., one therapy prior to another) ([0305]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have tried a treatment regimen wherein the HBsAg-targeting siRNA was administered prior to the anti-PDL1 siRNA. It would have amounted to optimizing the obvious combination by known means to yield predictable results. The skill artisan would have recognized that there were only two options of administering the two siRNAs sequentially, as instructed by Pedersen – the HBsAg-targeted siRNA first or the anti-PDL1 siRNA first. Thus, there were a finite number of predictable drug administration sequences that the skilled artisan could have chosen from. The skilled artisan had a reasonable expectation that the either of the siRNAs could be administered first because Pedersen teaches sequential administration.
Regarding claim 119, Koser teaches weekly administration of the siRNAs ([0185]). Koser demonstrates three weekly doses of HBV(s)-219P was effective at reducing HBsAg levels (FIG. 12a).
Regarding claim 122, Pedersen teaches that previous therapy studies for HBV treatment did not show robust HBsAg decline long term, such as after a 48-week therapy ([0303]).
It would have been obvious to one skilled in the art to have administered the obvious combination over the course of 48 weeks. It would have amounted to optimizing the obvious combination by known means to yield predictable results. The skill artisan would have provided the combination at various lengths to determine the long-term treatment efficacy of the administration in humans. The skilled artisan would have specifically chosen a 48-week course because Pedersen teaches the efficacy of previous therapeutics was low after 48 weeks of therapy, and the skilled artisan could compare the efficacy of the obvious combination with previous therapies.
Regarding claim 124, Koser teaches providing the HBsAg-targeting siRNA to mice at 9 mg/kg ([0208]). Pedersen teaches providing the anti-PDL1 siRNA to mice for the treatment of HBV at 5 mg/kg (at least 3 mg/kg) ([0507]).
Regarding claim 130, as noted above, Pedersen teaches sequential administration of HBV therapeutics ([0305]) and doses of at 5 mg/kg at once a week for 8 weeks (i.e., weekly with five or more doses) ([0507]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have tried a treatment regimen wherein the weekly dosing of the anti-PDL1 siRNA taught in Pedersen was administered at least a week after the first dose of the HBsAg-targeting siRNA. It would have amounted to optimizing the obvious combination by known means to yield predictable results. The skill artisan would have recognized that there were only two options of administering the two siRNAs sequentially, as instructed by Pedersen – the HBsAg-targeted siRNA first or the anti-PDL1 siRNA first. Thus, there were a finite number of predictable drug administration sequences that the skilled artisan could have chosen from.
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Koser (US 20200171069 A1, published June 4, 2020) and Pedersen (US 20170283496 A1, published October 5, 2017) as applied to claims 3, 5-8, 12, 17, 25, 31-32, 115-116, 119, 122, 124 and 130 above, and further in view of Zhen (Zhen et al., Molecular Immunology (2021), 130: 7-13; published online December 16, 2020).
The teachings of Koser and Pedersen are recited above and applied as for claims 3, 5-8, 12, 17, 25, 31-32, 115-116, 119, 122, 124 and 130 above.
Koser and Pedersen do not teach the reduction in HBV DNA, HBsAg or HBeAg with combination therapies that are greater than the sum of the effects of the individual therapies. In other words, Koser and Pedersen do do not teach synergistic effects with combination therapies.
Zhen teaches inhibiting HbsAg expression and PDL1 expression using CRISPR technology (page 8, ¶2). Zhen teaches “The combination of anti HBV and anti PD-1 therapy can inhibit HBV expression and significantly improve the survival of HBV transgenic mice…. [T]hese results demonstrate that the combination of HBV targeted therapy and PD-1 immune checkpoint block has a strong synergistic effect, thus supporting the transformation potential of this combined therapy strategy in clinical treatment of HBV infection.” (Abstract).
It would have been obvious to one skilled in the art before ethe effective filing date of the claimed invention that the HBsAg-targeting and PDL1-targeting siRNA combination rendered obvious above would have had a synergistic effect on reducing the HBsAg, HBeAg and/or HBV DNA when provided to a subject. Zhen provides predictability for the synergistic effect because Zhen teaches a combination CRISPR-based therapy targeted to HBV mRNA knockdown and PDL1 mRNA knockdown showed a synergistic effect.
Claims 37 and 139 are rejected under 35 U.S.C. 103 as being unpatentable over Pedersen (US 20170283496 A1) in view of Graham (WO 2012055362 A1).
As noted above in paragraphs 5 and 6, claims 37 and 139 do not encompass the siRNA of claim 3. Claims 37 and 139 are interpreted as requiring either or both the RNAi agent of HBV and PDL1 as encompassing a genetically encoded RNAi agent, which includes short hairpin RNAs (shRNAs) that are expressed in a cell upon delivery of the transgene encoding the shRNA.
Pedersen teaches “the oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective again HBV such as… the siRNA molecules described in… WO2012/055362” (i.e., a pharmaceutical combination, a composition) ([0304]). Pedersen teaches the oligonucleotide comprising cctatttaacatcagac (i.e., SEQ ID NO 11) knocked down PDL1 expression by 85-98% (Tables 10 and 11). Therefore, Pedersen teaches an anti-PDL1 antisense oligonucleotide comprising SEQ ID NO 11 is “an oligonucleotide of the present invention” combined with an siRNA effective against HBV (i.e., an RNAi oligonucleotide targeting HBV).
Pedersen does not teach the HBV-targeted siRNA is in a form deliverable as a transgene.
Graham teaches RNAi effector sequences targeting HBsAg that are 20-23 nucleotides (Table 1). Graham teaches short hairpin versions (shRNAs) of the RNAI agents (page 8; Fig 7). Graham teaches siRNAs and shRNAs showed similar knockdown efficiencies (Fig 10).
Regarding claims 37 and 139, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have combined the anti-PDL1 siRNAs taught in Pedersen with the HBV-targeting shRNAs of Graham in a pharmaceutical combination for the purpose of treating an HBV infection. It would have amounted to the simple combination of known RNAi agents by known means to yield predictable results. The skilled artisan would have predicted that the anti-PDL1 siRNA could be combined with the HBsAg-targeting shRNA, and been motivated to have done so, because Pedersen suggests combining the anti-PDL1 siRNA specifically with HBV-targeted siRNAs, and Graham teaches that shRNAs are just as effective at inhibiting expression of HBV mRNA.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635