Prosecution Insights
Last updated: August 16, 2026
Application No. 18/761,504

COMPLEMENT COMPONENT C5 iRNA COMPOSITIONS AND METHODS OF USE

Non-Final OA §102§103§112
Filed
Jul 02, 2024
Priority
Sep 18, 2018 — provisional 62/732,655 +2 more
Examiner
ZAHORIK, AMANDA MARY
Art Unit
Tech Center
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
1y 6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
42 granted / 73 resolved
-2.5% vs TC avg
Strong +48% interview lift
Without
With
+48.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
51 currently pending
Career history
116
Total Applications
across all art units

Statute-Specific Performance

§101
6.1%
-33.9% vs TC avg
§103
33.4%
-6.6% vs TC avg
§102
16.3%
-23.7% vs TC avg
§112
31.4%
-8.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 73 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received 03/12/2025. Claims 1-8, 12, 14-19, and 26-28 are currently pending and are examined herein. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-2, 7-8, 12, 14 and 18 are rejected under 35 U.S.C. 102(a)(1)/102(a)(2) as being anticipated by U.S. Patent Publication No. 2017/0253874 to Borodovsky (hereinafter ‘Borodovsky’; published 09/07/2017, priority filing 09/16/2015). Claim interpretation: Claim 1 is drawn to a product, i.e., a dsRNA agent. The claim further recites an intended use for the agent in inhibiting expression of complement component C5 for the prevention or treatment of Alzheimer’s disease, atherosclerosis, or inflammation of the choroid plexus (Chp). MPEP 2111.02 states: “During examination, statements in the preamble reciting the purpose or intended use of the claimed invention must be evaluated to determine whether or not the recited purpose or intended use results in a structural difference (or, in the case of process claims, manipulative difference) between the claimed invention and the prior art.”. Further, “If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction (Id.). Further, “a preamble generally is not limiting when the claim body describes a structurally complete invention such that deletion of the preamble phrase does not affect the structure or steps of the claimed invention” (Id.). In the instant case, the body of the claim fully sets forth a structurally complete dsRNA, with sense and antisense strand sequences, and deletion of the preamble phrase does not affect the structure of the claimed dsRNA. Therefore, for the purposes of comparison to the prior art, and in accordance with MPEP 2111.02, the intended use of the dsRNA is not considered a limitation. Regarding claims 1 and 2, Borodovsky teaches a dsRNA agent, AD-61679, comprising a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand comprises/consists of 5' - UGACAAAAUAACUCACUAUAA - 3' and the nucleotide sequence of the antisense strand comprises 5' - UUAUAGUGAGUUAUUUUGUCAAU - 3' (claim 1) or consists of 5'-UUAUAGUGAGUUAUUUUGUCAAUdTdT-3' (claim 2): [0917] AD-61679 (unmodified sense sequence: 5′-UGACAAAAUAACUCACUAUAA-3′; modified sense sequence: 5′-usgsAfcAfaAfaUfAfAfcUfcAfcUfaUfaaL96-3′; unmodified antisense sequence: 5′-UUAUAGUGAGUUAUUUUGUCAAU-3′; modified antisense sequence: 5′-usUfsauaGfuGfaGfuuaUfuUfuGfucasasudTdT-3′) Regarding claim 7, Borodovsky teaches wherein the sense strand comprises two phosphorothioate linkages at the 5’-terminus and the antisense sense comprises two phosphorothioates at the 5’-terminus as well as two at the 3’-terminus (“s”; see above). Regarding claims 8 and 14, Borodovsky teaches wherein the sense strand is conjugated to a ligand comprising one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at the 3’-terminus (L96, seen above, which Table 2 on p. 81 discloses to be the trivalent alkyl-linked GalNAc derivative N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3). Regarding claim 12, Borodovsky teaches wherein each strand is independently 21-30 nucleotides in length (see above). Regarding claim 18, Borodovsky teaches administering AD-61679 to mice in vivo, i.e., a pharmaceutical composition comprising AD-61679 (see above). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 3-6, 15-17, 19 and 26-28 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. Patent Publication No. 2017/0253874 to Borodovsky (hereinafter ‘Borodovsky’; published 09/07/2017, priority filing 09/16/2015). Borodovsky teaches the dsRNA agent of claim 1 (AD-61679), as described in the above rejection of claim 1 under 35 U.S.C. 102. Regarding claims 3-6, Borodovsky teaches that all the nucleotides of the antisense strand comprise either a 2’-O-methyl modification (2’-OMe; lower case a, c, g, u) or a 2’-fluoro modification (2’-F; Af, Uf, Cf, Gf)(see the rejection under 35 U.S.C. 102 above). Regarding claims 3-6, Borodovsky’s dsRNA agent differs from the instantly claimed agent insofar as Borodovsky teaches that all nucleotides of the sense strand of AD-58641.1 are modified, but does not teach that substantially all, i.e., not all of the nucleotides are modified. However, Borodovsky does teach a dsRNA agent for inhibiting expression of complement component C5 wherein substantially all of the nucleotides of the sense strand are 2’-OMe and/or 2’-F-modified (para [0013]). Further, Borodovsky teaches that the, “sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.” (para [0396]. Regarding claims 15-17, while Borodovsky teaches that the sense strand is conjugated to the N-acetylgalactosamine derivative L96, N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3, Borodovsky does not explicitly teach the structure of the ligand nor how it is conjugated to the sense strand, as recited in claims 15-17. However, Borodovsky does teach a dsRNA agent for inhibiting expression of complement component C5 wherein the sense strand is conjugated to the ligand as shown in the recited schematic (para [0024], figure reproduced below) wherein X is O (para [0026]): PNG media_image1.png 354 543 media_image1.png Greyscale Borodovsky further teaches in vivo administration of AD-58641 via subcutaneous injection (col 219 ln 5-10). Lastly, Borodovsky provides a teaching, suggestion, or motivation to use the disclosed dsRNAs for inhibiting C5 to treat C5-associated diseases in human subjects, including Alzheimer’s disease, atheroschlerosis, and establishes that there existed an art-recognized need for such treatments: [0004] …two complement effectors, C5a and C5b-9, generated from C5 cleavage, are key components of the complement system responsible for propagating and/or initiating pathology in different diseases, including paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, ischemia-reperfusion injuries and neurodegenerative diseases. [0005] …there is a need in the art for alternative therapies and combination therapies for subjects having a complement component C5-associated disease. [0338] …methods and compositions including these iRNAs are useful for treating a subject who would benefit by a reduction in the levels and/or activity of a C5 protein, such as a subject having a complement component C5-associated disease 13. The method of claim 11, wherein the complement component C5-associated disease is selected from the group consisting of…atherosclerosis, Alzheimer's disease It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified AD-61679 according to the alternatives disclosed by Borodovsky. Where the prior art teaches a dsRNA agent for reducing C5 expression and further provides conjugates and modifications for routine optimization of the dsRNA agent, a person of ordinary skill has good reason to pursue the known options within their technical grasp for optimization of the agent for various characteristics, such as increased half-life or thermal stability. It would further have been obvious to try using AD-61679 to inhibit C5 expression and thereby treat atherosclerosis or Alzheimer’s disease in a human subject. The ordinary artisan would have been motivated to do so based on Borodovsky’s teaching that there was an art-recognized need for treatments to inhibit C5 expression or activity and thereby treat C5-associated diseases, combined with Borodovsky’s teachings that both Alzheimer’s disease and atherosclerosis were known C5-associated diseases. Claim Rejections - 35 USC § 112(a) – Enablement Claims 26-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for methods of treating Alzheimer’s disease, atherosclerosis, or ChP, the method comprising administering to a subject an effective amount of the recited dsRNA agent which inhibits expression of complement component C5, does not reasonably provide enablement for preventing the same. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention The invention is the class of invention that the CAFC has characterized as “the unpredictable arts such as chemistry and biology.” Mycogen Plant Sci., Inc. v. Monsanto Co., 243 F.3d 1316, 1330 (Fed. Cir. 2001). Breadth of the Claims The claims encompass methods of preventing or treating Alzheimer’s disease, atherosclerosis or ChP in a human subject, comprising administering an effective amount of a dsRNA agent which inhibits expression of complement component C5, wherein the dsRNA agent comprises the sense and antisense strands having the nucleotide sequences recited in claim 26. Applicant regards the term “prevention” or “preventing” to mean the following (p. 11 ln 5-15): As used herein, "prevention" or "?preventing," when used in reference to Alzheimer's disease, artherosclerosis, or inflammation of the choroid plexus, refers to a reduction in the likelihood that a subject will develop a symptom or sign associated with Alzheimer's disease, artherosclerosis, or inflammation of the choroid plexus. The likelihood of developing a atherosclerosis is reduced, for example, when an individual having one or more risk factors for atherosclerosis either fails to develop artherosclerosis or develops atherosclerosis with less severity relative to a population having the same risk factors and not receiving treatment as described herein. The failure to develop a disease, disorder or condition, or the reduction in the development of a sign or symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention. Applicant regards the term “treating” or “treatment” to mean the following (p. 10 ln 35-40): As used herein, the terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation of one or more signs or symptoms associated with Alzheimer's disease, artherosclerosis, or inflammation of the choroid plexus. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Guidance of the Specification The specification provides working examples of alleviating symptoms of complement-triggered choroid plexus inflammation in an ApoE -/- mouse model of atherosclerosis using AD-61679 siRNA (pp. 24-25, Example 3). The specification further discloses that C5 siRNA reduces disease-associated microglia cells in a mouse model of AD (p. 26) and reduces atherosclerosis inflammation (p. 27). However, the specification does not reduce to practice prevention of any disease or symptoms thereof. State of the Art MPEP 2164.03 states, “The amount of guidance or direction needed to enable the invention is inversely related to the amount of knowledge in the state of the art as well as the predictability in the art… if little is known in the prior art about the nature of the invention and the art is unpredictable, the specification would need more detail as to how to make and use the invention in order to be enabling…In cases involving unpredictable factors, such as most chemical reactions and physiological activity, more may be required.” In the instant case, there was, even after the filing date of the instant invention, no clear consensus on or understanding of the risk factors underlying Alzheimer’s disease, nor known effective preventative or disease-modifying treatments. In a 2017 review, Medina (Alzheimer’s & Dementia: Translational Research & Clinical Interventions 3 (2017) 571-578.) stated: Despite remarkable advances in understanding the neurobiology underlying AD, during the last three decades, numerous attempts to develop effective disease-modifying therapies have failed to demonstrate clinical efficacy. The reasons for these successive failures to develop treatment for AD have been the topic of extensive deliberations, where a variety of potential contributors or plausible answers for these disappointing results have been considered. However, these explanations do not adequately account for the poor outcomes of most efficacy trials. The failures in therapy development have begun to reinforce the growing recognition that there are major gaps in our understanding of the neurodegenerative process in AD….It is now clear that dementia-AD is a complex entity that includes a variable genetic signature potentially accounting for a significant portion of disease risk. (p. 575) Further, Medina noted: Presently, the mechanistic relationships among the various risk factors are not known, and the various hypotheses about these common mechanisms have not been validated. This question remains as one of the important challenges for future R&D on preventive therapies. (p. 576) In summary, the art of the time showed that no preventative therapies for AD were extent, and in fact the causes and risk factors for AD were not well-understood. Experimentation Required The claims explicitly encompass preventing AD in a subject. Looking to the prior art for guidance, a search of the prior art did not identify any methods which could effectively prevent AD in a subject. In fact, no prior art was identified which taught effective prevention of AD using any agent similar to the agents utilized in the instant claims. The specification also does not provide any working example demonstrating prevention of AD in a subject. Therefore, given the lack of knowledge present in the prior art and the lack of guidance provided in the specification with respect to preventing AD, further experimentation would be required. Considering that the additional experimentation would require de novo experimentation without a guarantee of success, and further considering that any positive results (i.e., successful prevention of AD in a subject) would amount to a significant advancement in the state of the art, the additional experimentation required is considered undue. Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, it is the conclusion that an undue amount experimentation would be required to make and use the invention as claimed. Conclusion No claim is allowed at this time. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA M ZAHORIK/Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 02, 2024
Application Filed
Jul 21, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12674166
RNAI CONSTRUCTS FOR INHIBITING PNPLA3 EXPRESSION AND METHODS OF USE THEREOF
5y 0m to grant Granted Jul 07, 2026
Patent 12674167
APTAMER SPECIFICALLY BINDING TO CANCER STEM CELLS, AND USE THEREOF
4y 9m to grant Granted Jul 07, 2026
Patent 12668795
INHIBITOR OF MIR-129 AND USES THEREOF
4y 9m to grant Granted Jun 30, 2026
Patent 12667629
INCREASED PACKAGING EFFICIENCY OF VECTOR FOR CARDIAC GENE THERAPY
3y 0m to grant Granted Jun 30, 2026
Patent 12662508
COMPOUNDS AND METHODS FOR MODULATING ANGIOTENSINOGEN EXPRESSION
4y 0m to grant Granted Jun 23, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+48.2%)
3y 7m (~1y 6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 73 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month