Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restrictions/Election
Applicant's election of Group III, claims 13-18 (drawn to a method of producing a tomato plant with virus resistance by plant breeding methods and tomato plant produced) in the reply filed on 04/23/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 1-23 are pending.
Claims 1-12 and 19-23 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 04/23/2026.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Thus claims 13-18 are examined in this office action.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. See for example page 7, paragraph 0015. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The use of the terms “TaqMan” on page 13, paragraph 0040, “Agencourt”, “Applied Biosystems”, “LI-COR Biosciences”, “NimbleGen”, “Illumina” in page 15, paragraph 0048) which is a trade name or a mark used in commerce, has been noted in this application. The term is a tradename or a mark used in commerce and should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM, or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Drawings
The Figure is objected to because it fails to comply with 37 CFR 1.84.(u)(1) which states:
(u) Numbering of views.
(1) The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation "FIG." Where only a single view is used in an application to illustrate the claimed invention, it must not be numbered and the abbreviation "FIG." must not appear.
Applicant must delete “FIG. 1" from the drawing and any reference in the specification should say -- the figure -- without any number designation.
Claim Interpretation
In claim 13, “increased resistance” has been defined as increased resistance compared to a plant not comprising the resistance allele (page 3, paragraph 0005). It is further defined as an indication that the plant is more able to reduce disease burden than a non-resistant or less resistant plant (page 41-42, paragraph 00105). This is interpreted as any increase above zero percentage hence it can be a very small increase or a large increase as long as it is a statistically significant increase.
In line 7 of claim 13, the recitation of “lacks a deleterious allele genetically linked thereto” is interpreted as two different loci that are not transmitted together from parents to offspring more often than expected by chance (i.e. having a recombination fraction larger than 0.5).
In claim 13 line 3, “flanked in the genome of said plant by marker locus M1 and M3” in claim13 is interpreted as the marker locus is identifiable region (i.e. polymorphism) located near a gene which can be used in linkage studies to track the coinheritance of the gene in question and the identified allele are located between two markers. This is different from an intergenic marker which is located within the gene itself. This is interpreted to be positional and it does not mean that the recited “chromosomal segment” comprises the recited sequences.
Claim Rejections - 35 USC § 112 - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 13-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim.
Regarding claim 13, the term “recombinant” renders the claim indefinite. The term “recombinant” has been described as recombinant DNA sequences comprising one or more genetic loci in a configuration in which they are not found in nature for example by recombination between homologous chromosomes during meiosis (page 40, paragraph 00101). It is not clear from description on how many nucleotides worth of S. chilense are required to be considered as a locus. For example, is it 10 mer or more? How long of a sequence is necessary to differentiate between two species? For example, all species have “ATG”.
Regarding claim 13 line 7, the term “cold sensitivity” renders claim indefinite. Specification, Page 45, Paragraph 00115 describes an example of cold sensitivity phenotype which is expressed in the younger leaves at the top of the plant after a period of more than 5 consecutive days where the night temperature is below 6oC. But it does not give a complete definition of range of below temperatures. Furthermore, claim does not require purpling or necrosis on younger leaves when temperature fall below 6oC making the term indefinite.
Regarding claims 13 and 16, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claims 16 and 16 recite the broad recitation for example M1 marker, and the claims also recites markers M3 and M4 which are also broad. SEQ ID Nos: 6, 11 and 16 can be the narrower statement of the range/limitation in terms of size of the chromosomal segment they can identify. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
For example, in claim 5, marker M1 identified in parenthesis is SEQ ID NO: 6 has 98.5% sequence identity to the segment of S. lycopersicum chromosome 11, complete genome (see alignment below). Since it is a marker locus, it is not clear whether claimed locus requires 100% identity to SEQ ID NO: 6 which has not been stated in claims clearly and is only shown in parenthesis.
Claim Rejections - 35 USC § 112 - written description requirement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 13-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Breadth of the Claim
Claim 13 states that the ToCV resistance allele is located in a chromosomal segment on chromosome 11 flanked by marker M1 and M3 which are about 529,029 bp apart in the long arm of chromosome 11 (page 47, table 1).
The examiner interprets claims 2 and 5 as requiring that the marker locus is identifiable region (i.e. polymorphism) located near the recited gene which can be used in linkage studies to track the coinheritance of the gene in question. This is different from an intergenic marker which is located within the gene itself. Furthermore, the recited chromosomal segment is not required to comprise marker loci with the introgressed segment.
SEQ ID NO:6 comprise ambiguity symbol of N and Y, SEQ ID NO: 11 comprise ambiguity symbol of R and SEQ ID NO: 16 comprise ambiguity symbol of N in multiple positions. For example, Handbook of Intellectual property information and documentation, WIPO, sates that ambiguity symbol of “n” represent any of a, c, g or t/u or, unknown reside, R would be any of a or g and w would Y would be c or t/u (page 29). Therefore, applicant is claiming a broad genus of recombinant chromosome segments. Furthermore, Spec, Table 1 lists specific favorable allele would been required to be associated to cause disease resistance (Spec, page 47, Table 1).
What is Described in the Specification
Applicant describes the following:
A partial monogenic ToCV resistant variety Elinita which is also cold sensitive was mapped at the end of chromosome 11 of the public tomato genome map version SL2.50 (pages 6-7, paragraph 0014).
ToCV resistance has been associated with a deleterious cold sensitivity phenotype preventing the trait from being used in important tomato growing markets during the long-crop season (page 5 and 6, paragraph 0012).
Resistance to tomato chlorosis virus (ToCV) in tomato was identified in breeding line 960744 and is derived from S. chilense line LA1932, which is available from the Tomato Genetics Resource Center at UC-Davis, California, USA (page 44, paragraph 00115).
Breeding line 960744 was used to develop a ToCV resistant line to create a mapping population to map the ToCV resistance locus and develop molecular markers for tracking the locus (page 45, paragraph 00115).
The resistance to ToCV was determined to be additive, where plants that are homozygous for the ToCV resistance allele on chromosome 11 show a resistance phenotype that is acceptable for a grower (FIG. 1) (page 45, paragraph 00115).
A new mapping population to fine map the ToCV resistance locus and uncouple the cold sensitivity locus was developed using the parental lines of the former commercial hybrid 'Elenita' (page 45, paragraph 00116).
About 3000 F2 seedlings were screened for recombination events in the ToCV resistance locus region (page 45, paragraph 00116).
Plants with recombination events were selfed to fix the recombination events in the F3 generation (page 45-46, paragraph 00116).
A set of 32 families were developed and the F4 generation was screened for ToCV resistance (page 45, paragraph 00116).
The subsequent mapping analysis showed that the ToCV resistance locus is located between marker locus M1, a SNP marker with a [C/T] change at 54,914,243 bp on chromosome 11 of the public tomato genome map version SL2.50, and M3, a SNP marker with a [A/T] change at 55,443,272 bp on chromosome 11 of the public tomato genome map version SL2.50 (page 46, paragraph 00116).
This region encompasses a 0.6 cM region on chromosome 11 (page 45-46, paragraph 00116).
It was discovered that one line from the mapping population did not have a cold sensitivity phenotype. This was line designated “CHI-1120-0340”, and it is the deposited variety disclosed (page 45-46, paragraph 00116).
Difference Between What was Reduced to Practice and What is Claimed
Applicant has not described the structure of the ToCV resistance allele from S. chilense other than in the deposited line CHI-1120-0340 as deposit of NCMA Accession Number 202007005.
Applicant has not described that selection of markers M1, M2 and M3 using marker assisted selection would produce the ToCV resistance plant that lacks a allele that confers cold sensitivity phenotype in any other plant other than in the deposited seed of NCMA Accession No. 202007005 (claims 1 and 16).
Applicant does not describe the structure of the deleterious allele that confers cold sensitivity to the plant.
There is no known correlation between the structure and function of an allele from chromosome 11 in S. chilense that confers resistance to ToCV and is not linked to an allele conferring deleterious cold sensitivity.
Applicant does not describe the size of the chromosomal segment on chromosome 11 of the line “CHI-1120-0340”.
Since the flanking marker can be either far or close to the introgressed segment, the size of the introgressed segment can be small or large.
Analysis
The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim.
The applicants fail to describe structural features of the ToCV resistance allele recited in the claims. The alleles have been only described by function of ToCV resistance. Applicant have described a recombinant segment is associated with the SNP markers M1 (at about 54.9 mbps), M3 (at about 55.4 mbps) and M2 (at about 55.1 mbps) of chromosome 11 of S. lycopersicum (specification, page 47, table 1) without describing structural feature of associated recombinant segment. There is no indication that the introgressed segment begins on Marker M1 and end in marker M3 and the region include ToCV resistance allele completely.
For example, Arcos et al. (Published: 2018, Journal: Euphytica 214:178 https://doi.org/10.1007/s10681-018-2253-9) teaches certain level of ToCV resistance also found in S. lycopersicon, S. habrochaites, S. peruvianum varieties (see Table 2 below). Furthermore, alignment of SEQ ID NOs: 6 and 16 has 100% identity to S. Lycopersicon genome in varieties of tomato M82 (see alignment below). However, the line M82 is sensitive to cold stress (see Abstract Wang et al., (Published:2016, Journal: Plant Physiology 172: 1432–1442)) and furthermore there is no evidence that M82 would have been resistant to ToCV since most of the cultivated cultivars are susceptible to ToCV ( see Arcos et al., page 177, left paragraph 2). Therefore, there is dearth of description of the ToCV resistance allele and its structure. Instead, applicant has not described ToCV resistance allele from any other plant other than present in the deposited line CHI-1120-0340 as deposit of NCMA Accession Number 202007005.
PNG
media_image1.png
780
1100
media_image1.png
Greyscale
Alignment of SEQ ID NO:6 to the GenEmbl database:
RESULT 2
HG975523s5
LOCUS HG975523s5 5391715 bp DNA linear PLN 17-NOV-2015
COMMENT segment of length 5391715: from 48000001 to 53391715
DEFINITION Solanum lycopersicum chromosome ch11, complete genome.
ACCESSION HG975523
VERSION HG975523.1
DBLINK BioProject: PRJEB6302
BioSample: SAMEA3283147
KEYWORDS complete genome.
SOURCE Solanum lycopersicum (Lycopersicon esculentum)
ORGANISM Solanum lycopersicum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
Solanoideae; Solaneae; Solanum; Solanum subgen. Lycopersicon.
REFERENCE 1
AUTHORS Bolger,A., Scossa,F., Bolger,M., Lanz,C., Maumus,F., Tohge,T.,
Quesneville,H., Alseekh,S., Soerensen,I., Lichenstein,G.,
Fich,E.A., Conte,M., Keller,H., Schneeberger,K., Schwacke,R.,
Ofner,I., Vrebalov,J., Xu,Y., Osorio,S., Aflitos,S.A., Schijlen,E.,
Jiminez-Gomez,J., Kimura,S., Kumar,R., Koenig,D., Headland,L.R.,
Maloof,J.N., Sinha,N., van Ham,R.C.H.J., Lankhorst,R.K., Mao,L.,
Arsova,B., Fei,Z., Rose,J.K.C., Zamir,D., Carrari,F.,
Giovannoni,J.J., Weigel,D., Usadel,B. and Fernie,A.R.
TITLE The genome of the highly stress tolerant wild species tomato
Solanum pennellii
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 53391715)
AUTHORS Bolger,M.
TITLE Direct Submission
JOURNAL Submitted (11-MAR-2014) Institute for Biology and Molecular
Genetics, IBMG, Worringer Weg 2, 52074 Aachen, GERMANY
FEATURES Location/Qualifiers
source 1..53391715
/organism="Solanum lycopersicum"
/mol_type="genomic DNA"
/cultivar="M82"
/db_xref="taxon:4081"
/chromosome="ch11"
assembly_gap 3006..4527
/estimated_length=1522
/gap_type="unknown"
assembly_gap 235948..237556
/estimated_length=1609
/gap_type="unknown"
assembly_gap 278722..279037
/estimated_length=316
/gap_type="unknown"
assembly_gap 330328..334912
/estimated_length=4585
/gap_type="unknown"
assembly_gap 340020..340039
/estimated_length=20
/gap_type="unknown"
assembly_gap 465123..466626
/estimated_length=1504
/gap_type="unknown"
assembly_gap 526396..526996
/estimated_length=601
/gap_type="unknown"
assembly_gap 543804..544502
/estimated_length=699
/gap_type="unknown"
assembly_gap 797459..797531
/estimated_length=73
/gap_type="unknown"
assembly_gap 798717..798736
/estimated_length=20
/gap_type="unknown"
assembly_gap 880445..880808
/estimated_length=364
/gap_type="unknown"
assembly_gap 922910..924137
/estimated_length=1228
/gap_type="unknown"
assembly_gap 955309..956272
/estimated_length=964
/gap_type="unknown"
assembly_gap 973322..974164
/estimated_length=843
/gap_type="unknown"
assembly_gap 1014231..1015707
/estimated_length=1477
/gap_type="unknown"
assembly_gap 1030043..1030062
/estimated_length=20
/gap_type="unknown"
assembly_gap 1032243..1032262
/estimated_length=20
/gap_type="unknown"
assembly_gap 1117983..1118965
/estimated_length=983
/gap_type="unknown"
assembly_gap 1327801..1328358
/estimated_length=558
/gap_type="unknown"
assembly_gap 1385108..1385697
/estimated_length=590
/gap_type="unknown"
assembly_gap 1395453..1395875
/estimated_length=423
/gap_type="unknown"
assembly_gap 1407234..1407801
/estimated_length=568
/gap_type="unknown"
assembly_gap 1625800..1628724
/estimated_length=2925
/gap_type="unknown"
assembly_gap 1728623..1729130
/estimated_length=508
/gap_type="unknown"
assembly_gap 1741232..1742576
/estimated_length=1345
/gap_type="unknown"
assembly_gap 1746875..1748022
/estimated_length=1148
/gap_type="unknown"
assembly_gap 1784659..1785234
/estimated_length=576
/gap_type="unknown"
assembly_gap 2011894..2012425
/estimated_length=532
/gap_type="unknown"
assembly_gap 2026556..2026873
/estimated_length=318
/gap_type="unknown"
assembly_gap 2090509..2094696
/estimated_length=4188
/gap_type="unknown"
assembly_gap 2100607..2100626
/estimated_length=20
/gap_type="unknown"
assembly_gap 2111277..2112354
/estimated_length=1078
/gap_type="unknown"
assembly_gap 2119032..2119051
/estimated_length=20
/gap_type="unknown"
assembly_gap 2155331..2156732
/estimated_length=1402
/gap_type="unknown"
assembly_gap 2219018..2219339
/estimated_length=322
/gap_type="unknown"
assembly_gap 2221839..2222668
/estimated_length=830
/gap_type="unknown"
assembly_gap 2239278..2239297
/estimated_length=20
/gap_type="unknown"
assembly_gap 2239821..2239840
/estimated_length=20
/gap_type="unknown"
assembly_gap 2268201..2269270
/estimated_length=1070
/gap_type="unknown"
assembly_gap 2276745..2278135
/estimated_length=1391
/gap_type="unknown"
assembly_gap 2292824..2292843
/estimated_length=20
/gap_type="unknown"
assembly_gap 2293372..2293659
/estimated_length=288
/gap_type="unknown"
assembly_gap 2298193..2304790
/estimated_length=6598
/gap_type="unknown"
assembly_gap 2327214..2328179
/estimated_length=966
/gap_type="unknown"
assembly_gap 2381751..2383207
/estimated_length=1457
/gap_type="unknown"
assembly_gap 2387140..2389624
/estimated_length=2485
/gap_type="unknown"
assembly_gap 2403359..2404211
/estimated_length=853
/gap_type="unknown"
assembly_gap 2428997..2432066
/estimated_length=3070
/gap_type="unknown"
assembly_gap 2434240..2436677
/estimated_length=2438
/gap_type="unknown"
assembly_gap 2451722..2452537
/estimated_length=816
/gap_type="unknown"
assembly_gap 2465363..2465664
/estimated_length=302
/gap_type="unknown"
assembly_gap 2470185..2474573
/estimated_length=4389
/gap_type="unknown"
assembly_gap 2491885..2492567
/estimated_length=683
/gap_type="unknown"
assembly_gap 2608181..2609389
/estimated_length=1209
/gap_type="unknown"
Query Match 100.0%; Score 399.6; Length 5391715;
Best Local Similarity 99.0%;
Matches 396; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTACTTCTTTTCATTTTTAATCATGCCGTGCTAGCTCATCATCAAACACATAGCATTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4002892 TGTTACTTCTTTTCATTTTTAATCATGCCGTGCTAGCTCATCATCAAACACATAGCATTA 4002951
Qy 61 TATTTAACCTCCATAGAGAATCTAAATTTTTTAAAGGATAACGATCACAAGTTTTAGGAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4002952 TATTTAACCTCCATAGAGAATCTAAATTTTTTAAAGGATAACGATCACAAGTTTTAGGAA 4003011
Qy 121 ATAAGTGCAACTTCCATTGTCACATGTTATATAATTCTATATTTCTCATTGCTTATTGGT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4003012 ATAAGTGCAACTTCCATTGTCACATGTTATATAATTCTATATTTCTCATTGCTTATTGGT 4003071
Qy 181 TTNTGCTCTTACCATGTTTYAATTCACGTCTCAATTGCCACCATGTTTAATCAATTGTCC 240
||:||||||||||||||||:||||||||||||||||||||||||||||||||||||||||
Db 4003072 TTGTGCTCTTACCATGTTTTAATTCACGTCTCAATTGCCACCATGTTTAATCAATTGTCC 4003131
Qy 241 GTAGGAAGTGTTTCTAAGGTGCTGTTGCTATTTTTACATCTGTTCCCGAGTTCTTTTTTT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4003132 GTAGGAAGTGTTTCTAAGGTGCTGTTGCTATTTTTACATCTGTTCCCGAGTTCTTTTTTT 4003191
Qy 301 TNNCTTTTTGAACTTTCCACTAAAGCTATTATGTCGTCCACAGTGAATTTTCAGGTCTGT 360
|::|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4003192 TTTCTTTTTGAACTTTCCACTAAAGCTATTATGTCGTCCACAGTGAATTTTCAGGTCTGT 4003251
Qy 361 TGTTATAGGCAAGTCTTTGAGATGGGACTATCAAAGAAGG 400
||||||||||||||||||||||||||||||||||||||||
Db 4003252 TGTTATAGGCAAGTCTTTGAGATGGGACTATCAAAGAAGG 4003291
Alignment of SEQ ID NO:6 to the GenEmbl database:
RESULT 1
HG975523s5
LOCUS HG975523s5 5391715 bp DNA linear PLN 17-NOV-2015
COMMENT segment of length 5391715: from 48000001 to 53391715
DEFINITION Solanum lycopersicum chromosome ch11, complete genome.
ACCESSION HG975523
VERSION HG975523.1
DBLINK BioProject: PRJEB6302
BioSample: SAMEA3283147
KEYWORDS complete genome.
SOURCE Solanum lycopersicum (Lycopersicon esculentum)
ORGANISM Solanum lycopersicum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
Solanoideae; Solaneae; Solanum; Solanum subgen. Lycopersicon.
REFERENCE 1
AUTHORS Bolger,A., Scossa,F., Bolger,M., Lanz,C., Maumus,F., Tohge,T.,
Quesneville,H., Alseekh,S., Soerensen,I., Lichenstein,G.,
Fich,E.A., Conte,M., Keller,H., Schneeberger,K., Schwacke,R.,
Ofner,I., Vrebalov,J., Xu,Y., Osorio,S., Aflitos,S.A., Schijlen,E.,
Jiminez-Gomez,J., Kimura,S., Kumar,R., Koenig,D., Headland,L.R.,
Maloof,J.N., Sinha,N., van Ham,R.C.H.J., Lankhorst,R.K., Mao,L.,
Arsova,B., Fei,Z., Rose,J.K.C., Zamir,D., Carrari,F.,
Giovannoni,J.J., Weigel,D., Usadel,B. and Fernie,A.R.
TITLE The genome of the highly stress tolerant wild species tomato
Solanum pennellii
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 53391715)
AUTHORS Bolger,M.
TITLE Direct Submission
JOURNAL Submitted (11-MAR-2014) Institute for Biology and Molecular
Genetics, IBMG, Worringer Weg 2, 52074 Aachen, GERMANY
FEATURES Location/Qualifiers
source 1..53391715
/organism="Solanum lycopersicum"
/mol_type="genomic DNA"
/cultivar="M82"
/db_xref="taxon:4081"
/chromosome="ch11"
assembly_gap 3006..4527
/estimated_length=1522
/gap_type="unknown"
assembly_gap 235948..237556
/estimated_length=1609
/gap_type="unknown"
assembly_gap 278722..279037
/estimated_length=316
/gap_type="unknown"
assembly_gap 330328..334912
/estimated_length=4585
/gap_type="unknown"
assembly_gap 340020..340039
/estimated_length=20
/gap_type="unknown"
assembly_gap 465123..466626
/estimated_length=1504
/gap_type="unknown"
assembly_gap 526396..526996
/estimated_length=601
/gap_type="unknown"
assembly_gap 543804..544502
/estimated_length=699
/gap_type="unknown"
assembly_gap 797459..797531
/estimated_length=73
/gap_type="unknown"
assembly_gap 798717..798736
/estimated_length=20
/gap_type="unknown"
assembly_gap 880445..880808
/estimated_length=364
/gap_type="unknown"
assembly_gap 922910..924137
/estimated_length=1228
/gap_type="unknown"
assembly_gap 955309..956272
/estimated_length=964
/gap_type="unknown"
assembly_gap 973322..974164
/estimated_length=843
/gap_type="unknown"
assembly_gap 1014231..1015707
/estimated_length=1477
/gap_type="unknown"
assembly_gap 1030043..1030062
/estimated_length=20
/gap_type="unknown"
assembly_gap 1032243..1032262
/estimated_length=20
/gap_type="unknown"
assembly_gap 1117983..1118965
/estimated_length=983
/gap_type="unknown"
assembly_gap 1327801..1328358
/estimated_length=558
/gap_type="unknown"
assembly_gap 1385108..1385697
/estimated_length=590
/gap_type="unknown"
assembly_gap 1395453..1395875
/estimated_length=423
/gap_type="unknown"
assembly_gap 1407234..1407801
/estimated_length=568
/gap_type="unknown"
assembly_gap 1625800..1628724
/estimated_length=2925
/gap_type="unknown"
assembly_gap 1728623..1729130
/estimated_length=508
/gap_type="unknown"
assembly_gap 1741232..1742576
/estimated_length=1345
/gap_type="unknown"
assembly_gap 1746875..1748022
/estimated_length=1148
/gap_type="unknown"
assembly_gap 1784659..1785234
/estimated_length=576
/gap_type="unknown"
assembly_gap 2011894..2012425
/estimated_length=532
/gap_type="unknown"
assembly_gap 2026556..2026873
/estimated_length=318
/gap_type="unknown"
assembly_gap 2090509..2094696
/estimated_length=4188
/gap_type="unknown"
assembly_gap 2100607..2100626
/estimated_length=20
/gap_type="unknown"
assembly_gap 2111277..2112354
/estimated_length=1078
/gap_type="unknown"
assembly_gap 2119032..2119051
/estimated_length=20
/gap_type="unknown"
assembly_gap 2155331..2156732
/estimated_length=1402
/gap_type="unknown"
assembly_gap 2219018..2219339
/estimated_length=322
/gap_type="unknown"
assembly_gap 2221839..2222668
/estimated_length=830
/gap_type="unknown"
assembly_gap 2239278..2239297
/estimated_length=20
/gap_type="unknown"
assembly_gap 2239821..2239840
/estimated_length=20
/gap_type="unknown"
assembly_gap 2268201..2269270
/estimated_length=1070
/gap_type="unknown"
assembly_gap 2276745..2278135
/estimated_length=1391
/gap_type="unknown"
assembly_gap 2292824..2292843
/estimated_length=20
/gap_type="unknown"
assembly_gap 2293372..2293659
/estimated_length=288
/gap_type="unknown"
assembly_gap 2298193..2304790
/estimated_length=6598
/gap_type="unknown"
assembly_gap 2327214..2328179
/estimated_length=966
/gap_type="unknown"
assembly_gap 2381751..2383207
/estimated_length=1457
/gap_type="unknown"
assembly_gap 2387140..2389624
/estimated_length=2485
/gap_type="unknown"
assembly_gap 2403359..2404211
/estimated_length=853
/gap_type="unknown"
assembly_gap 2428997..2432066
/estimated_length=3070
/gap_type="unknown"
assembly_gap 2434240..2436677
/estimated_length=2438
/gap_type="unknown"
assembly_gap 2451722..2452537
/estimated_length=816
/gap_type="unknown"
assembly_gap 2465363..2465664
/estimated_length=302
/gap_type="unknown"
assembly_gap 2470185..2474573
/estimated_length=4389
/gap_type="unknown"
assembly_gap 2491885..2492567
/estimated_length=683
/gap_type="unknown"
assembly_gap 2608181..2609389
/estimated_length=1209
/gap_type="unknown"
Query Match 99.8%; Score 926.6; Length 5391715;
Best Local Similarity 99.1%;
Matches 919; Conservative 8; Mismatches 0; Indels 0; Gaps 0;
Qy 3 ATGGAGCTTTTAAGTGTTCAACTATTGCTCATAATCAAGAAACTAATGGTTCGTGTTTGA 62
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4532282 ATGGAGCTTTTAAGTGTTCAACTATTGCTCATAATCAAGAAACTAATGGTTCGTGTTTGA 4532223
Qy 63 ACCTAAGAGGGAATATCTCATCTGATTAAWGTTATAGCTCAAGAGTTGATTTGCATANAT 122
|||||||||||||||||||||||||||||:|||||||||||||||||||||||||||:||
Db 4532222 ACCTAAGAGGGAATATCTCATCTGATTAAAGTTATAGCTCAAGAGTTGATTTGCATACAT 4532163
Qy 123 ATTTACGTGACAAACTAATGCACACTACTAATTCCTCTATGTGGAGTGTTTGGAATCTGA 182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4532162 ATTTACGTGACAAACTAATGCACACTACTAATTCCTCTATGTGGAGTGTTTGGAATCTGA 4532103
Qy 183 ACTTCTTACTAGCACTAATAAAGGGAGAAAACAATATACGAAACTTCTAACATAAAAGCC 242
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4532102 ACTTCTTACTAGCACTAATAAAGGGAGAAAACAATATACGAAACTTCTAACATAAAAGCC 4532043
Qy 243 ACAGATCAATCTAATGNAACCCAAACTTTTTCTTGTTCTCCCTTGATTCTTCAGATTCAT 302
||||||||||||||||:|||||||||||||||||||||||||||||||||||||||||||
Db 4532042 ACAGATCAATCTAATGCAACCCAAACTTTTTCTTGTTCTCCCTTGATTCTTCAGATTCAT 4531983
Qy 303 ATGATGAATATAACTCGGATAACCATTTAAACATTTACATACATACCTCGACTAAGTCGA 362
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531982 ATGATGAATATAACTCGGATAACCATTTAAACATTTACATACATACCTCGACTAAGTCGA 4531923
Qy 363 CGGTACCTNCTATCTCCCATAAGCAGCTAACTTTGTTCACCAAGACTTGGACAGATGAAA 422
||||||||:|||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531922 CGGTACCTACTATCTCCCATAAGCAGCTAACTTTGTTCACCAAGACTTGGACAGATGAAA 4531863
Qy 423 AGAAACCGTCTAGTATTTTTTCTTTGAAACATTAACCAAAATCAAGAAGAATGATCAGTC 482
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531862 AGAAACCGTCTAGTATTTTTTCTTTGAAACATTAACCAAAATCAAGAAGAATGATCAGTC 4531803
Qy 483 TAAACCTATTCCAGCTATCACCAAACCATTTTAATAATCTCTCCAAGATTCCTACTCATC 542
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531802 TAAACCTATTCCAGCTATCACCAAACCATTTTAATAATCTCTCCAAGATTCCTACTCATC 4531743
Qy 543 CATAACCGAACAATAGATAGCAAAAATCACATACCAAAGACAAAAACAAAATGAACAATT 602
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531742 CATAACCGAACAATAGATAGCAAAAATCACATACCAAAGACAAAAACAAAATGAACAATT 4531683
Qy 603 TTACAACAATACCATAGTAAAAAGCACCACGATACACTCACAAACAAGGGGTGGAGCTAG 662
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531682 TTACAACAATACCATAGTAAAAAGCACCACGATACACTCACAAACAAGGGGTGGAGCTAG 4531623
Qy 663 AGGAACTCGAGGAGTTCATCTGAAACACTCACAAACATTCAAGGGCAGAGCTAGGGGACG 722
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531622 AGGAACTCGAGGAGTTCATCTGAAACACTCACAAACATTCAAGGGCAGAGCTAGGGGACG 4531563
Qy 723 CAAAACGAACCGCATTCACTAGAAAATTATAGTTGATATATACAAGATCAAGATTTAATN 782
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||:
Db 4531562 CAAAACGAACCGCATTCACTAGAAAATTATAGTTGATATATACAAGATCAAGATTTAATT 4531503
Qy 783 TACATATAATAGATGCTGCATCCTCTTGGCTAGGAGATCCCACACTTTTTAGCTCCCTCG 842
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4531502 TACATATAATAGATGCTGCATCCTCTTGGCTAGGAGATCCCACACTTTTTAGCTCCCTCG 4531443
Qy 843 NCGACTCGAACTCACAACCTTAGGGTTGAGAGTNATGAATGTTTATCANCCGAGCAACTT 902
:||||||||||||||||||||||||||||||||:||||||||||||||:|||||||||||
Db 4531442 GCGACTCGAACTCACAACCTTAGGGTTGAGAGTAATGAATGTTTATCAGCCGAGCAACTT 4531383
Qy 903 CCACTTATCTCCTCTTGGCTTCTTCGC 929
|||||||||||||||||||||||||||
Db 4531382 CCACTTATCTCCTCTTGGCTTCTTCGC 4531356
Furthermore, SEQ ID NO:6 comprise ambiguity symbol of N and Y, SEQ ID NO: 11 comprise ambiguity symbol of R and SEQ ID NO: 16 comprise ambiguity symbol of N in multiple positions. For example, Handbook of Intellectual property information and documentation, WIPO, sates that ambiguity symbol of “n” represent any of a, c, g or t/u or, unknown reside, R would be any of a or g and w would Y would be c or t/u (page 29). Therefore, applicant is claiming a broad genus of recombinant chromosome segments. Furthermore, Table 1 lists specific favorable allele would been required to be associated to cause disease resistance (Spec, page 47, Table 1).
Relating to structure vs. function, the claims remain drawn to any unspecified allele of the unspecified marker loci. This leads to a situation where the instantly claimed allele of the claimed marker loci would not possess the necessary structural features needed to accomplish the claimed phenotype. The Specification makes clear that the specific single nucleotide polymorphisms (i.e. nucleotide residue “C”, at position 54,914,243 of M1 (i.e. SEQID NO:6), residue “G” at position 55,135,473 of M2 or SEQ ID NO: 11 and residue “T” at position 55,443,272 of M3 or SEQ ID NO:16 are comprised within the marker alleles that leads to the phenotype of the caused QTLs (page 47, Table 1), thus it is necessary to claim the polymorphisms as such (i.e., specific favorable alleles).
Applicant does not describe the structure of the deleterious allele that confers cold sensitivity to the plant and there is no known correlation between the structure and function of an allele from chromosome 11 in S. chilense that confers resistance to ToCV and is not linked to an allele conferring deleterious cold sensitivity. For example Deng et al. (Published: 2025, Journal: Plant Physiology, 199: 2 pages 1-36 https://doi.org/10.1093/plphys/kiaf420) teaches cold stress, including chilling (0–12 °C) and freezing (<0 °C) temperatures, inhibits tomato plant growth and development and adaptation of tomato wherein plant mitigates this by large scale transcriptional reprogramming of COLD-RESPONSIVE (COR) regulatory functional genes (page 2, left paragraph 2). Deng et al. teaches various phytohormones such as ethylene, gibberellins etc. also modulate cold-stress response (page 2, left paragraph 3, Figure 8). Therefore, there would be many genes effecting sensitivity to cold stress in any tomato plants. Instead, applicant has not described any chromosomal segment lacking deleterious cold sensitivity allele other than in the deposited line CHI-1120-0340 as deposit of NCMA Accession Number 202007005.
Art does not teach SEQ ID NOs: 6, 11 and 16 are comprised in a locus from S. chilense, wherein SEQ ID NOs: 6 and 16 appears to be from S. lycopersicum cultivar M82 (see alignment above). In fact, the art, in general, teaches little if any sequence information about S. chilense chromosome 11 associated with ToCV resistance. Applicant fails to describe if, for example, SEQ ID NOs: 6, 11 and 16 are present in all S. chilense plants as highly conserved sequences or whether they are only found flanking the gene or genes associated with the ToCV resistance when introgressed into tomato plant and that are uniquely present in the deposited lines.
Still further, although SEQ ID NOs: 6, 11 and 16 are recited in claims 13 and 16, they are used as reference markers to track the recombinant QTL from S. chilense in deposited line (page 47, Table 1).
For example, the art teaches that a variety of ways exist to map genetic information, e.g., RFLP, SSR, SNP, AFLP. Batley & Edwards, “SNP applications in plants,” Association Mapping in Plants, Oraguzie et al., eds. Springer, Berlin, 95-102 (2007), p. 96. However, the features and applications for AFLP, RFLP, SSR, and SNP molecular genetic markers vary widely, and each has strength and weaknesses. (page 96, Table 6.1). Furthermore, Ganal et al. (Published:2009, Journal: Current Opinion in Plant Biology 12:211–217) warn that there are few validated SNP markers for crop plants.
Therefore, Applicant fails to describe structural or functional features common to the genus of alleles or marker loci allegedly responsible for the recited functions.
Vas-Cath Inc. v. Mahurkar teaches that the purpose of the written description is for “warning an innocent purchaser, or other person using a machine, of his infringement of the patent; and at the same time, of taking from the inventor the means of practicing upon the credulity or the fears of other persons, by pretending that his invention is more than what it really is, or different from its ostensible objects, that the patentee is required to distinguish his invention in his specification.” Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, 1115-16 (Fed. Cir. 1991) (quoting Evans v. Eaton, 20 U.S. (7 Wheat.) 356, 434 (1822). In this case, a practitioner would not be able to determine if any particular tomato plant with introgressed S. chilense loci with at least the same pattern of resistance is infringing the instant claims, and therefore, the public has not been put on notice with a sufficient description of the claimed invention.
The Enzo decision states that written description requirement may be satisfied by a deposit. Enzo Biochem Inc. v. Gen-Probe Inc., 323 F3d 956, 63 USPQ2d 1609, 1613 (Fed. Cir. 2002). However, the MPEP emphasizes that the Final Rule governing the deposit of biological materials requires that “[o]nce the patent issues, the description must be sufficient to aid in the resolution of questions of infringement.” MPEP § 2163(I) (quoting 54 Fed. Reg. 34,864, 34,880 (22 August 1989).
Furthermore, by requiring a tomato plant with S. chilense genetic information, but not requiring the locus present in the deposited seeds, Applicant is attempting to reach through and claim the full genus of, e.g. any tomato plants that comprise S. chilense loci providing resistance to downy mildew. Thus, these claims are "reach through" claims in which the specification has described a starting material and at least one method step, however, they have not described the resulting product that they are claiming, where the genus of products that can be produced by the recited method steps and materials is so large that one of skill in the art is not able to envision the members of the genus. See Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 920-23, 69 USPQ2d 1886, 1890-93 (Fed. Cir. 2004).
The claimed genera include, in their broadest scope, all genes that can be obtained from S. chilense chromosome 11 that confer some degree of resistance to ToCV races by some undefined mechanism. Applicant fails to describe a representative number of species compared to the size of the claimed genera. Applicant also fails to provide written description in the specification with regard to the structural and functional characteristics necessary and/or sufficient for the claimed plants and methods as broadly as claimed. The specification also lacks written description with regard to the broadly claimed methods of identifying spinach plants that comprise the claimed locus and/or display the claimed resistance.
Thus, Thus, based on the analysis above, Applicant has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly. As a result, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed.
Summary
No claim is allowed.
Closest Prior Art
Claims 13-18 are free of prior art. The closest prior art is Pérez de Castro et al. (Published: 2013, Journal: Euphytica 190(2): 203-214) which teaches a segment introgressed from S. chilense into S. lycopersicum in distal end of chromosome 11 which is disclosed as family 4 and 5, which is homozygous (see for example Family 4, markers interval ct55 (map position 45.0 cM) to T0386A (map position 85.0 cM)) and heterozygous to the introgressed locus (see for example markers interval ct55 (map position 45.0 cM)) to C2At2g28490 (map position 98.0))(Page 209, Figure 2)), which conferred resistance to tomato yellow leaf curl disease. The patentable distinction is Pérez de Castro et al. does not teach their recombinant fragment is flanked by marker locus M1 (SEQ ID NO:6) and marker locus M3 (SEQ ID NO:16) on the chromosome 11, the recombinant fragment cause resistance to ToCV and it lacks the allele genetically linked to cold sensitivity.
Examiner’s Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SANTOSH SHARMA whose telephone number is (571)272-8440. The examiner can normally be reached Mon-Fri 8:00 AM - 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, AMJAD A. ABRAHAM can be reached at (571)270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SANTOSH SHARMA/ Examiner, Art Unit 1663
/DAVID H KRUSE/ Primary Examiner, Art Unit 1663
Prosecution Insights