DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d).
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Status of Claims
Claims 2 and 17-24 are canceled.
Claims 1 and 3-16 are pending.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 02/28/2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Interpretation
Claim 1 recites “A method for treating a liver disease or regenerating a biliary system in a subject, wherein the method comprises administering of a pharmaceutically effective amount of a Tjp1 inhibitor to the subject.” The use of the term “or” is being interpreted such that only one of either “treating a liver disease” or “regenerating a biliary system” is required by claim 1. The term “a subject” is being interpreted as any subject that has a liver or biliary system. The term “a Tjp1 inhibitor” is being interpreted as any matter that inhibits Tjp1 activity.
Claims 4-10 and 12-16 recite lists of alternatives in Markush groupings, and thus each claim is being interpreted as requiring only one member of each respective Markush grouping.
It is noted that Tjp1 (Tight junction protein 1) is also known as ZO-1 (Zonula occludens-1) in the art. The terms Tjp1 and ZO-1 are used interchangeably.
Claim Rejections - 35 USC § 112(a) - Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 4-6, 8-10, and 12 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Adequate written description support for a claimed genus may be provided by describing sufficient identifying characteristics, describing a representative number of species, actual reduction to practice, disclosure of drawings or structural chemical formulas, complete or partial structure, physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure and any working examples, method of making the claimed invention, level of skill and knowledge in the art as well as predictability in the art are other determinants that are used to analyze whether applicants had possession of the claimed genus. The present specification fails to meet these requirements for the following reasons.
Regarding claims 1,and 3-4:
Claim 1 encompass a method of introducing any type of TJP1 inhibitor to inhibit the expression of any TJP1 sequence, as well as encompass any TJP1 homolog or allele from any species known or yet to be discovered of TJP1, as well as DNA genomic fragments, spliced variants or fragment that retains TJP1-like activity.
Claim 3 encompass a method of introducing any type of nucleic acid to inhibit the expression of any TJP1 sequence, as well as encompass any TJP1 homolog or allele from any species known or yet to be discovered of TJP1, as well as DNA genomic fragments, spliced variants or fragment that retains TJP1-like activity.
Claim 4 encompass a method of introducing a nucleic acid selected from the group consisting of a short hairpin molecule, an shRNA, and siRNA, and antisense oligonucleotide (AON), a gapmer, and a short hairpin Antisense Oligonucleotide (shAON) to inhibit the expression of any TJP1 sequence, as well as encompass any TJP1 homolog or allele from any species known or yet to be discovered of TJP1, as well as DNA genomic fragments, spliced variants or fragment that retains TJP1-like activity.
The specification discloses that the term Tjp1 (Tight Junction Protein 1) and ZO-1 (Zonula Occludens-1) are used interchangeably. The terms “Tjp1” and “ZO-1” refers to an actin-binding scaffold protein that is associated with tight junctions, which are critical for the biliary-blood barrier and in human patients, [0023].
Not only are the claims directed to any inhibitory Tjp1 molecule or inhibitory nucleic acid molecule, but the inhibitor is not required to have any specific structural relationship with the target sequence. The inhibitor can act upon any target and have the secondary effect of inhibiting Tjp1 expression and therefore meet the instant limitation of being a Tjp1 inhibitor. The specification does not adequately describe this genus of targets.
Although the specification prophetic examples of some inhibitory molecules such as siRNA, shRNAs, antisense oligonucleotides, gapmers, and shAON, the specification does not describe an adequate number of species of inhibitory molecules to demonstrate that applicant was in possession of the claimed molecules within the instant method at the time the invention was made. The instant genus of inhibitory molecules is very large, including small molecules, aptamers, triplexes, peptides, and miRNAs, siRNA, for example. Additionally, the nucleic acid agent is not required to be specifically targeted/complementary to any specific target sequence.
Furthermore, although the specification discloses inhibitory agents that are specific for a TJP1 sequence, the specification does not describe such agents directed to any other species of TJP1 to describe the instantly claimed genus of any TJP1. Each of the instantly disclosed agents is targeted to a single sequence, although the claims are drawn to any TJP1. One of ordinary skill in the art could not make such agents to any TJP1 without knowledge of the sequence and knowledge of the types of inhibitory molecules. Given the breadth of sequences embraced in the instantly claimed genus, one could not envision the member agents that target such a broad genus.
Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of agents that inhibit the expression of any TJP1 such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing.
Regarding claims 5-6, 8-10 and 12:
Claims 5, 8-9, and 12 recite that the nucleic acid comprises “at least 60% identity” to a sequence selected from the recited group, and claims 6 and 10 recite “at least 80% identity” to a sequence from the recited group. The claims recite no minimum length for the claimed nucleic acids. Consequently, the claims read on, for example, a fragment as short as approximately 13 nucleotides that is 100% identical to a portion of a disclosed 21-mer SEQ ID NO (13/21 = 61.9% identity), as well as full-length 21-mer nucleic acid differing from a disclosed SEQ ID NO by up to 8 nucleotide positions (60% identity) or up to 4 positions ( 80% identity), without regard to which specific nucleotide positions are altered.
The prior art establishes that the gene-silencing activity of siRNA and shRNA molecules is highly sensitive to both the position and identity of nucleotide changes relative to a validated sequence, and is not a simple function of overall percent identity. Mismatches located within the central or seed region of a guide strand are known in the art to be substantially more disruptive to silencing activity than mismatches located toward the 3’ end of the molecule, and duplexes providing fewer that approximately 17-19 nucleotides of complementarity are known to lose gene-silencing function altogether, see Du Q, et al., (Nucleic Acids Res. 2005 Mar 21;33(5):1671-7), Elbashir SM. et al., (Methods (26) 199-213, published 2002), Huang H. et al., (Nucleic Acids Research, Volume 37, Issue 22, 1 December 2009, Pages 7560–7569), and Giese K. et al., (US7452987B2). Because a substantial number of positions within each disclosed 21-mer SEQ ID NO fall within regions as intolerant to substitution, the number of positions within the more permissive region(s) of the molecule is limited, and is not shown to accommodate the number of substitutions permitted under the claimed 60% or 80% identity thresholds without disrupting the seed or central regions.
The specification does not identify which nucleotide positions within the disclosed SEQ ID NOs may be altered, nor the minimum functional length of a fragment, while retaining Tjp1 inhibitory activity, an discloses no working example of any sequence variant below 100% identity to a disclosed SEQ ID NO. Accordingly, the specification fails to describe a representative number of species within the scope of the claimed 60% and 80% identity genus, and does not disclose a structure-function correlation sufficient to demonstrate that applicant possessed the full scope of the claimed genus of variant nucleic acid inhibitors at the time of filing.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 5-7 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 5-7 recite that the nucleic acid of claim 3 comprises identity to “a sequence selected from a group consisting of” a list that includes both a sequence and its complementary counterpart, for example, SEQ ID NO: 4 and SEQ ID NO: 91, which the specification identifies as combinable to form a single hairpin construct as in instant claim 8(i-iii). A nucleic acid comprising only one member of such a pair, for example SEQ ID NO: 4 without SEQ ID NO: 91 is not complementary/antisense to the Tjp1 target mRNA and would not be expected to function as an inhibitor of Tjp1 expression. Claim 3, from which claims 5-7 depend, required that the recited nucleic acid be the Tjp1 inhibitor of claim 1. The claims thus recite, as alternative members of a single Markush grouping, at least some structural species that are inherently incapable of satisfying the functional limitation carried forward from claim 1. Because the claims recite structural and functional limitations that are in conflict for at least a portion of the claimed genus, the metes and bounds of claims 5-7 are unclear, and the claims are indefinite.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 14, and 16 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moschetta A. et al., (WO2018164715A1, in IDS).
Moschetta teaches the use of obeticholic acid (OCA) for the treatment of cholangiocarcinoma as well as hepatocellular carcinoma (See entire claim set, brief description of the drawings, Page 33 Lines 10-27; Figures 14B-14C). According to Figure 14C, OCA is an inhibitor of ZO-1 expression (i.e. a Tjp1 inhibitor). Therefore, Moschetta anticipates the subject matter of claims 1, 14 and 16.
Claims 1 and 14-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Roberts SB, et al., (Hepatol Commun. 2020 Jul 6;4(9):1332-1345, in IDS) as evidenced by Moschetta A. et al., (WO2018164715A1, in IDS).
Roberts teaches the use of OCA for the treatment of primary biliary cholangitis (see abstract). As evidenced by Moschetta, OCA is an inhibitor of ZO-1. Therefore, Roberts anticipates the subject matter of claims 1, 14 and 15.
Claims 1, 3-4, 11, and 14-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Duft BJ. et al., (WO2013148736A1, in IDS).
Duft teaches using an “anti-ZO-1 agent, including … preferably an anti-ZO-1 polynucleotide species,” (see [0045]) such as “an antisense polynucleotide, an RNA, shRNA, miR A or an siRNA,” (see claim 1 and 5) to treat liver disease such as “liver fibrosis” and “liver cirrhosis” and “NASH” (see [0096] and claim 5) or fibrosis (see 0035]). Duft teaches exemplary siRNA molecules that target the coding region of ZO-1, see [00337] and example 4. Therefore, Duft anticipates the subject matter of claims 1, 3, 4, 11, 14 and 15.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-10, and 14-16 are rejected under 35 U.S.C. 103 as being unpatentable over Hunziker W. et al., (WO2018052374A1, in IDS) in view of Duft BJ. et al., (WO2013148736A1, in IDS), Moschetta A. et al., (WO2018164715A1, in IDS), and Roberts SB, et al., (Hepatol Commun. 2020 Jul 6;4(9):1332-1345, in IDS).
Hunziker teaches “a method for treating a heart disease in a subject comprising the step of administering to the subject a therapeutically effective amount of Tjpl inhibitor,” (see claim 1), “wherein the Tjpl inhibitor is a nucleic acid,” (see claim 2), and “wherein the nucleic acid is selected from the group consisting of an siRNA, an shRNA, an antisense oligonucleotide, a gapmers, and a short hairpin Antisense Oligonucleotide (shAON)” (see claim 3). Hunziker further teaches the “nucleic acid encoding a Tjpl inhibitor” is “selected from the group consisting of:
SEQ ID NO: l (CCGGGCCTGCATACAATAAAGCAAACTCGAGTTTGCTTTATTGTATGCAGGCTTTTTG),
SEQ ID NO:2 (CCGGGGAACCACTCTATCAAGTATTCTCGAGAATACTTGATAGAGTGGTTCCTTTTTG),
SEQ ID NO: 3 (CCGGCGTGGATTGAACTTACTAAATCTCGAGATTTAGTAAGTTCAATCCACGTTTTTG), and
SEQ ID NO: 4 (CCGGCCGCGAAGTTATGAGCAAGTTCTCGAGAACTTGCTCATAACTTCGCGGTTTTTG),” see claims 6 and 24.
Instant SEQ ID NO: 1 of instant claims 9-10 is 100% identical to Hunziker’s SEQ ID NO: 3 above. Furthermore, as recited in instant claim 8i, instant SEQ ID NOs 4 and 91 are combined by a linker, which yield instant SEQ ID NO: 1; therefore, Hunziker’s SEQ ID NO: 3 above comprises with 100% identity instant SEQ ID NO: 4 and 91 of instant claims 5-7.
Instant SEQ ID NO: 2 of instant claims 9-10 is 100% identical to Hunziker’s SEQ ID NO: 4 above. Furthermore, as recited in instant claim 8ii, instant SEQ ID NOs 5 and 92 are combined by a linker, which yield instant SEQ ID NO: 2; therefore, Hunziker’s SEQ ID NO: 4 above comprises with 100% identity instant SEQ ID NO: 5 and 92 of instant claims 5-7.
Hunziker further teaches that deletion of Tjp1 induces cell-cycle reentry and proliferation of pre-existing cardiomyocytes (CMs), evidenced by increased Edu incorporation and elevated levels of proliferation/cell-cycle markers (PCNA, pS10-H3, Cyclin D1, Cyclin E, Cyclin A2, Cyclin B1) in Tjp1-deleted hearts relative to control (see [0012][0088]), and that this proliferative response is accompanied by partial dedifferentiation of pre-existing CMs, including uncoupling from the intercalated disc and re-expression of early cardiac lineage markers (see [00107]). Hunziker further teaches that, following experimentally induced myocardial infarction, Tjp1 deletion enhances CM proliferation specifically in the infarct border region relative to control (see [0016], Figure 6B), notwithstanding that both control and Tjp1-deleted hearts exhibited similar initial fibrotic injury immediately following the infarct-inducing surgery (see [0016], Figure 6A). Hunziker thus teaches that inhibition of Tjp1 promotes regeneration of a tissue via induction of proliferation and dedifferentiation of resident, pre-existing cells.
Hunziker further teaches that the disclosed shRNA molecules inhibit Tjp1 expression in Murine Hepa 1-6 cells, which are a liver cancer cell line widely used as a syngeneic model to study hepatocellular carcinoma, see [0018], and in MCF7 cell lines, which are a widely used human breast cancer model, see [0083-0084].
While Hunziker teaches regeneration of heart cells by treating fibrosis caused by a heart disease, Hunziker does not explicitly teach employing a Tjp1 inhibitor to treat a liver disease or regenerate a biliary system.
The teachings of Duft, Moschetta, and Roberts are incorporated herein to the respective 102 rejections above.
It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to apply Hunziker’s Tjp1-targeting nucleic acid inhibitors to the treatment of liver disease and regeneration of the biliary system. A PHOSITA would have been motivated because the proliferative/dedifferentiation mechanism by which Hunziker’s Tjp1 inhibition promoted tissue regeneration is not disclosed as unique to cardiac tissue or cardiomyocytes, but rather reflects release if resident cells from a growth-suppressive constraint associated with Tjp1/ZO-1 at cell-cell junctions. This general relationship between Tjp1 inhibition and cell proliferation is corroborated in the hepatobiliary context by Duft, which independently teaches that anti-ZO-1 polynucleotide inhibitors are already used in the art to treat liver fibrosis and cirrhosis, and by Moschetta and Roberts, which show that ZO-1 inhibition achieved through the agonist, OCA, independently produces therapeutic benefit across multiple liver diseases (i.e., cholangiocarcinoma and primary biliary cholangitis). A PHOSITA seeking a Tjp1 targeting nucleic acid inhibitor suitable for treating liver disease or promoting biliary regeneration would have looked to Hunziker’s art-recognized Tjp1 RNAi as previously validated inhibitors falling within the class of reagents Duft identifies as effective against liver disease. A PHOSITA would have had a reasonable expectation of success given that Hunziker had already demonstrated these shRNA effectively reduce Tjp1 expression in cancer cell lines including a liver cancer cell line and inducing a regenerative cellular response in vivo, and given the independent confirmation from Moschetta and Roberts that ZO-1 inhibition is therapeutically beneficial for liver disease.
Claims 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over Hunziker W. et al., (WO2018052374A1, in IDS) in view of Duft BJ. et al., (WO2013148736A1, in IDS), Moschetta A. et al., (WO2018164715A1, in IDS), and Roberts SB, et al., (Hepatol Commun. 2020 Jul 6;4(9):1332-1345, in IDS). as applied to claims 1, 3-10, and 14-16 above, and further in view of Elbashir SM. et al., (Methods (26) 199-213, published 2002) and NCBI RefSeq NM_003257.5 (Homo sapiens tight junction protein 1 (TJP1), transcript variant 1, mRNA, published June 2, 2019).
The teachings of Hunziker, Duft, Moschetta, and Roberts are incorporated herein by reference to the 102 and 103 rejections above.
While Hunziker and Duft each teach polynucleotides such as siRNA and shRNA that target Tjp1, neither Hunziker, Duft, Moschetta, nor Roberts teach the specific siRNA sequences of SEQ ID NOs: 94-103.
Elbashir teaches “selection of siRNA sequences for targeting of mRNAs,” see pages 200-202. Specifically, Elbashir teaches “Protocol 1: selection of siRNA sequences,” see section 2.1, in which Elbasher teaches to “Select the target region from the open reading frame of a given cDNA sequence preferably 50 to 100 nt downstream of the start codon,” see page 202 column 1, 2.1.2. Elbashir teaches to “search for sequences 5’-AA(N19)UU, where N is any nucleotide, in the mRNA sequence and choose those with approximately 50% G/C content,” see page 202 column 1, 2.1.2, and Fig 2A. Elbashir further teaches that “nevertheless, 32 to 79% G/C content” also works well, but to avoid “highly G-rich sequences” because “they tend to form G-quartet structures,” see page 202 column 1, 2.1.2. Elbashir further teaches that “If there are no 5’-AA(N19)UU motifs present in the target mRNA, search for 50-AA(N21) or 5’-NA(N21) (Fig. 2B),” see page 202 column 1, 2.1.2.
The coding sequence of Tjp1 is publicly available at NCBI RefSeq.
It would have been obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date to arrive at an siRNA sequence, such as instant SEQ ID NO: 95, that targets the Tjp1 coding sequence by applying Elbashir’s siRNA selection criteria to the publicly available human Tjp1 coding sequence (NM_003257.5). A PHOSITA would have been motivated to identify siRNA sequences alternative to those exemplified by Duft, because Duft’s own disclosed siRNA confirm the ZO-1 coding region as a validated target for therapeutic nucleic acid gene silencing, and Elbashir provides design rules for identifying additional effective siRNA target sites within a given coding sequence. A PHOSITA would have had a reasonable expectation of success in arriving at additional functional siRNAs, for example with 100% identity to SEQ ID NO: 95, because applying Elbashir’s established selection criteria to the human Tjp1 coding sequence, which was already validated by Duft, yields a finite, predictable set of candidate sequences meting the recommended positional and GC-content criteria.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to COREY LANE BRETZ whose telephone number is (571)272-7299. The examiner can normally be reached M-F 7:30am - 6:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/COREY LANE BRETZ/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights