Prosecution Insights
Last updated: August 16, 2026
Application No. 18/705,869

USE OF CARBOXYPEPTIDASE E/NEUROTROPHIC FACTOR-ALPHA1 TO TREAT NEURODEGENERATIVE DISEASE

Non-Final OA §103§112
Filed
Apr 29, 2024
Priority
Oct 29, 2021 — provisional 63/273,312 +1 more
Examiner
BARRON, SEAN C
Art Unit
1653
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
United States Department of Health and Human Services
OA Round
1 (Non-Final)
53%
Grant Probability
Moderate
1-2
OA Rounds
1y 3m
Est. Remaining
84%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allowance Rate
326 granted / 612 resolved
-6.7% vs TC avg
Strong +31% interview lift
Without
With
+30.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
116 currently pending
Career history
700
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
45.0%
+5.0% vs TC avg
§102
14.0%
-26.0% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 612 resolved cases

Office Action

§103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . References not included with this Office action can be found in a prior action. Election/Restrictions Applicant’s election without traverse of Group II, presently claims 1, 7-14, and 16-22, in the reply filed on 5/20/2026 is acknowledged. Claims 4-6 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5/20/2026. Claims 1, 7-14, and 16-22 are under consideration on the merits. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 7-14 and 16-22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 7, which depends from independent claim 1, recites “wherein the CPE protein is encoded by a CPE polynucleotide”. However, claim 1 is already limited to CPE protein by reciting “a mouse or human Carboxypeptidase E (CPE) protein to the subject, wherein the CPE protein comprises the amino acid sequence set forth in SEQ ID NO: 2, 4, 6, 8, 11, or 14”. Therefore, the metes and bounds of claim 7 are unclear because it is not clear which composition is controlling of claim scope as proteins and nucleic acids are mutually exclusive compositions. Correction is required. Applicant might overcome this rejection by amending claim 1 to alternative incorporate the limitations of claim 7. In so much that claims 8-14 and 16-22 depend from claim 7 and do not resolve the point of confusion, these claims must be rejected with claim 7 as indefinite. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 7-14, and 16-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating or preventing the onset of progression of Alzheimer’s disease, does not reasonably provide enablement for treatment or preventing the onset or progression of Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, or Down’s syndrome. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. The factors to be considered in determining whether undue experimentation is required are summarized in In re Wands, 858 F.2d 731, 737, 8 USPQd 1400, 1404 (Fed. Cir. 1988) (a) the breadth of the claims; (b) the nature of the invention; (c) the state of the prior art; (d) the level of one of ordinary skill; (e) the level of predictability in the art; (f) the amount of direction provided by the inventor; (g) the existence of working examples; and (h) the quantity of experimentation needed to make or use the invention based on the content of the disclosure. While all of these factors are considered, a sufficient number are discussed below so as to create a prima facie case. Independent claim recites a method of treating a neurodegenerative disease or preventing onset or progression of a neurodegenerative disease in a subject in need thereof, comprising administering a mouse or human Carboxypeptidase E (CPE) protein to the subject, wherein the CPE protein comprises the amino acid sequence set forth in SEQ ID NO: 2, 4, 6, 8, 11, or 14; and wherein the neurodegenerative disease is selected from the group consisting of Alzheimer's disease (AD), Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, and Down's syndrome. Notwithstanding the issues of indefiniteness set forth above, claim 1 and claims 7-11 contemplate polynucleotides encoding for wildtype mouse CPE (SEQ ID NO: 1), wildtype human CPE (SEQ ID NO: 3), mouse E342Q mutant CPE (SEQ ID NO: 5), human E342Q mutant CPE (SEQ ID NO: 7), mouse ΔN CPE (SEQ ID NO: 10), and human ΔN CPE (SEQ ID NO: 13). For clarity of record, SEQ ID NOs: 2, 4, 6, 8, 11, and 14 as set forth in claim 1 are amino acid sequences encoded respectively by the polynucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 10, and 13. Before the invention was filed, Cheng (Transl Psychiatry (2016), 6, e973, 12 pages; provided in the IDS dated 10/01/2024) teaches that mutant carboxypeptidase E (CPE) found in humans induces AD-like (Alzheimer’s disease) pathologies in transgenic mice (Abstract). However, Cheng does not teach any known pathological or physiological association between CPE and Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, or Down’s syndrome such as to provide enabling support for treating or preventing the onset or progression of these other species of neurodegenerative diseases. Bhatia et al. (WO 2013/096741; of record), teaches transgenic organoids expressing carboxypeptidase E (claim 53) and teaches administering said organoids to subjects suffering from Alzheimer’s disease (claim 157). However, Bhatia does not teach any known pathological or physiological association between CPE and Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, or Down’s syndrome such as to provide enabling support for treating or preventing the onset or progression of these other species of neurodegenerative diseases. In the unpredictable arts, more guidance is needed to satisfy the enablement requirement, see M.P.E.P. § 2164.03 and In re Fisher, 427 F.2d 833, 839, 166 USPQ 18, 24 (CCPA 1970) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 927 F.2d 1200, 1212, 18 USPQ2d 1016, 1026 (Fed. Cir.), cert. denied, 502 U.S. 856 (1991). Also see M.P.E.P. § 2164.03. In this case, Cheng and Bhatia as a whole make clear that treatment or preventing the onset or progression of neurogenerative diseases other than Alzheimer’s disease was unpredictable before the filing of the instant Application and so more guidance is required from the disclosure to meet the enablement requirement. Examples 1-4 and 6-8 of the specification are entirely limited to treating or preventing the onset or progression of subjects suffering from Alzheimer’s disease (e.g. 3xTg-AD mice), and Example 5 is directed towards CPE having a neuroprotective effect on human primary neurons in vitro. However, the other species of neurodegenerative diseases of claim 1 are only generally and prophetically contemplated (e.g. [0012] and [0073] of the specification). There is no disclosure, either by direct evidence or the citation of prior art, that CPE has any pathological or physiological relevance to the specific neurodegenerative diseases consisting of Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, and Down's syndrome as claimed. While [0003] of the specification discusses a general role of loss-of-function mutant CPE having a role in intellectual disabilities in humans (citing Alsters et al. 2015, Dumarz et al. February 2021, and Bosch et al. August 2021, all provided in the IDS dated 10/01/2024), the genus of “intellectual disabilities” taught by the prior art cannot be enabling for the claims because neither Alsters, Dumarz, nor Bosch define “intellectual disability” nor set forth how the patients are assessed for “intellectual disability”, and none of Alsters, Dumarz, and Bosch make any pathological or physiological correlation between loss-of-function mutant CPE and the specific neurodegenerative diseases consisting of Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, and Down's syndrome as claimed or treatment or prevention of said neurodegenerative diseases thereof. Given the lack of predictability in the prior art and the lack of direction provided by Applicant, the amount of experimentation must necessarily be held as undue as persons skilled in this art would be left to empirically test for operable vs. inoperable treatment and prevention methods of the claimed neurogenerative diseases other than Alzheimer’s disease without any clear direction or guidance from the prior art and/or disclosure in determining operability; see M.P.E.P. § 2164.08 (b). The evidence as a whole suggests that persons skilled in this art would have no basis as of the filing date of the instant Application to believe that the specific neurodegenerative diseases consisting of Parkinson's disease (PD), dementia, frontotemporal dementia (FTD), depression, bipolar disorder, amyotrophic lateral sclerosis (ALS), spinal cord injury, traumatic brain injury (TBI), stroke, ischemia, and Down's syndrome as claimed could be treated or prevent the onset or progression of these neurodegenerative diseases by administering either the elected invention of polynucleotide(s) encoding for the CPE protein(s) of claim 1. Even assuming arguendo that the teachings of Alsters, Dumarz, and Bosch towards the genus of “intellectual disabilities” could be plausibly extended to the claimed species of treating or preventing neurodegenerative diseases other than Alzheimer’s disease with polynucleotides encoding CPE protein, plausibility by itself is not sufficient to satisfy the enablement requirement. See Rasmusson v. SmithKline Beecham Corp., 413 F.3d 1318 (Fed. Cir. 2005). "If mere plausibility were the test for enablement under section 112, applicants could obtain patent rights to ‘inventions' consisting of little more than respectable guesses as to the likelihood of their success. When one of the guesses later proved true, the ‘inventor’ would be rewarded the spoils instead of the party who demonstrated that the method actually worked. That scenario is not consistent with the statutory requirement that the inventor enable an invention rather than merely proposing an unproved hypothesis." See Rasmusson at 1325. Rasmusson confirms the long-held requirement that a specification must be fully enabling as of the filing date. See M.P.E.P. § 2164.05(a). Enablement of a treatment method may be established either by including within the specification working embodiments or scientifically sound reasoning that would have led a skilled artisan at the time of filing to conclude that the method was enabled. Both are lacking for the full scope of claim 1 and so necessarily dependent claims 7-14, and 16-22. For these reasons and those given above, the examiner concludes the claims are not enabled to their full scope. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 7-9, 12, 16, 17, and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Cheng et al. (Transl Psychiatry (2016), 6, e973, 12 pages; provided in the IDS dated 10/01/2024) in view of Bhatia et al. (WO 2013/096741), Yi et al. (J Cell Biochem. (2019), 120, 8053-8065; Reference U), and Kawai et al. (Nature (2001), 409, 685-690; Reference V). In view of the election requirement, this rejection addresses the embodiment of SEQ ID NO: 1 as a polynucleotide encoding CPE protein for claim 1. Cheng teaches that mutant carboxypeptidase E (CPE) found in humans induces AD-like pathologies in transgenic mice (Abstract), reading in-part on the embodiment of treating Alzheimer’s disease for claim 1. Cheng teaches the polynucleotides encoding for the mutant CPE protein in a pcDNA3.1(+) expression vector (page 2, right column, paragraph starting “A construct containing…”), reading in-part on claim 12 and the embodiment of an (implied) aqueous solution for claim 16. Regarding claims 1 and 7-9, Cheng does not teach administering the embodiment of SEQ ID NO: 1 to treat or prevent Alzheimer’s disease. Regarding claim 17, Cheng does not teach administering the embodiment of SEQ ID NO: 1 into the brain of the subject. Bhatia teaches transgenic organoids expressing carboxypeptidase E (claim 53) and teaches administering said organoids to subjects suffering from Alzheimer’s disease (claim 157), reading in-part on claim 1. Yi teaches methods of infusing MEG3 long noncoding RNA in a pcDNA3.1(+) vector into the third ventricle of rats with Alzheimer’s disease such as to improve the survival of hippocampal neurons (Abstract; detailed infusion methods at subheadings 2.3 and 2.4), reading in-part on claim 1 and reading on claim 17. Kawai teaches a cDNA set of 21,076 mouse clones (page 685, 1st paragraph in the left column under the Abstract). Kawai teaches mouse carboxypeptidase E, which is 100% identical to SEQ ID NO: 1a, reading on that embodiment for claims 1 and 7-9. Regarding claims 1, 7-9, and 17, it would have been obvious to a person of ordinary skill in the art before the invention was filed to substitute the polynucleotide encoding the mutant CPE of Cheng with the wildtype mouse CPE of Kawai to treat the AD-like symptoms in Cheng’s murine subjects according to Yi’s brain infusion/injection methods and in view of Bhatia. A person of ordinary skill in the art would have had a reasonable expectation of success to do so because Cheng teaches detailed methods of producing the CPE-containing vector, and because Yi teaches detailed methods of administering the same nucleotide vector of Chang to the brain of murine subjects such as to exert a biological effect in the brain of subjects. The skilled artisan would have been motivated to do so because Bhatia teaches that persons of ordinary skill in the art had considered administering CPE to subjects in need of treatment thereof for Alzheimer’s disease, and so the substitution would be predictably advantageous to treat Cheng’s murine subjects suffering from Alzheimer’s disease. Regarding claim 22, claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure. See M.P.E.P. § 2112.02 and 2112.04. In this case, claim 22 only recites the intended result of a process step positively recited in claim 16, and so is afforded no patentable weight. Cheng in view of Bhatia, Yi, and Kawai are reasonably presumed capable of meeting the wherein clause of claim 22 absent any showing to the contrary. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the invention was filed. Claims 13 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Cheng, Bhatia, Yi and Kawai as applied to claims 1 and 12 above, and further in view of He et al. (FASEB J. (2017), 31, 3383-3392; Reference W). The teachings of Cheng, Bhatia, Yi and Kawai are relied upon as set forth above. Regarding claim 13, Cheng, Bhatia, Yi and Kawai do not teach wherein the expression vector is an AAV construct. Regarding claim 14, Cheng, Bhatia, Yi and Kawai do not teach wherein the expression vector is an AAV9 construct. Regarding claim 17, Cheng, Bhatia, Yi and Kawai do not teach injecting/infusing the embodiment of SEQ ID NO: 1 into the brain of the subject. He teaches that administration of AAV9 vector(s) encoding for Ck5 inhibitory peptide (CIP) reduces apoptosis, memory deficit, and anxiety in murine subjects suffering from Alzheimer’s disease (Abstract; detailed methods of vector preparation and AAV administration on page 3384, the first two subheadings of the Materials and Methods; Fig. 5 for apoptosis; Fig. 6 for behavioral testing), reading on claims 13 and 14. Regarding claims 13 and 14, it would have been obvious to a person of ordinary skill in the art before the invention was filed to further substitute the pcDNA3.1(+) vector of Cheng with the AAV9 vector of He in the methods of treating AD subjects of Cheng in view of Bhatia, Yi, and Kawai. A person of ordinary skill in the art would have had a reasonable expectation of success to do so because He teaches detailed methods of AAV9 vector construction and administering said vectors to subjects suffering from Alzheimer’s disease such as to treat some of the symptoms of Alzheimer’s disease. The skilled artisan would have been motivated to do so because the simple substitution of one known vector encoding for a protein or peptide capable of treating Alzheimer’s disease when the vector is administered to subjects for a different vector would simply and predictably yield an AAV9 vector encoding a protein or peptide capable of treating Alzheimer’s disease when the vector is administered to subjects, and so must be held prima facie obvious; see M.P.E.P. § 2143(I)(B). Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the invention was filed. Claim 18 is rejected under 35 U.S.C. 103 as being unpatentable over Cheng, Bhatia, Yi and Kawai as applied to claims 1 and 17 above, and further in view of Castro-Alvarez et al. (Frontiers in Aging Neuroscience (2014), 6(243), 10 pages; Reference X). The teachings of Cheng, Bhatia, Yi and Kawai are relied upon as set forth above. Regarding claim 18, Cheng, Bhatia, Yi and Kawai do not teach injecting the embodiment of SEQ ID NO: 1 into the hippocampus of the subject. Castro-Alvarez teaches methods of injecting the hippocampus of subjects suffering from Alzheimer’s disease with an AAV particle composition comprising a vector encoding for inhibitory RNAs specific for CDK5 (page 2 “RNAi Design”, “Viral Particle Production”, and “Animal Procedures”), wherein the RNAi-treated subjects show improved spatial memory (Fig. 1), reading on claim 18. It would have been obvious to a person of ordinary skill in the art before the invention was filed to further substitute the brain ventricular infusion/injection methods of Yi with the hippocampal injection methods of Castro-Alvarez in the methods of treating AD subjects of Cheng in view of Bhatia, Yi, and Kawai. A person of ordinary skill in the art would have had a reasonable expectation of success to do so because Castro-Alvarez teaches detailed methods of administering said a suitable vector to subjects suffering from Alzheimer’s disease by hippocampal injection such as to treat some of the symptoms of Alzheimer’s disease. The skilled artisan would have been motivated to do so because the simple substitution of one route of administration in methods of treating Alzheimer’s disease for a different route of administration would simply and predictably yield a method of treating Alzheimer’s disease by administering the therapeutic composition by hippocampal injection, and so must be held prima facie obvious; see M.P.E.P. § 2143(I)(B).Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the invention was filed. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the invention was filed. Claims 19-21 are rejected under 35 U.S.C. 103 as being unpatentable over Cheng, Bhatia, and Kawai as applied to claims 1 and 16 above, and further in view of Nasr et al. (Life Science (2019), 226, 117-129; Reference U2) and Battaglia et al. (Expert Opinion on Drug Delivery (2018), 15(4), 369-378; Reference V2). The teachings of Cheng, Bhatia, Yi and Kawai are relied upon as set forth above. Yi as cited above towards brain ventricular administration reads in-part on the cerebrospinal fluid (CSF) of claim 21. Regarding claim 19, Cheng, Bhatia, Yi and Kawai do not teach administering the pharmaceutical composition via nasal spray to the subject. Regarding claims 20 and 21, Cheng, Bhatia, Yi and Kawai do not teach wherein the pharmaceutical composition comprises an extracellular vesicle encapsulating the CPE polynucleotide. Nasr teaches that that a composition comprising piracetam and vinpocetine as a microemulsion/vesicular nanoformulation administered intranasally to subjects is capable of reversing scopolamine-induced memory impairment (Abstract; subheading 2.2 for formulation and 2.8 and Fig. 5 for treatment of subjects), reading on claims 19-21. Nasr teaches that piracetam and vinpocetine are nootropic drugs exiting neuroprotective and glioprotective effects and are used to treat subjects suffering from Alzheimer’s disease (2nd paragraph of the Introduction on page 117), reading on claims 19-21. Battaglia teaches that transfer of substances from the nose into the brain can occur by slow intra-axonal transport (intraneuronal), or by faster transfer along the perineural space surrounding the nerve cells into the cerebrospinal fluid (CSF), and/or into the interstitial fluid of the brain (extra-neuronal or paracellular transport) (page 370, right column, paragraph starting “Transfer of substances…”), and is advantageous as a simpler and direct way for brain targeting, which avoids bloodstream clearance and invasive methods (page 370, left column, paragraph starting “Nose-to-brain delivery), reading on claims 19-21. Battaglia teaches that lipid nanoparticle formulations can improve nose-to-brain drug delivery, since they are able to protect the encapsulated drug from biological and/or chemical degradation, and from extracellular transport by P-gp efflux proteins (page 371, left column, paragraph starting “NP can improve..”), reading on claims 19-21. It would have been obvious to a person of ordinary skill in the art before the invention was filed to further formulate the therapeutic composition of Cheng as a microemulsion/vesicular nanoformulation in view of Nasr and Battaglia. A person of ordinary skill in the art would have had a reasonable expectation of success to do so because Nasr teaches detailed methods of making microemulsion/vesicular nanoformulations comprising drugs known for treating Alzheimer’s disease, and because Nasr teaches that said microemulsion/vesicular nanoformulations are capable of reversing memory impairment in subjects. The skilled artisan would have been motivated to do so because Battaglia teaches that lipid nanoparticle formulations are predictably advantageous to as being less invasive and by improving nose-to-brain drug delivery, and so the further formulation of the therapeutic composition of Cheng as a microemulsion/vesicular nanoformulation would predictably improve upon Cheng’s methods of treating Alzheimer’s disease in subjects in view of Bhatia and Kawai. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the invention was filed. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SEAN C BARRON whose telephone number is (571)270-5111. The examiner can normally be reached 7:30am-3:30pm EDT/EST (M-F). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Sharmila Landau can be reached at 571-272-0614. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Sean C. Barron/Primary Examiner, Art Unit 1653 SEQ ID NO: 1 hit GenCore version 6.5.3 Copyright (c) 1993 - 2026 Biocceleration Ltd. OM nucleic - nucleic search, using sw model Run on: July 21, 2026, 15:58:56 ; Search time 1089 Seconds (without alignments) 775997.856 Million cell updates/sec Title: US-18-705-869-1 Perfect score: 1431 Sequence: 1 atggccgggcgcggaggacg..........cagaaactttgaatttttaa 1431 Scoring table: IDENTITY_NUC Gapop 10.0 , Gapext 1.0 Searched: 61785019 unique seqs, 295269624635 residues Total number of hits satisfying chosen parameters: 123570038 Minimum DB seq length: 1 Maximum DB seq length: 40000 Post-processing: Minimum Match 0% Maximum Match 100% Listing first 45 summaries Database : GenEmbl_269:* RESULT 1 AK047891 LOCUS AK047891 2078 bp mRNA linear HTC 06-OCT-2010 DEFINITION Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130020F14 product:carboxypeptidase E, full insert sequence. ACCESSION AK047891 VERSION AK047891.1 KEYWORDS HTC; HTC_FLI; CAP trapper. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 AUTHORS Carninci,P. and Hayashizaki,Y. TITLE High-efficiency full-length cDNA cloning JOURNAL Meth. Enzymol. 303, 19-44 (1999) PUBMED 10349636 REFERENCE 2 AUTHORS Carninci,P., Shibata,Y., Hayatsu,N., Sugahara,Y., Shibata,K., Itoh,M., Konno,H., Okazaki,Y., Muramatsu,M. and Hayashizaki,Y. TITLE Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes JOURNAL Genome Res. 10 (10), 1617-1630 (2000) PUBMED 11042159 REFERENCE 3 AUTHORS Shibata,K., Itoh,M., Aizawa,K., Nagaoka,S., Sasaki,N., Carninci,P., Konno,H., Akiyama,J., Nishi,K., Kitsunai,T., Tashiro,H., Itoh,M., Sumi,N., Ishii,Y., Nakamura,S., Hazama,M., Nishine,T., Harada,A., Yamamoto,R., Matsumoto,H., Sakaguchi,S., Ikegami,T., Kashiwagi,K., Fujiwake,S., Inoue,K., Togawa,Y., Izawa,M., Ohara,E., Watahiki,M., Yoneda,Y., Ishikawa,T., Ozawa,K., Tanaka,T., Matsuura,S., Kawai,J., Okazaki,Y., Muramatsu,M., Inoue,Y., Kira,A. and Hayashizaki,Y. TITLE RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer JOURNAL Genome Res. 10 (11), 1757-1771 (2000) PUBMED 11076861 REFERENCE 4 AUTHORS Kawai,J., Shinagawa,A., Shibata,K., Yoshino,M., Itoh,M., Ishii,Y., Arakawa,T., Hara,A., Fukunishi,Y., Konno,H., Adachi,J., Fukuda,S., Aizawa,K., Izawa,M., Nishi,K., Kiyosawa,H., Kondo,S., Yamanaka,I., Saito,T., Okazaki,Y., Gojobori,T., Bono,H., Kasukawa,T., Saito,R., Kadota,K., Matsuda,H., Ashburner,M., Batalov,S., Casavant,T., Fleischmann,W., Gaasterland,T., Gissi,C., King,B., Kochiwa,H., Kuehl,P., Lewis,S., Matsuo,Y., Nikaido,I., Pesole,G., Quackenbush,J., Schriml,L.M., Staubli,F., Suzuki,R., Tomita,M., Wagner,L., Washio,T., Sakai,K., Okido,T., Furuno,M., Aono,H., Baldarelli,R., Barsh,G., Blake,J., Boffelli,D., Bojunga,N., Carninci,P., de Bonaldo,M.F., Brownstein,M.J., Bult,C., Fletcher,C., Fujita,M., Gariboldi,M., Gustincich,S., Hill,D., Hofmann,M., Hume,D.A., Kamiya,M., Lee,N.H., Lyons,P., Marchionni,L., Mashima,J., Mazzarelli,J., Mombaerts,P., Nordone,P., Ring,B., Ringwald,M., Rodriguez,I., Sakamoto,N., Sasaki,H., Sato,K., Schonbach,C., Seya,T., Shibata,Y., Storch,K.F., Suzuki,H., Toyo-oka,K., Wang,K.H., Weitz,C., Whittaker,C., Wilming,L., Wynshaw-Boris,A., Yoshida,K., Hasegawa,Y., Kawaji,H., Kohtsuki,S. and Hayashizaki,Y. CONSRTM RIKEN Genome Exploration Research Group Phase II Team and the FANTOM Consortium TITLE Functional annotation of a full-length mouse cDNA collection JOURNAL Nature 409 (6821), 685-690 (2001) PUBMED 11217851 REFERENCE 5 AUTHORS Okazaki,Y., Furuno,M., Kasukawa,T., Adachi,J., Bono,H., Kondo,S., Nikaido,I., Osato,N., Saito,R., Suzuki,H., Yamanaka,I., Kiyosawa,H., Yagi,K., Tomaru,Y., Hasegawa,Y., Nogami,A., Schonbach,C., Gojobori,T., Baldarelli,R., Hill,D.P., Bult,C., Hume,D.A., Quackenbush,J., Schriml,L.M., Kanapin,A., Matsuda,H., Batalov,S., Beisel,K.W., Blake,J.A., Bradt,D., Brusic,V., Chothia,C., Corbani,L.E., Cousins,S., Dalla,E., Dragani,T.A., Fletcher,C.F., Forrest,A., Frazer,K.S., Gaasterland,T., Gariboldi,M., Gissi,C., Godzik,A., Gough,J., Grimmond,S., Gustincich,S., Hirokawa,N., Jackson,I.J., Jarvis,E.D., Kanai,A., Kawaji,H., Kawasawa,Y., Kedzierski,R.M., King,B.L., Konagaya,A., Kurochkin,I.V., Lee,Y., Lenhard,B., Lyons,P.A., Maglott,D.R., Maltais,L., Marchionni,L., McKenzie,L., Miki,H., Nagashima,T., Numata,K., Okido,T., Pavan,W.J., Pertea,G., Pesole,G., Petrovsky,N., Pillai,R., Pontius,J.U., Qi,D., Ramachandran,S., Ravasi,T., Reed,J.C., Reed,D.J., Reid,J., Ring,B.Z., Ringwald,M., Sandelin,A., Schneider,C., Semple,C.A., Setou,M., Shimada,K., Sultana,R., Takenaka,Y., Taylor,M.S., Teasdale,R.D., Tomita,M., Verardo,R., Wagner,L., Wahlestedt,C., Wang,Y., Watanabe,Y., Wells,C., Wilming,L.G., Wynshaw-Boris,A., Yanagisawa,M., Yang,I., Yang,L., Yuan,Z., Zavolan,M., Zhu,Y., Zimmer,A., Carninci,P., Hayatsu,N., Hirozane-Kishikawa,T., Konno,H., Nakamura,M., Sakazume,N., Sato,K., Shiraki,T., Waki,K., Kawai,J., Aizawa,K., Arakawa,T., Fukuda,S., Hara,A., Hashizume,W., Imotani,K., Ishii,Y., Itoh,M., Kagawa,I., Miyazaki,A., Sakai,K., Sasaki,D., Shibata,K., Shinagawa,A., Yasunishi,A., Yoshino,M., Waterston,R., Lander,E.S., Rogers,J., Birney,E. and Hayashizaki,Y. CONSRTM FANTOM Consortium; RIKEN Genome Exploration Research Group Phase I & II Team TITLE Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs JOURNAL Nature 420 (6915), 563-573 (2002) PUBMED 12466851 REFERENCE 6 AUTHORS Carninci,P., Kasukawa,T., Katayama,S., Gough,J., Frith,M.C., Maeda,N., Oyama,R., Ravasi,T., Lenhard,B., Wells,C., Kodzius,R., Shimokawa,K., Bajic,V.B., Brenner,S.E., Batalov,S., Forrest,A.R., Zavolan,M., Davis,M.J., Wilming,L.G., Aidinis,V., Allen,J.E., Ambesi-Impiombato,A., Apweiler,R., Aturaliya,R.N., Bailey,T.L., Bansal,M., Baxter,L., Beisel,K.W., Bersano,T., Bono,H., Chalk,A.M., Chiu,K.P., Choudhary,V., Christoffels,A., Clutterbuck,D.R., Crowe,M.L., Dalla,E., Dalrymple,B.P., de Bono,B., Della Gatta,G., di Bernardo,D., Down,T., Engstrom,P., Fagiolini,M., Faulkner,G., Fletcher,C.F., Fukushima,T., Furuno,M., Futaki,S., Gariboldi,M., Georgii-Hemming,P., Gingeras,T.R., Gojobori,T., Green,R.E., Gustincich,S., Harbers,M., Hayashi,Y., Hensch,T.K., Hirokawa,N., Hill,D., Huminiecki,L., Iacono,M., Ikeo,K., Iwama,A., Ishikawa,T., Jakt,M., Kanapin,A., Katoh,M., Kawasawa,Y., Kelso,J., Kitamura,H., Kitano,H., Kollias,G., Krishnan,S.P., Kruger,A., Kummerfeld,S.K., Kurochkin,I.V., Lareau,L.F., Lazarevic,D., Lipovich,L., Liu,J., Liuni,S., McWilliam,S., Madan Babu,M., Madera,M., Marchionni,L., Matsuda,H., Matsuzawa,S., Miki,H., Mignone,F., Miyake,S., Morris,K., Mottagui-Tabar,S., Mulder,N., Nakano,N., Nakauchi,H., Ng,P., Nilsson,R., Nishiguchi,S., Nishikawa,S., Nori,F., Ohara,O., Okazaki,Y., Orlando,V., Pang,K.C., Pavan,W.J., Pavesi,G., Pesole,G., Petrovsky,N., Piazza,S., Reed,J., Reid,J.F., Ring,B.Z., Ringwald,M., Rost,B., Ruan,Y., Salzberg,S.L., Sandelin,A., Schneider,C., Schonbach,C., Sekiguchi,K., Semple,C.A., Seno,S., Sessa,L., Sheng,Y., Shibata,Y., Shimada,H., Shimada,K., Silva,D., Sinclair,B., Sperling,S., Stupka,E., Sugiura,K., Sultana,R., Takenaka,Y., Taki,K., Tammoja,K., Tan,S.L., Tang,S., Taylor,M.S., Tegner,J., Teichmann,S.A., Ueda,H.R., van Nimwegen,E., Verardo,R., Wei,C.L., Yagi,K., Yamanishi,H., Zabarovsky,E., Zhu,S., Zimmer,A., Hide,W., Bult,C., Grimmond,S.M., Teasdale,R.D., Liu,E.T., Brusic,V., Quackenbush,J., Wahlestedt,C., Mattick,J.S., Hume,D.A., Kai,C., Sasaki,D., Tomaru,Y., Fukuda,S., Kanamori-Katayama,M., Suzuki,M., Aoki,J., Arakawa,T., Iida,J., Imamura,K., Itoh,M., Kato,T., Kawaji,H., Kawagashira,N., Kawashima,T., Kojima,M., Kondo,S., Konno,H., Nakano,K., Ninomiya,N., Nishio,T., Okada,M., Plessy,C., Shibata,K., Shiraki,T., Suzuki,S., Tagami,M., Waki,K., Watahiki,A., Okamura-Oho,Y., Suzuki,H., Kawai,J. and Hayashizaki,Y. CONSRTM FANTOM Consortium; RIKEN Genome Exploration Research Group and Genome Science Group (Genome Network Project Core Group) TITLE The transcriptional landscape of the mammalian genome JOURNAL Science 309 (5740), 1559-1563 (2005) PUBMED 16141072 REFERENCE 7 AUTHORS Katayama,S., Tomaru,Y., Kasukawa,T., Waki,K., Nakanishi,M., Nakamura,M., Nishida,H., Yap,C.C., Suzuki,M., Kawai,J., Suzuki,H., Carninci,P., Hayashizaki,Y., Wells,C., Frith,M., Ravasi,T., Pang,K.C., Hallinan,J., Mattick,J., Hume,D.A., Lipovich,L., Batalov,S., Engstrom,P.G., Mizuno,Y., Faghihi,M.A., Sandelin,A., Chalk,A.M., Mottagui-Tabar,S., Liang,Z., Lenhard,B. and Wahlestedt,C. CONSRTM RIKEN Genome Exploration Research Group; Genome Science Group (Genome Network Project Core Group); FANTOM Consortium TITLE Antisense transcription in the mammalian transcriptome JOURNAL Science 309 (5740), 1564-1566 (2005) PUBMED 16141073 REFERENCE 8 (bases 1 to 2078) AUTHORS Adachi,J., Aizawa,K., Akimura,T., Arakawa,T., Bono,H., Carninci,P., Fukuda,S., Furuno,M., Hanagaki,T., Hara,A., Hashizume,W., Hayashida,K., Hayatsu,N., Hiramoto,K., Hiraoka,T., Hirozane,T., Hori,F., Imotani,K., Ishii,Y., Itoh,M., Kagawa,I., Kasukawa,T., Katoh,H., Kawai,J., Kojima,Y., Kondo,S., Konno,H., Kouda,M., Koya,S., Kurihara,C., Matsuyama,T., Miyazaki,A., Murata,M., Nakamura,M., Nishi,K., Nomura,K., Numazaki,R., Ohno,M., Ohsato,N., Okazaki,Y., Saito,R., Saitoh,H., Sakai,C., Sakai,K., Sakazume,N., Sano,H., Sasaki,D., Shibata,K., Shinagawa,A., Shiraki,T., Sogabe,Y., Tagami,M., Tagawa,A., Takahashi,F., Takaku-Akahira,S., Takeda,Y., Tanaka,T., Tomaru,A., Toya,T., Yasunishi,A., Muramatsu,M. and Hayashizaki,Y. TITLE Direct Submission JOURNAL Submitted (16-JUL-2001) Contact:Yoshihide Hayashizaki The Institute of Physical and Chemical Research (RIKEN), Omics Science Center, RIKEN Yokohama Institute; 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan URL :http://www.osc.riken.jp/ COMMENT cDNA library was prepared and sequenced in Mouse Genome Encyclopedia Project of Genome Exploration Research Group in Riken Genomic Sciences Center and Genome Science Laboratory in RIKEN. Division of Experimental Animal Research in Riken contributed to prepare mouse tissues. Please visit our web site for further details. URL:http://www.osc.riken.jp/ URL:http://fantom.gsc.riken.jp/ clone information is available at: http://fantom.gsc.riken.jp/3/db/annotate/ main.cgi?masterid=C130020F14. FEATURES Location/Qualifiers source 1..2078 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6J" /db_xref="FANTOM_DB:C130020F14" /db_xref="MGI:MGI:2413882" /db_xref="taxon:10090" /clone="C130020F14" /tissue_type="head" /clone_lib="RIKEN full-length enriched mouse cDNA library" /dev_stage="16 days embryo" CDS 83..1513 /note="unnamed protein product; carboxypeptidase E (MGD|MGI:101932 GB|NM_013494, evidence: BLASTN, 99\%, match=227); putative" /codon_start=1 Query Match 100.0%; Score 1431; Length 2078; Best Local Similarity 100.0%; Matches 1431; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCCGGGCGCGGAGGACGGGTGCTGCTGGCGCTGTGTGCCGCGCTGGTGGCCGGCGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 83 ATGGCCGGGCGCGGAGGACGGGTGCTGCTGGCGCTGTGTGCCGCGCTGGTGGCCGGCGGG 142 Qy 61 TGGCTGCTGACGGCTGAAGCCCAGGAGCCCGGGGCGCCAGCGGCTGGCATGAGGCGCCGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 143 TGGCTGCTGACGGCTGAAGCCCAGGAGCCCGGGGCGCCAGCGGCTGGCATGAGGCGCCGC 202 Qy 121 CGGCGGCTCCAGCAAGAGGACGGCATCTCCTTCGAGTACCACCGCTATCCAGAGCTGCGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 203 CGGCGGCTCCAGCAAGAGGACGGCATCTCCTTCGAGTACCACCGCTATCCAGAGCTGCGC 262 Qy 181 GAGGCGCTGGTGTCCGTATGGCTGCAGTGCACCGCCATCAGCAGAATCTACACAGTGGGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 263 GAGGCGCTGGTGTCCGTATGGCTGCAGTGCACCGCCATCAGCAGAATCTACACAGTGGGG 322 Qy 241 CGCAGCTTCGAGGGCCGGGAGCTCCTGGTCATCGAGCTGTCTGACAACCCCGGGGTCCAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 323 CGCAGCTTCGAGGGCCGGGAGCTCCTGGTCATCGAGCTGTCTGACAACCCCGGGGTCCAT 382 Qy 301 GAGCCGGGTGAACCTGAATTTAAATACATTGGGAACATGCATGGTAATGAGGCGGTTGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 383 GAGCCGGGTGAACCTGAATTTAAATACATTGGGAACATGCATGGTAATGAGGCGGTTGGA 442 Qy 361 CGGGAACTGCTTATTTTCTTGGCCCAGTACCTGTGTAACGAGTACCAGAAAGGCAATGAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 443 CGGGAACTGCTTATTTTCTTGGCCCAGTACCTGTGTAACGAGTACCAGAAAGGCAATGAG 502 Qy 421 ACAATTGTCAACCTGATCCACAGCACCCGAATTCATATCATGCCCTCCTTGAACCCCGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 503 ACAATTGTCAACCTGATCCACAGCACCCGAATTCATATCATGCCCTCCTTGAACCCCGAC 562 Qy 481 GGCTTTGAGAAAGCCGCATCGCAGCCCGGCGAGCTGAAGGACTGGTTTGTGGGCCGCAGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 563 GGCTTTGAGAAAGCCGCATCGCAGCCCGGCGAGCTGAAGGACTGGTTTGTGGGCCGCAGC 622 Qy 541 AACGCCCAGGGAATAGATCTGAACCGTAACTTCCCAGACCTGGACAGGATCGTGTATGTT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 623 AACGCCCAGGGAATAGATCTGAACCGTAACTTCCCAGACCTGGACAGGATCGTGTATGTT 682 Qy 601 AATGAGAAAGAAGGCGGTCCTAACAATCACCTGCTGAAGAATCTGAAGAAAATTGTGGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 683 AATGAGAAAGAAGGCGGTCCTAACAATCACCTGCTGAAGAATCTGAAGAAAATTGTGGAC 742 Qy 661 CAAAATTCAAAGCTTGCCCCCGAGACCAAGGCTGTCATTCACTGGATCATGGACATTCCA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 743 CAAAATTCAAAGCTTGCCCCCGAGACCAAGGCTGTCATTCACTGGATCATGGACATTCCA 802 Qy 721 TTTGTGCTTTCTGCCAATCTGCACGGAGGAGACCTTGTGGCTAATTACCCATATGATGAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 803 TTTGTGCTTTCTGCCAATCTGCACGGAGGAGACCTTGTGGCTAATTACCCATATGATGAG 862 Qy 781 ACACGGAGCGGTACTGCTCACGAATACAGTTCCTGCCCTGATGACGCAATTTTCCAAAGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 863 ACACGGAGCGGTACTGCTCACGAATACAGTTCCTGCCCTGATGACGCAATTTTCCAAAGC 922 Qy 841 TTGGCTCGCGCGTACTCTTCTTTCAACCCAGTCATGTCTGACCCCAATCGACCTCCCTGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 923 TTGGCTCGCGCGTACTCTTCTTTCAACCCAGTCATGTCTGACCCCAATCGACCTCCCTGT 982 Qy 901 CGCAAGAATGACGATGACAGCAGCTTTGTAGATGGAACGACCAATGGTGGTGCATGGTAC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 983 CGCAAGAATGACGATGACAGCAGCTTTGTAGATGGAACGACCAATGGTGGTGCATGGTAC 1042 Qy 961 AGCGTCCCCGGTGGAATGCAAGACTTCAATTACCTGAGCAGCAACTGCTTCGAGATCACT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1043 AGCGTCCCCGGTGGAATGCAAGACTTCAATTACCTGAGCAGCAACTGCTTCGAGATCACT 1102 Qy 1021 GTGGAGCTTAGCTGTGAGAAGTTCCCACCGGAAGAGACTCTCAAAAGCTACTGGGAAGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1103 GTGGAGCTTAGCTGTGAGAAGTTCCCACCGGAAGAGACTCTCAAAAGCTACTGGGAAGAT 1162 Qy 1081 AACAAAAACTCCCTCATCAGCTACCTGGAGCAGATACACCGAGGTGTTAAAGGGTTTGTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1163 AACAAAAACTCCCTCATCAGCTACCTGGAGCAGATACACCGAGGTGTTAAAGGGTTTGTC 1222 Qy 1141 CGTGACCTTCAGGGTAACCCGATTGCCAACGCAACCATCTCTGTGGACGGGATAGACCAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1223 CGTGACCTTCAGGGTAACCCGATTGCCAACGCAACCATCTCTGTGGACGGGATAGACCAT 1282 Qy 1201 GATGTCACCTCGGCTAAGGATGGGGATTACTGGCGATTGCTTGCTCCTGGAAACTATAAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1283 GATGTCACCTCGGCTAAGGATGGGGATTACTGGCGATTGCTTGCTCCTGGAAACTATAAA 1342 Qy 1261 CTTACAGCCTCCGCTCCTGGCTACCTGGCAATCACAAAGAAAGTGGCAGTTCCTTTTAGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1343 CTTACAGCCTCCGCTCCTGGCTACCTGGCAATCACAAAGAAAGTGGCAGTTCCTTTTAGC 1402 Qy 1321 CCTGCTGTTGGGGTGGACTTTGAGCTTGAGTCTTTCTCTGAAAGGAAGGAGGAGGAGAAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1403 CCTGCTGTTGGGGTGGACTTTGAGCTTGAGTCTTTCTCTGAAAGGAAGGAGGAGGAGAAG 1462 Qy 1381 GAAGAATTGATGGAGTGGTGGAAAATGATGTCAGAAACTTTGAATTTTTAA 1431 ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1463 GAAGAATTGATGGAGTGGTGGAAAATGATGTCAGAAACTTTGAATTTTTAA 1513
Read full office action

Prosecution Timeline

Apr 29, 2024
Application Filed
Jul 29, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680089
ADMINISTRATION OF KYNURENINE DEPLETING ENZYMES FOR TUMOR THERAPY
3y 7m to grant Granted Jul 14, 2026
Patent 12644086
ROLLED SCAFFOLD FOR LARGE SCALE CELL CULTURE IN MONOLAYER
5y 10m to grant Granted Jun 02, 2026
Patent 12629356
EXPANSION OF TUMOR INFILTRATING LYMPHOCYTES WITH POTASSIUM CHANNEL AGONISTS AND THERAPEUTIC USES THEREOF
3y 11m to grant Granted May 19, 2026
Patent 12618044
SPECIFICATION OF FUNCTIONAL CRANIAL PLACODE DERIVATIVES FROM HUMAN PLURIPOTENT STEM CELLS
3y 4m to grant Granted May 05, 2026
Patent 12611440
FUSION PROTEINS AND USES THEREOF
4y 1m to grant Granted Apr 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
53%
Grant Probability
84%
With Interview (+30.6%)
3y 7m (~1y 3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 612 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month