Prosecution Insights
Last updated: October 04, 2026
Application No. 18/840,525

NUCLEIC ACID CONSTRUCT BASED ON CRE-LOXP AND CRISPR AND USE THEREOF

Non-Final OA §102§103§112
Filed
Aug 22, 2024
Priority
May 27, 2022 — CN 202210594619.4 +1 more
Examiner
SPENCER, ANDREA LYNNE MORRIS
Art Unit
Tech Center
Assignee
Shanghaitech University
OA Round
1 (Non-Final)
22%
Grant Probability
At Risk
1-2
OA Rounds
1y 8m
Est. Remaining
58%
With Interview

Examiner Intelligence

Grants only 22% of cases
22%
Career Allowance Rate
2 granted / 9 resolved
-37.8% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
41 currently pending
Career history
63
Total Applications
across all art units

Statute-Specific Performance

§101
3.5%
-36.5% vs TC avg
§103
45.1%
+5.1% vs TC avg
§102
17.6%
-22.4% vs TC avg
§112
22.7%
-17.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 9 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Claims Status Claim 10 is canceled, claims 11-21 are newly added, and claims 1-9 and 11-21 are pending. Priority The present application is a 35 U.S.C. 371 national stage filing of International Application No. PCT/CN2023/094885, filed 05/17/2023. Applicant's claim for the benefit of a prior-filed parent application CN202210594619.4, filed on 05/27/2022, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55 for the Foreign Priority Application, filed 08/22/2024. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. The effective priority date for the instant application is 05/17/2023. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 3, 9, 11, 13, 15 and 20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Regarding claims 9, 11, 13, 15 and 20: The claims are drawn to a transgene expressing a Cas protein or derivatives thereof and a nucleotide sequence encoding a Cre enzyme or a Cas protein or derivatives thereof. The claims are directed to a genus of recombinant nucleic acid sequences which encode a Cre or Cas protein or a derivative of the protein. The scope of the genus claimed by “derivative thereof” is extremely broad and encompasses any nucleic acid sequence that encodes any part of a Cre or Cas protein. The instant specification teaches the Cas protein can be a Cas9 and the Cre enzyme can be a wild-type Cre enzyme or CreER (p7 [0033]). The instant specification further teach the use of transgenic mice expression specific Cas and Cre proteins; CAG-Cas9 (JAX: 028555); UBC-Cre-ERT2 (JAX: 007179) (p10; [0070]-[0071]. Thus, while the disclosure satisfies the written description requirement for Cas9, wild-type Cre and CreER, the written description requirement is not satisfied for the broad genus of nucleotides encoding all derivatives of Cas and Cre proteins. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-4 and 7-8 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 4, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Regarding claims 1-3, 7-8: The claims recite “nucleic acid pair”. The instant specification is silent as to a specific definition of “nucleic acid pair”. The phrase “nucleic acid pair” could be interpreted as a pair of sense/antisense nucleic acids, two independent nucleic acid molecules comprising the claimed sequence or one nucleic acid molecule comprising both of the claimed sequences. Because the invention is drawn to a LoxP nucleic acid pair, and LoxP sites are typically found on the same nucleic acid molecule with some amount of intervening sequence, the limitation is interpreted as such. Thus, for purposes of compact prosecution “nucleic acid pair” is interpreted as a single nucleic acid molecule which comprises the nucleic acid sequences encoded by Seq ID No: 1 and Seq ID NO: 2. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-4, 7-9, 16-17 and 20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Liu et al (Cell (2022) 185;3008-3024; epub 07/22/2022; cited in the IDS filed 08/08/2025) and as evidenced by Addgene plasmid #187460 (iMAP-61 Sequences [online]. AddGene corporation [retrieved on 08/03/2026]. Retrieved from the Internet: <https://www.addgene.org/187460/sequences/#addgene-fulle: iMAP-61 Sequences). Regarding claim 1: Figure S1a of Liu teach the LoxP nucleic acid pair “Lox71” and “TC9” which comprise 100% sequence identity with Seq Id NO: 1 and Seq ID NO: 2 of the instant disclosure; (see below): Seq ID NO:1/ TATA-Lox71 Fig S1A): Query 1 TACCGTTCGTATAGTATAAATTATACGAAGTTAT 34 |||||||||||||||||||||||||||||||||| Sbjct 1 TACCGTTCGTATAGTATAAATTATACGAAGTTAT 34 Seq ID NO: 2/TATA-LoxTC9: Query 1 ATAACTTCGTATAGTATAAATTATTGCTTCGGTA 34 |||||||||||||||||||||||||||||||||| Sbjct 1 ATAACTTCGTATAGTATAAATTATTGCTTCGGTA 34 Regarding claim 2: The claim recites the intended result “the LoxP nucleic acid pair can undergo only one round of Cre enzyme-mediated recombination” and does not confer structure to the claimed nucleic acid pair. Thus any nucleic acid pair with the identical structure as the nucleic acid pair of claim 1 in combination with a Cre enzyme is considered to produce the identical intended result. The teachings of Liu are discussed above. Liu further teach Ubc-CreER is introduced into the 61-guide transgenic mouse line, which comprises the LoxP sites of claim 1 (Fig 1A) (p3010 col2 ¶6). Cre expression is induced using tamoxifen (p3010 col2 ¶6). This reads on a Cre-LoxP recombination system comprising a Cre enzyme and the LoxP nucleic acid pair according to claim 1. Regarding claims 3: The claim recites the intended result of using the claimed nucleic acid construct; “the LoxP nucleic acid pair according to claim 1 is capable of only one round of Cre enzyme mediated recombination, resulting an induction of sgRNA expression; the sgRNA then recruits Cas proteins or derivatives thereof to perturb the target genes”. The result of using the construct does not confer structure to the nucleic acid construct and any composition with the identical structure of the claimed composition is considered to produce the identical result. The teachings of Liu are discussed supra. Figure S1a of Liu teach the LoxP nucleic acid pair “Lox71” and “TC9” which comprise 100% sequence identity with Seq Id NO: 1 and Seq ID NO: 2 of the instant disclosure; (see below): Seq ID NO:1/ TATA-Lox71 Fig S1A): Query 1 TACCGTTCGTATAGTATAAATTATACGAAGTTAT 34 |||||||||||||||||||||||||||||||||| Sbjct 1 TACCGTTCGTATAGTATAAATTATACGAAGTTAT 34 Seq ID NO: 2/TATA-LoxTC9: Query 1 ATAACTTCGTATAGTATAAATTATTGCTTCGGTA 34 |||||||||||||||||||||||||||||||||| Sbjct 1 ATAACTTCGTATAGTATAAATTATTGCTTCGGTA 34 Liu further teach a nucleic acid construct that comprises a U6 promoter, a series of tandemly linked guides encoding both the spacer and the scaffold in conjunction with a transcription terminator (sgRNA expression elements in tandem), a pair of piggyback inserted terminal repeats flanking the transgene (an inverted terminal repeat sequence of a transposon) (p3010; col1 ¶3; Figure 1A). Liu teach the U6 promoter carries the bifunctional LoxP sites (TATA-Lox71 and TAT-LoxTC9, which comprise 100% identity with the claimed LoxP sites as discussed above) (p3010; col1 ¶3). Liu teach that the nucleic acid construct plasmid #187460 (AddGene) carries the 61-guide transgene and thus comprises the sgRNA transgene (pe3). Plasmid 187460 also comprises a U6 promoter which shares 100% identity with Seq ID No: 3 of the instant invention (see below). Query 1 CGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1531 CGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCG 1590 Query 61 GCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1591 GCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAA 1650 Query 121 TGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1651 TGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGG 1710 Query 181 CTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1711 CTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGG 1770 Query 241 AAACTCACCCTAACTGTAAAGTAATTTACCGTTCGTATAGTATAAATTATACGAAGTTAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1771 AAACTCACCCTAACTGTAAAGTAATTTACCGTTCGTATAGTATAAATTATACGAAGTTAT 1830 Query 301 AAGCCTTGTTTG 312 |||||||||||| Sbjct 1831 AAGCCTTGTTTG 1842 A nucleic acid sequence which encodes LoxP sites and sgRNAs is considered to read on a Cre-Lox recombination system and a CRISPR gene editing system. Regarding claim 4: The claim requires sgRNA expression elements that are more than 2. This is interpreted as 3 or more sgRNA expression elements. The teachings of Liu are discussed above. Liu further teach the transgene carries 61 guides and is encoded by plasmid 187460 (p3010 col2 ¶2). This reads on three or more sgRNA as required by the claim. Regarding claim 7: The teachings of Liu are discussed above. Liu further teach piggyBac vectors carrying the transgenes and plasmids carrying the 61-guide transgene is AddGene plasmid #187460 (Fig s1E; pe3 ¶2/4). The piggyBac vectors read on expression vector because they comprises a U6 promoter and are used for expression of the sgRNA guides. Regarding claims 8 and 16-17: The teachings of Liu are discussed above. Liu further teach a cell comprising the LoxP nucleic acid pair of claim 1 (Lox71/LoxTC9); Figure S1D teaches the reporter plasmid is transfected into mouse N2 cells and the 6th panel shows results from the construct comprising the Lox71/TC9 sites. Regarding claims 9 and 20: The claims are drawn to a method of use of the nucleic acid construct of claims 3 and 4. Any method which comprises the recited active steps of the claimed method using the identical structures as claimed is considered to read on the method as claimed. The claim recite “so that the sgRNA is randomly expressed in germ cells of an animal in vivo”. This is an intended result which any method comprising the active steps and the structures required by the claim are considered to produce the claimed result. The active steps of the claim are using the nucleic acid construct, recombining, deriving an offspring and generating. The teachings of Liu are discussed supra. Liu also teach using piggyBac to generate a 61-guide transgenic line in germ cells, which as discussed above is encoded by plasmid 187460 (p3010 col2 ¶3; Figures 1C-D; 4G and S5). Liu teach deriving offspring expressing the same sgRNA throughout the body via natural reproduction; the 61-guide transgene can be stably transmitted to the offspring and passed the transgene for five generations (p3010 col2 ¶3). Recombining occurs because recombination is required for the sgRNA to be stably transmitted to the offspring. Liu teach generating a mosaic animal; the F5 sgRNA mouse was mated with the CAG-Cas9 transgenic mice and the resultant 61-guide; Cas9 mice (F6) were analyzed for transgene function and sequence integrity (p3010 col2 ¶3; Fig 1C-D). Liu further teach breeding single gene perturbation lines; Figure 1D shows a mosaic male can sire a pool of constitutive single-KO lines (Figure 1D). Thus the teachings of Liu anticipate the invention as claimed. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 5-6 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Liu et al as applied to claims 1-4, 7-9, 16-17 and 20 and further in view of Tiscornia et al (PNAS 2004) 101:19;1-5). Claims 1-4, 7-9, 16-17 and 20 are anticipated by Liu, and thus are also rendered obvious (see above). Regarding claims 5-6: The claims recite “the sgRNA expression elements in tandem further comprise a stuffer before or after the first sgRNA expression element; and the stuffer is a random inert sequence refractory to recombination” “wherein the length of the stuffer sequence is 0.5 kb to 10kb”. The instant specification further teach the “stuffer” is an inert sequence with a similar length but lacking LoxP (p13 [0083]). Tiscornia teach a recombinant expression system comprising a U6 promoter which is separated from a small hairpin RNA by a random DNA stuffer sequence (Abstract). Tiscornia teach the stuffer fragment is a randomly chosen 1-kb region of LacZ. This reads on an RNA element that comprises a stuffer before the first element, wherein the stuffer is a random inert sequence and the length of the stuffer sequence is 0.5 to 10 kb. MPEP 2131.03 reads “"[W]hen, as by a recitation of ranges or otherwise, a claim covers several compositions, the claim is ‘anticipated' if one of them is in the prior art." Titanium Metals Corp. v. Banner, 778 F.2d 775, 227 USPQ 773 (Fed. Cir. 1985)”. It would have been obvious to one of ordinary skill in the art to adapt the methods of Liu drawn to a nucleic acid construct encoding a Cre-Lox recombination system and a CRISPR gene editing system, by including 1kb of stuffer DNA with a random sequence as taught by Tiscornia. One of ordinary skill in the art would have been motivated to modify the nucleic acid construct as taught by Liu with the teachings of Tiscornia to include a 1kb DNA stuffer sequence using a random DNA sequence because Tiscornia teach the expression cassette is silent until activated by the addition of CRE recombinase (p3 col2 ¶3). Tiscornia further teach the levels of expression of the target gene can be manipulated (p5 col2 ¶2). Tiscornia teach the system provides a rapid and powerful approach to the study of gene function by generating localized, temporal and tissue-specific expression of the RNAs (p5 col2 ¶2). While Tiscornia disclose an inducible Cre-Lox system with a spacer identical to that of Liu (and would thus be incompatible with the system of Liu) Tiscornia also teach the alternative spacer “GCATACAT” which one of ordinary skill in the art would understand that the spacer would be compatible with the system of Liu (p2 col1 ¶3). One would have had a reasonable expectation of success because Tiscornia discloses a system for regulated expression of RNAs in an expression cassette and one of ordinary skill in the art would understand that a method of regulating one type of RNA expression (siRNA) could be adapted to use for regulation of another type of RNA expression (sgRNA). Regarding claim 21: The claims are drawn to a method of use of the nucleic acid construct of claims 3 and 4. Any method which comprises the recited active steps of the claimed method and comprises the identical structures as claimed are considered to read on the method as claimed. The claim recite “so that the sgRNA is randomly expressed in germ cells of an animal in vivo”. This is an intended result which any method comprising the active steps and the structures required by the claim are considered to produce the claimed result. The active steps of the claim are using the nucleic acid construct, recombining and deriving an offspring and generating. The teachings of Liu and Tiscornia are discussed supra. Liu also teach using piggyBac to generate a 61-guide transgenic line in germ cells, which as discussed above is encoded by plasmid 187460 (p3010 col2 ¶3; Figures 1C-D; 4G and S5). Liu teach deriving offspring expressing the same sgRNA throughout the body via natural reproduction; the 61-guide transgene can be stably transmitted to the offspring and passed the transgene for five generations (p3010 col2 ¶3). Recombining is considered to occur because recombination is required for the sgRNA to be stably transmitted to the offspring. Liu teach generating a mosaic animal (the F5 (sgRNA mouse) was mated with the CAG-Cas9 transgenic mice and the resultant 61-guide; Cas9 mice (F6) were analyzed for transgene function and sequence integrity (p3010 col2 ¶3; Fig 1C-D). Liu further teach breeding single gene perturbation lines; Figure 1D shows a mosaic mail can sire a pool of constitutive single-KO lines (Figure 1D). Claims 11, 13 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Liu et al as applied to claims 1-4, 7-9, 16-17 and 20 and further in view of Kodaeva et al (The Journal of Neuroscience (2021) 41:30;6449-6467). Claims 1-4, 7-9, 16-17 and 20 are anticipated by Liu, and thus are also rendered obvious (see above). Regarding claims 11, 13 and 15: The teachings of Liu are discussed above. Liu teach the recombinant expression vector plasmid 187460 which is used to generate the 61-guide transgenic mouse line. Liu further teach the 61-guide transgenic mouse line is mated with the CAG-Cas9 transgenic mice that constitutively expressing Cas9 (p3010 col2 ¶3). Liu do not teach the recombinant expression vector comprises a nucleotide sequence encoding a Cas protein. Kodaeva teach the pX330 plasmid (Addgene #42230 carries both gRNA and Cas9 expression units (6451 col1 ¶1). Kodaeva further teach using the vector comprising a nucleotide sequence encoding a Cas9 and gRNA to generate mouse knock-in lines (p6461 col2 ¶2). It would have been obvious to one of ordinary skill in the art to adapt the methods of Liu drawn to a nucleic acid construct encoding a Cre-Lox recombination system and a CRISPR gene editing system in which Cas9 is introduced by mating the 61-guide transgenic mouse line with a Cas9 expressing transgenic mouse, by incorporating Cas9 into the expression vector which comprises the gRNA, as taught by Kodaeva. One of ordinary skill in the art would have been motivated to modify the nucleic acid construct as taught by Liu with the teachings of Kodaeva, to include a nucleotide sequence encoding a Cas protein because Kodaeva teach this method successfully generates transgenic mouse lines. One would have had a reasonable expectation of success because Kodaeva demonstrates the method successfully generates transgenic mouse lines. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable, is considered to be obvious. See KSR International Co. v Teleflex Inc 82 USPQ2d 1385 (US 2007) at page 1395. Conclusion No claims are allowed. Art of record not relied upon: Livet et al (Nature (2007) 450;1-8); Yang et al (Molecular Therapy Nucleic Acids (2017) 7;378-386) Livet et al disclose the brainbow mouse which is generated by expressing different fluorophores from a transgene cassette by recombination of different Cre-Lox sites. However Livet differs from the instant disclosure because the transgene cassette comprises a fluorophore library and not a CRISPR system/sgRNA library. Livet do not disclose the LoxTC9 site of Seq ID NO: 3 of the instant invention. Yang et al disclose combining CRISPR/Cas9 and Cre-Lox gene editing systems to introduction of sgRNA using Cre-Lox recombination. Yang do not disclose the LoxTC9 site of Seq ID NO: 3 of the instant invention. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571) 272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631 /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Aug 22, 2024
Application Filed
Aug 12, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702730
ENGINEERED CARTILAGE
4y 3m to grant Granted Aug 11, 2026
Patent 12606833
MODIFIED MINI-NUCLEOSOME CORE PROTEINS AND USE IN NUCLEIC ACID DELIVERY
3y 6m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
22%
Grant Probability
58%
With Interview (+35.7%)
3y 10m (~1y 8m remaining)
Median Time to Grant
Low
PTA Risk
Based on 9 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month