Prosecution Insights
Last updated: October 01, 2026
Application No. 18/978,602

SNCA-TARGETING SIRNA COMPOSITIONS FOR TREATING SNCA-ASSOCIATED DISEASE

Non-Final OA §103§DOUBLEPATENT
Filed
Dec 12, 2024
Priority
Apr 01, 2022 — provisional 63/326,770 +3 more
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
3 (Non-Final)
58%
Grant Probability
Moderate
3-4
OA Rounds
1y 9m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
43 granted / 74 resolved
-1.9% vs TC avg
Strong +41% interview lift
Without
With
+40.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
56 currently pending
Career history
135
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
34.4%
-5.6% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
29.0%
-11.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 74 resolved cases

Office Action

§103 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 02/03/2026 has been entered. Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 02/03/2026 is acknowledged. Claim 32 was amended. Claims 1,11,12,15,16,23,24 and 30-33 are pending and under examination. Withdrawn Rejections/Objections Applicant’s arguments and amendments, see page 5, filed 02/03/2026, with respect to the 35 U.S.C. 112(d) rejection of claim 32, have been fully considered and are persuasive due to the amendment to claim 32 to depend on claim 31 which further limits. The 35 U.S.C. 112(d) rejection of claim 32 has been withdrawn. Applicant’s arguments, see pages 6-9, filed 02/03/2026, with respect to the 35 U.S.C. 103 rejection of claims 1,11,12,15,16,23,24 and 30-33 as unpatentable over US 20240011032, have been fully considered and are persuasive due to the statement of the obligation of assignment to the same person, Alnylam Pharmaceuticals, Inc. The 35 U.S.C. 103 rejection of claims 1,11,12,15,16,23,24 and 30-33 as unpatentable over US 20240011032 has been withdrawn. Applicant's arguments (see pages 9-22) with respect to claim(s) 1,11,12,15,16, 23,24 and 30-33 rejected under 35 U.S.C. 103 as unpatentable over MiIstein et al. in view of Freier et al. have been considered and are persuasive and therefore the rejection has been withdrawn. However, upon further consideration, a new ground of rejection is made based on a case of obviousness. As the new rejection still includes Milstein and Freier, the examiner will respond to the arguments pertaining to Milstein and Freier below. Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1,11,12,15,16,23,24 and 30-33 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova (US 20080139799, Published 12 June 2008), cited on an IDS, and Freier (U.S. Patent No. 9,663,783, Patented 30 May 2017) in view of Milstein (WO 2020/132227, Published 25 June 2020). Regarding claims 1,11,12 and 31, Khvorova teaches dsRNA can be used to inhibit protein expression, and has broad potential for treating human diseases (paragraph 0004). Khvorova teaches some in the field have begun to explore the possibility that RNAi can be made more efficient by paying attention to the design of the siRNA, and there is a need to develop rational criteria by which to select siRNA with an acceptable level of functionality and to identify siRNA that have this improved level of functionality, and identify siRNAs that are hyperfunctional (paragraph 0011). Khvorova teaches siRNAs and methods for increasing siRNA efficacy (paragraph 0012). Khvorova teaches siRNAs targeting synuclein, alpha (SNCA-1), and in embodiments are rationally designed (paragraph 0030), and the siRNA sequence is selected from the group consisting of SEQ ID NO: 438-570 (paragraph 0031). Khvorova teaches siRNA comprises a sense region and an antisense region, which together form a duplex region comprising 18-30 base pairs, and the sense region comprises a sequence at least 90% similar to a sequence selected from the group consisting of siRNA sequence targeting SNCA-1 disclosed herein….the siRNA sequence is selected from the group consisting of SEQ ID NOs: 438-570 (paragraph 0032). Khvorova teaches the phrase “duplex region” refers to the region in two complementary or substantially complementary polynucleotides that form base pairs with one another, either by Watson-Crick base pairing or any other manner that allows for a stabilized duplex between polynucleotide strands that are complementary or substantially complementary. For example, a polynucleotide strand having 21 nucleotide units can base pair with another polynucleotide of 21 nucleotide units, yet only 19 bases on each strand are complementary or substantially complementary, such that the “duplex region” has 19 base pairs (paragraph 0068). Khvorova teaches siRNAs that target SNCA-1, including NCBI accession numbers NM_00345 and 007308, having sequences generated in silico by the algorithms provided herein and include the siRNA sequences listed in Example XVII in paragraph 0438. An siRNA targeting SNCA-1 having SEQ ID NO: 501 is listed on page 36 of Khvorova, shown below: PNG media_image1.png 35 369 media_image1.png Greyscale As shown in the alignment below, nucleotides 1-19 of SEQ ID NO: 501 of Khvorova (Db) which is identified as an SNCA siRNA sequence, are identical to nucleotides 1-19 of the sense strand of instant SEQ ID NO: 21 (Qy). PNG media_image2.png 151 507 media_image2.png Greyscale Khvorova does not teach that the sense strand comprises or consists of all 21 nucleotides of SEQ ID NO: 21. However, Khvorova does teach the siRNAs target SNCA-1, including NCBI accession numbers NM_00345 and 007308 (paragraph 0438). Therefore, the mRNA sequence of SNCA-1 was publicly available before the effective filing date. A blast search of instant SEQ ID NO: 21 shows that nucleotides 1-21 of SEQ ID NO: 21 align with nucleotides 406-426 of Homo sapiens SNCA, transcript variant 1, mRNA of Sequence ID NM_00345, shown below. PNG media_image3.png 214 577 media_image3.png Greyscale Freier also teaches compounds and compositions for inhibiting expression of alpha-synuclein mRNA and protein in an animal and which is useful to treat neurodegenerative diseases including Parkinson’s Disease, dementia, multiple system atrophy and Alzheimer’s Diseases (column 1, lines 26-31). Freier teaches that misfolding, aggregation, and fibrillation of alpha-synuclein are implicated as critical factors in neurodegenerative diseases including Parkinson’s disease, Lewy body variant of Alzheimer’s disease, diffuse Lewy body disease, dementia with Lew bodies and multiple system atrophy, and that there is currently a lack of acceptable options for treating such neurodegenerative disorders (Column 1, lines 65-67 to Column 2, lines 1-3, 21-22). Freier teaches an antisense oligonucleotide of SEQ ID NO: 23 that is targeted to SEQ ID NO: 2, for inhibiting human SNCA mRNA levels, and has 95% inhibition of SNCA (Table 2, Column 45). SEQ ID NO: 23 of Freier has 100% identity to nucleotides 2-21 of instant SEQ ID NO: 64. See alignment below: SEQ ID NO: 64 2 CCAACATTTGTCACTTGCTC 21 SEQ ID NO: 23 1 CCAACATTTGTCACTTGCTC 20 Freier teaches modifications to antisense oligonucleotides including that the antisense compound targeted to alpha-synuclein nucleic acid includes a phosphorothioate internucleoside linkage, and that modified internucleoside linkages provide desirable properties such as enhanced cellular uptake, enhanced affinity for the target, increased stability in the presence of nucleases (Column 25, lines 29-36 and 46-50). Freier teaches sugar modifications including 2’-F and 2’-OCH3, and that sugar modifications may impart enhanced nuclease stability and increased binding affinity (Column 25, lines 56-58 and Column 26, line 14). Khvorova and Freier do not teach the specific modifications at the specific nucleotide positions recited in the claims. Before the effective filing date, Milstein et al. taught a double-stranded RNAi agent for inhibiting expression of amyloid precursor protein (APP) gene, wherein the RNAi agent includes a sense and antisense strand (page 2, lines 22-24). Milstein et al. taught the APP gene is a gene found in the central nervous system and is associated with Alzheimer’s Disease (page 1, Background). Milstein et al. taught the duplex AD-397197 targeted to APP and which is a modified sequence comprising a sense sequence of SEQ ID NO: 1469 and antisense sequence of SEQ ID NO: 1470 with specific modifications shown below (Page 228, Table 5A): PNG media_image4.png 22 639 media_image4.png Greyscale Milstein et al. taught only about 2% of the target APP is remaining in the neuron cell culture by the siRNA, AD-397197 (Table 7, page 239). Therefore, it was known in the prior art to incorporate 2’-O-hexadecyl nucleoside (e.g. adenosine) at position 6 of the sense strand with heavy 2’-O-methyl modifications in the 5’ and 3’ regions and multiple 2-fluoro modifications in the central nucleotides, as well as terminal phosphorothioate linkages, and was also known in the art to formulate the antisense strand having a 5’VP and a mixture of 2’O-methyl and 2’-F with at least 7 consecutive 2’-O-methyl modifications in the 3’ region of the antisense and terminal phosphorothioate linkages, as shown in the modified sense and antisense sequences above of Milstein et al. It would have been obvious before the effective filing date to provide a double-stranded siRNA agent targeting SNCA having the sense and antisense sequences as taught by Khvorova and Freier and to modify with the chemical pattern of Milstein to arrive at the instant claims with a reasonable expectation of success, as this would have amounted to applying a known technique of a chemical modification pattern to a known product, ready for improvement. One of ordinary skill in the art could have used the teachings of Khvorova regarding the rational design criteria by which to select siRNA with an acceptable level of functionality and to identify siRNA that have this improved level of functionality and the identified siRNAs including the rationally designed SNCA siRNA sequence of SEQ ID NO: 501 as well as the teachings regarding that the siRNAs target SNCA-1 of NCBI accession numbers NM_00345 and 007308 and that the siRNAs form a duplex region comprising 18-30 base pairs to arrive at the instant sense strand sequence of SEQ ID NO: 21 with a reasonable expectation of success. Likewise, it is within the level of skill for one of ordinary skill in the art to arrive at the corresponding antisense sequence of the sense sequence of the siRNA of Khvorova, and in addition, Freier teaches an antisense oligonucleotide of SEQ ID NO: 23 that is targeted to SNCA for inhibiting human SNCA mRNA levels with 95% inhibition of SNCA and which has 100% identity to nucleotides 2-21 of instant SEQ ID NO: 64. An ordinary artisan could have arrived at the antisense sequence of instant SEQ ID NO: 64 from SEQ ID NO: 23 of Freier and the sense sequence of Khvorova and NCBI accession numbers NM_00345 and 007308. Regarding the “U” being the first base in the antisense strand that hybridizes with “A” in the 21st base of the sense strand, it was known in the art that siRNA strands unwind better and more efficiently for targeting binding when the 5’ end of the antisense strand has U or A forming the U:A base pair with the sense strand. One would not start with “C” as is SEQ ID NO: 23 as the first position when making an effective siRNA but would rather start with “A” or “U” because the U:A or A:U base pair strength is less than C:G or G:C base pair strength. One of ordinary skill in the art would have been motivated to provide a double stranded siRNA targeting SNCA because Freier teaches that misfolding, aggregation, and fibrillation of alpha-synuclein are implicated as critical factors in neurodegenerative diseases including Parkinson’s disease, Lewy body variant of Alzheimer’s disease, diffuse Lewy body disease, dementia with Lew bodies and multiple system atrophy, and that there is currently a lack of acceptable options for treating such neurodegenerative disorders, and would therefore look for an siRNA targeting SNCA for treatment of these neurodegenerative diseases. One of ordinary skill in the art would have been motivated to modify the siRNA sequences of Khvorova and Freier based on the teachings of Milstein regarding that it was known in the prior art to incorporate 2’-O-hexadecyl nucleoside (e.g. adenosine) at position 6 of the sense strand with heavy 2’-O-methyl modifications in the 5’ and 3’ regions, and to formulate the antisense strand having a 5’VP and a mixture of 2’O-methyl and 2’-F with at least 7 consecutive 2’-O-methyl modifications in the 3’ region of the antisense. One of ordinary skill in the art would have had a reasonable expectation of success because the antisense strands of Milstein et al. are 23 nucleotides in length, as is instant SEQ ID NO: 64. Accordingly, the limitations of claims 1,11,12 and 31 would have been prima facie obvious to one of ordinary skill in the art. Khvorova does not teach pharmaceutical compositions or sodium salts of siRNA. However, regarding claims 15,16,23,24,30,32 and 33, Freier teaches the antisense oligonucleotides targeted to alpha-synuclein nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier (Column 34, lines 41-44). Freier teaches pharmaceutically acceptable salts of antisense compounds, including sodium salts, and pharmaceutical compositions comprising antisense compound salts (Column 34, lines 55-65). Milstein et al. also teaches pharmaceutical compositions comprising the RNAi agent and a pharmaceutically acceptable carrier (page 137, lines 27-29). It would have been obvious to one of ordinary skill in the art before the effective filing date, to incorporate the siRNA of Khvorova and Freier modified with the chemical modification pattern of Milstein into a pharmaceutical composition comprising a pharmaceutically acceptable carrier or excipient or to provide the siRNA as a sodium salt and provide the sodium salt of the siRNA in a pharmaceutical composition, for the purpose of storage for future use. One of ordinary skill in the art would have been motivated to do so because Freier teaches compounds and compositions for inhibiting expression of alpha-synuclein mRNA and protein in an animal and which is useful to treat neurodegenerative diseases including Parkinson’s Disease, dementia, multiple system atrophy and Alzheimer’s Diseases (column 1, lines 26-31) and therefore an ordinary artisan would be motivated to provide the siRNA of Khvorova and Freier modified by the chemical modification pattern of Milstein in a sodium salt form or pharmaceutical composition for storage for later use for treatment of a neurodegenerative disease. Accordingly, the limitations of claims 15,16,23,24,30,32 and 33 would have been prima facie obvious to one of ordinary skill in the art. Response to Arguments While the examiner withdrew the 103 rejection using Milstein and Freier, the examiner made a new case of obviousness using Khvorova and Freier in view of Milstein. Therefore, the examiner is responding to arguments regarding Milstein and Freier since they are still used in the new rejection. Applicant argues on pages 12-13 that the Examiner cannot use hindsight to establish a prima facie case of obviousness, citing MPEP 2142, MPEP 2145 (X)(A) and In re McLaughlin, and that Milstein et al. is Applicant’s own work and is directed to dsRNAi agents and compositions targeting the APP gene and the examiner provided no reason of why one of ordinary skill in the art trying to design a dsRNA targeting SNCA would even look to a publication directed to a completely different gene, APP, and select a sequence that targets APP to design the dsRNA agent that targets SNCA, and the only reason for doing this is using the claimed sequences as a blueprint and searching for references that teach the different elements of the claim. Applicant argues even if one of skill in the art had the motivation to look at the teaching of Milstein, there are over 600 dsRNA molecules, each with a distinct sense strand and antisense strand, and from among over 600 duplexes, the examiner points to duplex AD-397197 and states that “only about 2% of the target APP is remaining in the neuron cell culture by the siRNA, AD-397197”. Applicant argues that Milstein teaches at least another 49 duplexes which result in even better inhibition of APP in neuronal cell culture when compared to AD-397197 and which have a completely different sequence than the claimed sequence, as seen in Table 7 and 18, and therefore there would be no reason to specifically choose duplex AD-397197 from among hundreds of duplexes taught by Milstein, many of which have better activity than AD-39797, and the examiner selected that duplex only with the benefit of hindsight reconstruction as the Examiner was specifically looking to find a sequence to match the claimed sequence. Applicant argues on page 14, that the Examiner uses hindsight reconstruction with regards to Freier and uses the claim elements as a blueprint, and that no ordinary artisan would follow the path provided by the examiner because it makes no scientific sense. It is not clear why one of ordinary skill in the art would be motivated to choose a single-stranded antisense oligonucleotide targeting SNCA from Freier, use it to swap the antisense strand in a duplex targeting APP from Milstein, generate a corresponding sense strand to the antisense strand, modify the nucleotides of both strands looking at the nucleotide modifications from among hundreds of duplexes targeting a different gene and arrive in a predictable manner at the specific sense strand and antisense strand sequences and modifications of the present claims. In response to applicants argument regarding improper hindsight reasoning it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper." In re McLaughlin, 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971). Regarding the number dsRNA molecules in Milstein, despite Applicant’s argument, this is still a finite list to choose from. KSR selection only needs to be a suitable option, not the best option. It is also noted that the new reference, Khvorova which teaches siRNAs specifically targeting SNCA, has an even smaller list of siRNAs targeting SNCA as seen on pages 36-37 of Khvorova, and selecting any of the siRNA sequences from the list would be a suitable option. Also, claims 1,11,12,23,30,31 and 32 merely recite a product of a specific structure. Claims 15,16,24 and 32 recite a dsRNA product with an intended use, “for inhibiting expression of a gene encoding alpha-Synuclein (SNCA)”. In response to applicant's argument that Milstein et al. does not describe dsRNA agents targeting SNCA but dsRNA targeting a different gene, APP, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The antisense sequence of Freier has 100% identity to nucleotides 2-21 of instant SEQ ID NO: 64, and a dsRNA having the same antisense sequence as instant SEQ ID NO: 64 would also have the same corresponding sense sequence as instant SEQ ID NO: 21. Milstein provides the teaching of the obviousness of the instant modifications at specific locations (Milstein et al. teach it was known in the prior art to incorporate 2’-O-hexadecyl nucleoside (e.g. adenosine) at position 6 of the sense strand with heavy 2’-O-methyl modifications in the 5’ and 3’ regions, and to formulate the antisense strand having a 5’VP and a mixture of 2’O-methyl and 2’-F with at least 7 consecutive 2’-O-methyl modifications in the 3’ region of the antisense) and which resulted in strong inhibition of expression of the target gene. Applicant argues on page 15 that Milstein and Freier fail to teach or suggest the claimed invention, and one of ordinary skill in the art would have had no motivation nor a reasonable expectation of success for arriving at the claimed invention based on the teachings of Milstein et al. and Freier each alone or in combination. Applicant argues that Milstein does not teach dsRNA agents targeting SNCA, nor those with the specific sense and antisense sequences and specific nucleotide modifications and Freier does not teach double stranded RNA agents, or pharmaceutically acceptable salts thereof, targeting SNCA, let alone those having the specific sense strand and antisense strand sequence as well as the specific modifications of the sense and antisense strands. In response, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., Inc., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). The fact that the dsRNA agents targeting SNCA as exactly claimed in the instant case were not actually exemplified by the prior art is not sufficient to render the instant claims nonobvious in view of the obviousness rationale set forth in the last Office action. Applicant argues on pages 16-17, the lack of motivation and reasonable expectation of success of arriving at the claimed invention, as Milstein does not disclose any dsRNA agents targeting SNCA, and human APP is only about 41% sequence identity with human SNCA. Applicant argues on page 17 that careful review of Freier shows the totality of teachings are directed to antisense inhibition of SNCA and antisense oligonucleotides targeting SNCA, and does not provide a single double stranded RNA agent targeting SNCA, let alone those with the recited sense and antisense strand sequences and nucleotide modifications of the claims. Applicant argues one of skill in the art would not have been motivated by the teaching of Freier to swap the nucleotide sequence targeting APP in the dsRNA of Milstein with the antisense oligonucleotide of SEQ ID NO: 23, because Freier is silent to dsRNA agents for inhibition of SNCA, and provides no teaching or suggestion to replace the antisense oligonucleotide of SEQ ID NO: 23 with a dsRNAi agent comprising an antisense strand with SEQ ID NO: 23. Applicant argues one of ordinary skill in the art would consider different strategies to develop dsRNAi agents as compared to antisense oligonucleotides, and again references Watts and Corey (J. Pathol. (2012) 226(2)365-379) that teaches there are different strategies that one of ordinary skill in the art must take into consideration to develop antisense oligonucleotides as compared to double stranded RNAi agents, and that “an ideal target sequence for an ASO is not necessarily ideal for an siRNA and vice versa (page 8, first paragraph), and based on this unpredictability, there would not have been motivation or reasonable expectation of success to arrive at the invention based on the teachings of Milstein et al. and Freier each alone or in combination. In response to this, the Examiner responds that a teaching, suggestion, or motivation to combine references that is found in the prior art is an appropriate rationale for determining obviousness. KSR, 550 U.S. at 418, 82 USPQ2d at 1396. In addition, KSR selection only needs to be a suitable option, not the best option. The rejection provided motivation for providing a dsRNA targeting SNCA (inhibiting expression of alpha-synuclein mRNA and which is useful to treat a variety of neurodegenerative diseases) and the motivation for providing phosphorothioate and sugar modifications in Freier (Office action pages 11-12). While Applicant points to Watts and Corey (J. Pathol. (2012) 226(2)365-379) regarding the differences in ASOs and siRNAs and lack of a reasonable expectation of success, the examiner points out that the instant claims merely require a dsRNA or a dsRNA with an intended use, and this intended use does not structurally distinguish the instant claims from the prior art. Watts and Corey also describe similarities between ASOs and siRNAs: “Single-stranded antisense oligonucleotides (ASOs) and RNA interference (RNAi) share their fundamental principle: an oligonucleotide binds a target RNA through Watson-Crick base pairing” (Page 2, 2nd paragraph), and “ASOs and siRNAs share important similarities as drug candidates. Both platforms are intended to modulate gene expression. Both are nucleic acids and contain an antisense strand intended to recognize a target mRNA” (page 8, third paragraph). Therefore, an antisense strand targeting SNCA of an antisense oligonucleotide would have a reasonable expectation of success as the same antisense strand sequence in a dsRNA agent targeting SNCA and an ordinary artisan could determine the corresponding sense sequence of the antisense sequence to arrive at the same product (with no recited function). In response to applicants argument regarding improper hindsight reasoning it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper." In re McLaughlin, 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971). Applicant makes similar arguments on page 18 regarding the number of duplexes and in vitro activity in Milstein as on page 13-14 of response, as there is no reason to specifically choose duplex AD-397197 from among hundreds of duplexes taught by Milstein, many of which have better activity than AD-397197. Applicant also argues that Freier does not teach or suggest the specific nucleotide modifications of the present claims, and pertains to a 2’-O-methoxyethyl gapmer and teaches away from the specific nucleotide modifications required by the present claims. Applicant argues on page 19 that the teachings of the prior art encompass thousands and thousands of possible modified nucleotide sequences, and that there would be at least 1.96 x 107 possible modified duplex sequences, which is not a reasonable or finite number of identified, predictable potential solutions. This is not found persuasive. Regarding the teachings of Milstein et al. for the specific modifications at particular locations, Milstein et al. teaches modification patterns of dsRNA agents for both sense and antisense sequences targeting a gene in the CNS, just as the instant dsRNA agent targets a gene in the CNS (SNCA) and that it was known in the art to incorporate 2’-O-hexdecyl nucleoside (e.g. adenosine) at position 6 of the sense strand with heavy 2’-O-methyl modifications in the 5’ and 3’ regions and multiple 2-fluoro modifications in the central nucleotides and terminal phosphorothioate linkages and to formulate the antisense strand having a 5’-VP and mixture of 2’O-methyl and 2’-F with at least 7 consecutive 2’-O-methyl modifications in the 3’ region and terminal phosphorothioate linkages. There would be a reasonable expectation of success to apply this modification technique to other dsRNA agents targeting other CNS genes, and because Milstein et al. teaches the high efficacy of knocking down target APP of AD-397197 (Table 7, page 239). An ordinary artisan would look to Milstein et al. to use the Duplexes with the highest knockdown of APP which would significantly reduce the number of duplexes of which AD-397197 is included. Regarding Freier, the antisense sequence of SEQ ID NO: 23 of Freier that targets the same gene as the dsRNA agent of the instant claims, SNCA, has 100% identity to nucleotides 2-21 of instant SEQ ID NO: 64, and SEQ ID NO: 23 is one of the most potent oligonucleotide sequences targeting SNCA which would reduce the number of possible sequences for an ordinary artisan to choose from. One of skill in the art would be able to figure out a 23-mer, which is a well-known antisense oligonucleotide length, comprising the active sequence of the prior art using SEQ ID NO: 2 of Freier. Regarding the “U” being the first base in the antisense strand that hybridizes with “A” in the 21st base of the sense strand, it was known in the art that siRNA strands unwind better and more efficiently for targeting binding when the 5’ end of the antisense strand has U or A forming the U:A base pair with the sense strand. One would not start with “C” as is SEQ ID NO: 23 as the first position when making an effective siRNA but would rather start with “A” or “U” because the U:A or A:U base pair strength is less than C:G or G:C base pair strength. Freier also teaches the benefits of the same modifications of the instant claims (phosphorothioate internucleoside linkages provide desirable properties such as enhanced cellular uptake, enhanced affinity for the target, enhanced stability in the present of nucleases (Column 25, lines 29-36,46-50) as well as sugar modifications 2’-F and 2’-OCH3 which impart enhanced nuclease stability and binding affinity (Column 25, lines 56-58 and Column 26, line 14). The examiner does not agree that there would not be a finite number of options based on the evidence provided above regarding the specific modification pattern and efficacy of the duplex AD-397197 and the antisense sequence and efficacy of the antisense of SEQ ID NO: 23 of Freier to arrive at the instant claims. Nevertheless, the examiner is providing a new rejection teaching siRNA specifically targeting SNCA (Khvorova) which teaches a finite list of sequences (132 sequences) targeting SNCA, including SEQ ID NO: 501 which shares 100% identity with nucleotides 1-19 of instant SEQ ID NO: 21. An ordinary artisan could select any of the siRNAs that are taught to target SNCA that have been rationally designed of Khvorova and use the information provided in Khvorova regarding the NCBI accession numbers NM_00345 and 007308 for the target gene SNCA and that the siRNAs form a duplex region comprising 18-30 base pairs to arrive at the instant sense strand sequence of SEQ ID NO: 21 with a reasonable expectation of success. Likewise, it is within the level of skill for one of ordinary skill in the art to arrive at the corresponding antisense sequence of the sense sequence of the siRNA of Khvorova based on the teachings of Khvorova and in addition, Freier also teaches an antisense oligonucleotide of SEQ ID NO: 23 that is targeted to SNCA for inhibiting human SNCA mRNA levels with 95% inhibition of SNCA and which has 100% identity to nucleotides 2-21 of instant SEQ ID NO: 64. An ordinary artisan could have arrived at the antisense sequence of instant SEQ ID NO: 64 from SEQ ID NO: 23 of Freier and the sense sequence of Khvorova and NCBI accession numbers NM_00345 and 007308. An ordinary artisan could then further modify the sense and antisense sequences based on the teachings of Milstein regarding the chemical modification motifs known in the art to produce an siRNA with modifications that result in effective silencing of the target gene. Applicant argues on page 17 that Applicant engaged in inventive research to identify dsRNA with exceptional activity (Examples 2 and 3) which were then administered to non-human primates (Example 4) and argues on page 20-21, that there are unexpected results which are commensurate in scope with the claimed invention. Applicant argues the specification provides working examples, that duplex AD-1747580, potently and durably inhibit SNCA expression in vivo. Applicant points to Example 4 where non-human primates were intrathecally administered a single 60 mg dose of duplex AD-1747580 which at day 29 provided 84.98% knockdown of SNCA mRNA levels in prefrontal cortex and 74.57% knockdown in midbrain and points to FIGS. 9A and 10, and at day 84 there was greater than 80-90% knockdown in the prefrontal cortex (see Fig 11). Applicant argues alpha-synuclein levels were significantly reduced in brain and spinal cord tissues in non-human primates at days 29 and 84 after administering AD-1747580. Applicant refers to page 174, lines 17-32 of the as filed specification which demonstrate that AD-1747580 duplex was identified via RNA-Seq to possess the most favorable selectivity profile from among the three lead candidates tested. In response, the Examiner notes that Applicant points to Example 4, where 3 different duplexes are tested (AD-1747583, AD-1747580, AD-1747585), each of which have different sense and antisense sequences as well as different modifications at different positions. See below: PNG media_image5.png 23 624 media_image5.png Greyscale PNG media_image6.png 24 624 media_image6.png Greyscale PNG media_image7.png 26 624 media_image7.png Greyscale Example 4 involves intrathecal administration of a specific dose of each duplex to non-human primates, which are not required by the instant claims which are to a product. Whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980) (Claims were directed to a process for removing corrosion at "elevated temperatures" using a certain ion exchange resin (with the exception of claim 8 which recited a temperature in excess of 100C). Appellant demonstrated unexpected results via comparative tests with the prior art ion exchange resin at 110C and 130C. The court affirmed the rejection of claims 1-7 and 9-10 because the term "elevated temperatures" encompassed temperatures as low as 60C where the prior art ion exchange resin was known to perform well. The rejection of claim 8, directed to a temperature in excess of 100C, was reversed.). See also In re Peterson, 315 F.3d 1325, 1329-31, 65 USPQ2d 1379, 1382-85 (Fed. Cir. 2003) (data showing improved alloy strength with the addition of 2% rhenium did not evidence unexpected results for the entire claimed range of about 1-3% rhenium); In re Grasselli, 713 F.2d 731, 741, 218 USPQ 769, 777 (Fed. Cir. 1983) (Claims were directed to certain catalysts containing an alkali metal. Evidence presented to rebut an obviousness rejection compared catalysts containing sodium with the prior art. The court held this evidence insufficient to rebut the prima facie case because experiments limited to sodium were not commensurate in scope with the claims.). Note: MPEP 716.02(d). Additionally, Applicants have not stated what the expected effect should be to determine if the results are in fact unexpected. Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. An unexpected property or result must actually be unexpected and of statistical and practical significance. The burden is on the applicant to establish the results are in fact unexpected, unobvious and of statistical and practical significance. See MPEP 716.02. The same Example 4 cited by Applicant in the response also shows that AD-1747583 and AD-1747585 were also intrathecally administered at the same dose as AD-1747580, and that the IC50 value ranking of duplexes for target SNCA mRNA knockdown was noted as AD-1747583<AD-1747580<AD-1747585 (page 170). Example 4 shows that all three duplexes tested (AD-1747583, AD-1747580, AD-1747585) exhibited similar alpha-synuclein knockdown potencies (page 170). As the other duplexes that do not fall within the scope of the claims regarding the sequences and modifications and also have good results, it is not clear what the expected effect is. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1,11,12,15,16,23,24 and 30-33 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-30 of copending Application No. 18/898,882 (reference application). Instant claims 1,11,12,30-32 recite a dsRNA agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises or consists of the nucleotide sequence 5'- gsasgca(Ahd)guGfAfCfaaauguugsgsa-3' of SEQ ID NO:21 and the antisense strand comprises or consists of the nucleotide sequence 5’-VPusdCscadAcdAuuugdTcAfcuugcucsusu -3' of SEQ ID NO: 64, wherein a, g, c and u are 2-0-methyl (2-OMe) A, G, C and U; Af, Gf, and Cf are 2-fluoro (2-F) A, G, and C; dA, dT, and dC are 2-deoxy A, T, and C; (Ahd) is 2'-O-hexadecyl adenosine- 3'-phosphate; VP is Vinyl-phosphonate; and s is a phosphorothioate linkage; instant claims 11-12 recite the antisense strand consist of the nucleotide sequence of 5’-VPusdCscadAcdAuuugdTcAfcuugcucsusu -3' of SEQ ID NO: 64 and the sense strand consist of the nucleotide sequence of 5'- gsasgca(Ahd)guGfAfCfaaauguugsgsa-3' of SEQ ID NO: 21. Instant claims 15-16,24 and 33 recite a pharmaceutical composition for inhibiting expression of a gene encoding a-synuclein (SNCA) comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier. Instant claims 23,30,32 recite a sodium salt of a dsRNA agent and recites SEQ ID NO:21 and SEQ ID NO:64. Claims 1-3,5-7,9,11 of ‘882 recite a dsRNA agent or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double stranded region, wherein the nucleotide sequence of the antisense strand differs by no more than 4 modified or unmodified nucleotides from the nucleotide sequence having the same sequence (SEQ ID NO: 64) and the same modifications. Claims 4,8,10,12 of ‘882 recites the nucleotide sequence of the sense strand differs by no more than 3 modified or unmodified nucleotides from SEQ ID NO: 21 and has the same sequence and modifications as the instant claims. Claims 13-14,17,25 of ‘882 recite a method for inhibiting expression of a gene encoding SNCA in a cell comprising contacting the cell with a dsRNA agent of the same sequences and modifications at each nucleotide as the instant claims and allows up to 4 modified or unmodified nucleotides; claims 20-22,26-29 of ‘882 recite a method for inhibiting expression of a gene encoding SNCA in a subject comprising administering to the subject a therapeutically effective amount of a dsRNA agent of the same sequences and modifications at each nucleotide as the instant claims and allows up to 4 modified or unmodified nucleotides, and claim 30 recite a method of treating an SNCA-associated disease in a subject comprising administering to the subject a therapeutically effective amount of a dsRNA agent of the same sequences and modifications at each nucleotide as the instant claims and allows up to 4 modified or unmodified nucleotides. As the claims of ‘882 recite the same sequences and modifications as the instant claims, and encompass that the dsRNA comprises or consists of the sense strand of SEQ ID NO: 21 and the antisense sequence of SEQ ID NO: 64, the instant dsRNA product of the same sequences are rendered obvious. The claims in the examined application are a species of the genus of dsRNAs or recite the exact same species used in the methods of ‘882. Response to Arguments Applicant responded that they will consider submitting a Terminal Disclaimer when all other issues of the case have been obviated. As the other issues are not yet obviated, the rejection stands. Conclusion Claims 1,11,12,15,16,23,24 and 30-33 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Dec 12, 2024
Application Filed
Mar 26, 2025
Non-Final Rejection mailed — §103, §DOUBLEPATENT
Jun 24, 2025
Response Filed
Nov 03, 2025
Final Rejection mailed — §103, §DOUBLEPATENT
Feb 03, 2026
Request for Continued Examination
Feb 04, 2026
Response after Non-Final Action
Mar 31, 2026
Non-Final Rejection mailed — §103, §DOUBLEPATENT
Jun 24, 2026
Examiner Interview Summary

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735701
TRANS-SPLICING RIBOZYME SPECIFIC TO APOE4 RNA AND USE THEREOF
4y 8m to grant Granted Sep 15, 2026
Patent 12655432
OLIGONUCLEOTIDES FOR SOD1 MODULATION
3y 7m to grant Granted Jun 16, 2026
Patent 12655461
BIOSENSORS FOR SELECTIVELY IDENTIFYING AZIDE IONS
3y 6m to grant Granted Jun 16, 2026
Patent 12649939
NOVEL PROCESSES FOR THE PRODUCTION OF OLIGONUCLEOTIDES
6y 0m to grant Granted Jun 09, 2026
Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
3y 4m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+40.9%)
3y 7m (~1y 9m remaining)
Median Time to Grant
High
PTA Risk
Based on 74 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month