Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claim status
Claims 1-14 are pending
Claims 1-14 are under examination
Information Disclosure Statement
No information disclosure statement (IDS) has been submitted.
Applicant is reminded that the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Objection to Drawings
Sequence Compliance
Figures 7 & 8 of the Specification do not conform to sequence rules, requiring the use of “SEQ ID NO:” (37 CFR 1.821-1.825).
Where the description or claims of a patent application discuss a sequence that is set forth in the “Sequence Listing” in accordance with paragraph (c) of this section, reference must be made to the sequence by use of the sequence identifier, preceded by “SEQ ID NO:” in the text of the description or claims, even if the sequence is also embedded in the text of the description or claims of the patent application. 37 CFR 1.821 (d). Specifically, the cited section indicates that nucleotide and/or amino acid sequences are an unbranched sequence of 4 or more amino acids or an unbranched sequence of 10 or more nucleotides. Branched sequences are specifically excluded from this definition. Sequences with fewer than four specifically defined nucleotides or amino acids are specifically excluded from this section.
The applicant is reminded that the specification must be amended in order to comply with regulations cited above. All references to sequences in claims and specification should be referred to as “SEQ ID NO:1”, for example. To avoid all doubts of the examiner and to ensure correct interpretation of the claims and specification, the identification of sequences with proper sequence identifiers is required.
Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Objection to Specification
First, the specification is objected to because it refers to “Supplemental Figure 1” (p. 69, [0195], p. 75, [0234], which does not appear in the disclosure
Second, the specification is objected to because it refers to Example 2 (p. 77, [0241-0244]), with verbiage that is in the past tense (e.g., “produced”, “used”). According to MPEP 608.01(p) and 2164.02, prophetic examples must not be described using the past tense, as past tense incorrectly implies the experiment was actually performed.
Claim Objections
Claims 12 and 13 are objected to because of the following informalities: Applicant is advised be consistent with the capitalization of the terms “VP1”, “VP2” and “VP3”.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3, 5, 7-14 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural product without significantly more. The claims recite an AAVrh94, AAVrh95, AAVrh96, AAVrh97, AAVrh98, and AAVrh99 which are not markedly different from their naturally occurring counterparts. This judicial exception is not integrated into a practical application because the natural product is not linked to a particular technology. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the additional limitations are well-understood, routine and conventional in virology and cell biology.
Briefly summarized here, the guidance for subject edibility cites a two part test: is the claimed invention directed to a statutory class of invention (Step 1), if so then is the claimed invention as a whole directed to a law of nature, natural phenomena, or an abstract idea (i.e. set forth or described in the claim) (Step 2A, prong one), if so then is the claimed invention recite additional elements that integrate the judicial exception into a practical application (Step 2A, prong two), if not then does the claim as a whole amount to significantly more than the judicial exception (Step 2B).
In regard to Step 1, instant claims are drawn to compositions of matter- AAV vectors.
[TextBox: [img-media_image1.png]]In regard to Step 2A prong one, instant claims are drawn to a nature-based products which are not markedly different from their naturally occurring counterparts. Specifically, independent claim 1 is directed to AAVrh94-99 which have been isolated from the non-human primate (NHP) liver tissue of Rhesus macaque (see Fig. 3C of Applicant disclosure). These are nature-based products. Specifically, Applicant specification discloses that the claimed AAV are “natural” isolates from Rhesus macaque [0022, 0219, 0240].
These claims encompass naturally occurring AAV vectors. This option of the claims is a naturally occurring product. Applicant is reminded that, “a new mineral discovered in the earth or a new plant found in the wild is not patentable subject matter” under Section 101. Diamond v. Chakrabarty, 447 U.S. 303, 309, 206 USPQ 193, 197 (1980).
Because instant claims are directed to a nature-based product, i.e., an AAV vector, the nature-based product is analyzed to determine whether it has markedly different characteristics from any naturally occurring counterpart(s) in their natural state. In instant case, independent claims 1, 12, and 13 recite specific SEQ ID NOs for the claimed genus of AAV vectors. However, as stated supra, since these AAV vectors were isolated unchanged from NHP liver, the SEQ ID NOs are also too unchanged from their natural counterparts. Furthermore, instant claims recite an “expression cassette” that encodes a “gene product” and is “operably linked to expression control sequences”. However, naturally occurring AAV vector express AAV gene products that are linked to control sequences (e.g., the constitutive nature of a 5’ ITR). Thus, instant claims encompass a genus of AAV vectors that are identical (no difference in structural or functional characteristics) to naturally occurring AAV vectors.
Furthermore, the fact that instant claim recites “recombinant” does not differentiate it from the naturally occurring AAV vectors because although the claimed viruses may be man-made they are identical to what exists in nature (i.e., same structure and function). As the Supreme Court made clear, neither naturally occurring compositions of matter, nor synthetically created compositions that are structurally identical to the naturally occurring compositions, are patent eligible.”). Thus, a recombinant product is not automatically eligible because it was created by human ingenuity or intervention. See, e.g.,In re Roslin Institute (Edinburgh), 750 F.3d 1333, 1337, 110 USPQ2d 1668, 1671-72 (Fed. Cir. 2014) (cloned sheep); cf. J.E.M. Ag Supply, Inc. v. Pioneer Hi-Bred Int’l, Inc., 534 U.S. 130-132, 60 USPQ2d 1868-69 (2001) (hybrid plant). Instead, the key to the eligibility of all non-naturally occurring products is whether they possess markedly different characteristics from any naturally occurring counterpart.
Finally, in regard to the claimed genus of vectors comprising one or more deamidated asparagines, Wilson et al. (WO2019/169004, filed 2/27/2019, published 9/06/2019) evidence that deamidation is a naturally occurring spontaneous process that serves as a “molecular clock” for AAV vectors during their infection life-cycle (p. 2, 3rd para.). Thus, the claimed AAV vectors do not appear to possess markedly different characteristics from any naturally occurring counterpart.
In regard to Step 2A prong two, the judicial exception is not integrated into a practical application. In particular, Claims 11 recite no additional elements to integrate the claimed AAV vector into a practical application, as the term “transgene” can represent an AAV protein expressed in the cells, and these AAV vectors naturally deliver said transgenes to NHP populations. Moreover, Claims 12-14 recite a single additional element- that the nucleic acid is in a plasmid. However, in regard to Claim 12, circular intermediate forms of AAV were known to occur based on the structure of integrated proviruses, as head-to-tail monomer and multimer genomes, and these circular intermediates form during latent infection or viral replication inside a host cell. In regard to Claims 13 and 14, the AAVrh capsid, rep gene, genomic 5’ and 3’ ITRs, adenoviral helper genes, and host cells are all part of the natural AAV infection.
In regard to Step 2B, the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. Claims 3, 7, and 8 recite that the AAV produces a gene product that is useful to treat a disorder, is an immunogen, and is therapeutic, respectively. However, naturally occurring AAV vectors were known to be therapeutic. For example. Srivastava et al. (Human Gene Therapy, 2017, 28:4:323-327) evidence that naturally occurring AAVs possess antitumor activity by promoting the host’s immune response and regulating certain oncogenes (p. 323-324). Furthermore, Claim 10 recites a single additional element- that the AAV is in a pharmaceutical composition comprising a physiological buffer. The term pharmaceutic composition is extremely broad and encompasses many types of sterile physiological buffers. Thus, merely placing the natural product into a generic buffer so that the AAV may maintain its structure and function does not add a meaningful limitation as it is a nominal extra-solution component of the claim as is a necessary precursor for all of the uses of the AAV, and is nothing more than an attempt to generally link the protein product to a particular biotechnology. Clearly, combining the natural AAV in a pharmaceutical composition on its own does nothing to improve a technology, effect a particular treatment, or implement with a particular device to provide a meaningful limitation on the judicial exception.
Therefore, Claims 1-3, 5, 7-14 are directed to a natural product, that is not markedly different from its natural counterpart, is not integrate a practical application, and does not include elements that amount to significantly more than the natural product itself and do not qualify as patent eligible subject matter under 35 U.S.C. § 101.
Claim Rejections - 35 USC § 112(a)
(Written Description)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-6, 8-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Independent claims 1, 12, 13 encompass a genus of AAV comprising an AAVrh96 capsid produced by expressing a nucleic acid sequence at least 98% to 100% identical to SEQ ID NO:13, as well as plasmids thereof, and methods of making the AAVrh96 vector from said nucleic acid, while the specification discloses no such AAVrh96 vectors made from said nuclei acid.
Dependent claims 3-6, 8-11, and 14, encompass the produced AAVrh96 vectors with various transgenes, methods of delivery, and host cells.
Under the written description guidelines (see MPEP 2163) the Examiner is directed to determine whether one skilled in the art would recognize that the Applicant was in possession of the claimed invention as a whole at the time of filing. The following considerations are critical to this determination.
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. An original claim may lack written description support when (1) the claim defines the invention in functional language specifying a desired result but the disclosure fails to sufficiently identify how the function is performed or the result is achieved or (2) a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement is not necessarily met when the claim language appears in ipsis verbis in the specification. "Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement." Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002).
Accordingly, to satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163.
ACTUAL REDUCTION TO PRACTICE
In regard to independent claims 1, 12, 13 encompassing a genus of AAV comprising an AAVrh96 capsid produced by expressing a nucleic acid sequence at least 98% to 100% identical to SEQ ID NO:13, as well as plasmids thereof, and methods of making the AAVrh96 vector from said nucleic acid, the specification discloses no such AAVrh96 vectors made from said nuclei acid.
Furthermore, although Applicant provides the 2,226 nucleotide sequence of SEQ ID NO:13, as can be seen below this sequence translates into a partial protein product that beings with a VP1 protein coding sequence and then after a single nucleotide insertion frame-shifts into an unnamed protein product with multiple stop codons (in bold):
atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgc M A A D G Y L P D W L E D N L S E G I R gagtggtgggcgctgaaacctggagccccgaagcccaaagccaaccagcaaaagcaggac E W W A L K P G A P K P K A N Q Q K Q D gacggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgac D G R G L V L P G Y K Y L G P F N G L D aagggggagcccgttaacgcggcggacgcagcggccctcgagcacgacaaggcctacgac K G E P V N A A D A A A L E H D K A Y D cagcagctcaaagcgggtgacaatccgtacctgcggtataatcacgccgacgccgagttt Q Q L K A G D N P Y L R Y N H A D A E F caggagcgtctgcaagaagatacgtcatttgggggcaacctcgggcgagcagtcttccag Q E R L Q E D T S F G G N L G R A V F Q gccaagaagcgggttctcgaacctctcggtctggttgaggaaggcgctaagacggctcct A K K R V L E P L G L V E E G A K T A P ggaaagaagagaccggtagagccatcaccccagcgttctccagactcctctacgggcatc G K K R P V E P S P Q R S P D S S T G I ggcaagaaaggccaacagcccgccagaaaaagactcaattttggtcagactggcgactca G K K G Q Q P A R K R L N F G Q T G D S gagtcagttccagaccctcaacctctcggagaacctccagcagcgccctctggtgtggga E S V P D P Q P L G E P P A A P S G V G cctaatacaatggctgcaggcggtggcgcaccaatggcagacaataacgaaggcgccgac P N T M A A G G G A P M A D N N E G A D ggagtgggtagttcctcgggaaattggcattgcgattccacatggctgggcgacagagtc G V G S S S G N W H C D S T W L G D R V atcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaagcaa I T T S T R T W A L P T Y N N H L Y K Q atctccaacgggacatcgggaggcagccaccaacgacaacacctacttcggctacagcac I S N G T S G G S H Q R Q H L L R L Q H cccctgggggtattttgactttaacagattccactgccacttttcaccacgtgactggca P L G V F - L - Q I P L P L F T T - L A gcgactcatcaacaacaactggggattccggcccaagagactcagcttcaagctcttcaa A T H Q Q Q L G I P A Q E T Q L Q A L Q catccaggtcaaggaggttacgcagaatgaaggcaccaagaccatcgccaataacctcac H P G Q G G Y A E - R H Q D H R Q - P H cagcaccatccaggtgtttacggactcggaataccagctgccgtacgtcctcggctctgc Q H H P G V Y G L G I P A A V R P R L C ccaccagggctgcctgcctccgttcccggcggacgtcttcatgattcctcagtacggcta P P G L P A S V P G G R L H D S S V R L cctgactctcaacaatggcagccaggccgtgggacgttcctccttctactgcctggagta P D S Q Q W Q P G R G T F L L L L P G V cttcccctctcagatgctgagaacgggcaacaacttctccttcagctacaccttcgaaga L P L S D A E N G Q Q L L L Q L H L R R cgtgcctttccacagcagctacgcgcacagccagagcctggaccggctgatgaatcccct R A F P Q Q L R A Q P E P G P A D E S P catcgaccaatacctgtactacctgtcaagaacccagtctacgggcggtacagcgggaac H R P I P V L P V K N P V Y G R Y S G N gcagcagttgctgttttctcaggccgggcctagcaacatgtcggctcaggccagaaactg A A V A V F S G R A - Q H V G S G Q K L gctgccaggaccctgctacagacagcagcgagtctccacgacactgtcgcaaaacaacaa A A R T L L Q T A A S L H D T V A K Q Q cagcaactttgcttggaccggtgccaccaaatatcacctgaacggcagagactctctggt Q Q L C L D R C H Q I S P E R Q R L S G gaatccgggcgtagccatggcaaccaacaaggacgacgaggaccgcttcttcccatctag E S G R S H G N Q Q G R R G P L L P I - cggcatcctcatgtttggcaagcagggagctggaaaagacaacgtggactatagcaacgt R H P H V W Q A G S W K R Q R G L - Q R gatgctcaccagcgaggaagagatcaagaccaccaaccccgtggccacagaacagtatgg D A H Q R G R D Q D H Q P R G H R T V W cgtggtggctgataacctgcagcagcaaaacaccgctcctattgtaggggccgtcaacag R G G - - P A A A K H R S Y C R G R Q Q ccagggagccttacctggtatggtctggcagaaccgggacgtatacctgcagggtccaat P G S L T W Y G L A E P G R I P A G S N ctgggccaagattcctcacacggatggcaactttcacccgtctcctctcatgggcggctt L G Q D S S H G W Q L S P V S S H G R L tggacttaaacatccgcctcctcagatcctcatcaagaacactcctgttcctgcggaccc W T - T S A S S D P H Q E H S C S C G P tccaacggcgttcaaccaggccaagctgaattctttcatcacgcagtacagcaccggaca S N G V Q P G Q A E F F H H A V Q H R T agtcagcgtggagattgagtgggagctgcagaaggaaaacagcaagcgctggaacccaga S Q R G D - V G A A E G K Q Q A L E P R gattcagtatacctccaactactacaaatctacaaatgtggactttgctgtcaatacaga D S V Y L Q L L Q I Y K C G L C C Q Y R gggtgtttattctgagcctcgccccattggcactcgttacctcacccgtaatctgtaatt G C L F - A S P H W H S L P H P - S V I gcttgttaatcaataaaccggttgattcgtttcagttgaactttgg A C - S I N R L I R F S - T L
In regard to dependent claims 3-6, 8-11, and 14, encompassing the produced AAVrh96 vectors with various transgenes, methods of delivery, and host cells, as stated supra, the specification discloses no such AAVrh96 vectors, nor methods of delivery, nor host cells thereof
Accordingly, Applicant did not demonstrate the full genus of compositions, nor did Applicant adequately set forth in terms of distinguishing identifying characteristics as evidenced by other descriptions of the invention (e.g., rational approach to making such substitutions in SEQ ID NO:13 to make and use a functional AAVrh96) that are sufficiently detailed to show that Applicant was in possession of the claimed genus of compositions.
DISCLOSURE OF STRUCTURE
The Applicant has provided the nucleic acid sequence for the AAVrh96 capsid to be produced from SEQ ID NO:13. Certainly, with the help of a recombinant expression system, a skilled artisan could make the truncated AAVrh96 capsid. However, the prior art is silent with respect to a truncated AAVrh96 capsid that can be incorporated into a function AAVrh96 vector. Furthermore, neither the specification nor the art indicate a relationship between the structure of the claimed genus of AAVrh96 capsid compositions being produced from SEQ ID NO:13, or sequences 98% identical thereto, and the ability to make and use a functional AAVrh96 vector.
Therefore, it is incumbent on the applicant to provide this nexus between structure and function, in order to be given credit for possession of the claimed genus of AAVrh96 vectors. An applicant may show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics. Enzo Biochem, 323 F.3d at 964, 63 USPQ2d at 1613.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
The method of making the claimed invention is not well established. Although the sequence data for related AAV vectors was known in the state of the art, one of skill in the art would neither expect nor predict an appropriate function of an AAVrh96 vector according to the claimed genus of compositions.
Specifically, the closest prior art to SEQ ID NO:13 is from the inventors previous patent document of Wilson et al., US 2007/0036760, filed 9/30/2004, published 2/15/2007, which discloses the AAVrh46 vector of SEQ ID NO:19 that is over 90% identical to SEQ ID NO:13 (see SCORE search 9/21/2026, rnpbm file, result #7), but critically does not include the frame-shift insertion (see highlighted c in sequence above).
CONCLUSION
Therefore, the Examiner concludes that there is insufficient written description of the instantly claimed genus of AAVrh96 vector compositions, plasmids, methods of delivery and host cells thereof, and the Examiner further concludes a skilled artisan would find the specification inadequately describes the claimed genus of compositions.
Claim Rejections - 35 USC § 112(a)
(Scope of Enablement)
Claims 1, 3-6, 8-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for AAVrh94, 95, 97, 98, and 99, does not reasonably provide enablement for the AAVrh96 vectors, plasmids, methods of delivery, and host cells thereof. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
SCOPE OF THE INVENTION
Independent claims 1, 12, 13 encompass a genus of AAV comprising an AAVrh96 capsid produced by expressing a nucleic acid sequence at least 98% to 100% identical to SEQ ID NO:13, as well as plasmids thereof, and methods of making the AAVrh96 vector from said nucleic acid, while the specification discloses no such AAVrh96 vectors made from said nuclei acid.
Dependent claims 3-6, 8-11, and 14, encompass the produced AAVrh96 vectors with various transgenes, methods of delivery, and host cells.
The factors to be considered in determining whether undue experimentation is required are summarized In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). The Court in Wands states: “Enablement is not precluded by the necessity for some 'experimentation.'” Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. “Whether undue experimentation is needed is not a single simple factual determination, but rather is a conclusion reached by weighing many factual considerations.” (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: (1) the quantity of experimentation necessary, (2) the amount or direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims. While all of these factors are considered, a sufficient amount for a prima facie case is discussed below.
The office has analyzed the specification in direct accordance to the factors outlined in In re Wands. MPEP 2164.04 states: "[W]hile the analysis and conclusion of a lack of enablement are based on factors discussed in MPEP 2164.01(a) and the evidence as whole, it is not necessary to discuss each factor in written enablement rejection." These factors will be analyzed, in turn, to demonstrate that one of ordinary skill in the art would have had to perform "undue experimentation" to make and/or use the invention and therefore, Applicant's claims are not enabled commensurate with the scope of the invention.
ACTUAL REDUCTION TO PRACTICE
In regard to independent claims 1, 12, 13 encompassing a genus of AAV comprising an AAVrh96 capsid produced by expressing a nucleic acid sequence at least 98% to 100% identical to SEQ ID NO:13, as well as plasmids thereof, and methods of making the AAVrh96 vector from said nucleic acid, the specification discloses no such AAVrh96 vectors made from said nuclei acid.
Furthermore, although Applicant provides the 2,226 nucleotide sequence of SEQ ID NO:13, as can be seen below this sequence translates into a partial protein product that beings with a VP1 protein coding sequence and then after a single nucleotide insertion frame-shifts into an unnamed protein product with multiple stop codons (in bold):
atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgc M A A D G Y L P D W L E D N L S E G I R gagtggtgggcgctgaaacctggagccccgaagcccaaagccaaccagcaaaagcaggac E W W A L K P G A P K P K A N Q Q K Q D gacggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgac D G R G L V L P G Y K Y L G P F N G L D aagggggagcccgttaacgcggcggacgcagcggccctcgagcacgacaaggcctacgac K G E P V N A A D A A A L E H D K A Y D cagcagctcaaagcgggtgacaatccgtacctgcggtataatcacgccgacgccgagttt Q Q L K A G D N P Y L R Y N H A D A E F caggagcgtctgcaagaagatacgtcatttgggggcaacctcgggcgagcagtcttccag Q E R L Q E D T S F G G N L G R A V F Q gccaagaagcgggttctcgaacctctcggtctggttgaggaaggcgctaagacggctcct A K K R V L E P L G L V E E G A K T A P ggaaagaagagaccggtagagccatcaccccagcgttctccagactcctctacgggcatc G K K R P V E P S P Q R S P D S S T G I ggcaagaaaggccaacagcccgccagaaaaagactcaattttggtcagactggcgactca G K K G Q Q P A R K R L N F G Q T G D S gagtcagttccagaccctcaacctctcggagaacctccagcagcgccctctggtgtggga E S V P D P Q P L G E P P A A P S G V G cctaatacaatggctgcaggcggtggcgcaccaatggcagacaataacgaaggcgccgac P N T M A A G G G A P M A D N N E G A D ggagtgggtagttcctcgggaaattggcattgcgattccacatggctgggcgacagagtc G V G S S S G N W H C D S T W L G D R V atcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaagcaa I T T S T R T W A L P T Y N N H L Y K Q atctccaacgggacatcgggaggcagccaccaacgacaacacctacttcggctacagcac I S N G T S G G S H Q R Q H L L R L Q H cccctgggggtattttgactttaacagattccactgccacttttcaccacgtgactggca P L G V F - L - Q I P L P L F T T - L A gcgactcatcaacaacaactggggattccggcccaagagactcagcttcaagctcttcaa A T H Q Q Q L G I P A Q E T Q L Q A L Q catccaggtcaaggaggttacgcagaatgaaggcaccaagaccatcgccaataacctcac H P G Q G G Y A E - R H Q D H R Q - P H cagcaccatccaggtgtttacggactcggaataccagctgccgtacgtcctcggctctgc Q H H P G V Y G L G I P A A V R P R L C ccaccagggctgcctgcctccgttcccggcggacgtcttcatgattcctcagtacggcta P P G L P A S V P G G R L H D S S V R L cctgactctcaacaatggcagccaggccgtgggacgttcctccttctactgcctggagta P D S Q Q W Q P G R G T F L L L L P G V cttcccctctcagatgctgagaacgggcaacaacttctccttcagctacaccttcgaaga L P L S D A E N G Q Q L L L Q L H L R R cgtgcctttccacagcagctacgcgcacagccagagcctggaccggctgatgaatcccct R A F P Q Q L R A Q P E P G P A D E S P catcgaccaatacctgtactacctgtcaagaacccagtctacgggcggtacagcgggaac H R P I P V L P V K N P V Y G R Y S G N gcagcagttgctgttttctcaggccgggcctagcaacatgtcggctcaggccagaaactg A A V A V F S G R A - Q H V G S G Q K L gctgccaggaccctgctacagacagcagcgagtctccacgacactgtcgcaaaacaacaa A A R T L L Q T A A S L H D T V A K Q Q cagcaactttgcttggaccggtgccaccaaatatcacctgaacggcagagactctctggt Q Q L C L D R C H Q I S P E R Q R L S G gaatccgggcgtagccatggcaaccaacaaggacgacgaggaccgcttcttcccatctag E S G R S H G N Q Q G R R G P L L P I - cggcatcctcatgtttggcaagcagggagctggaaaagacaacgtggactatagcaacgt R H P H V W Q A G S W K R Q R G L - Q R gatgctcaccagcgaggaagagatcaagaccaccaaccccgtggccacagaacagtatgg D A H Q R G R D Q D H Q P R G H R T V W cgtggtggctgataacctgcagcagcaaaacaccgctcctattgtaggggccgtcaacag R G G - - P A A A K H R S Y C R G R Q Q ccagggagccttacctggtatggtctggcagaaccgggacgtatacctgcagggtccaat P G S L T W Y G L A E P G R I P A G S N ctgggccaagattcctcacacggatggcaactttcacccgtctcctctcatgggcggctt L G Q D S S H G W Q L S P V S S H G R L tggacttaaacatccgcctcctcagatcctcatcaagaacactcctgttcctgcggaccc W T - T S A S S D P H Q E H S C S C G P tccaacggcgttcaaccaggccaagctgaattctttcatcacgcagtacagcaccggaca S N G V Q P G Q A E F F H H A V Q H R T agtcagcgtggagattgagtgggagctgcagaaggaaaacagcaagcgctggaacccaga S Q R G D - V G A A E G K Q Q A L E P R gattcagtatacctccaactactacaaatctacaaatgtggactttgctgtcaatacaga D S V Y L Q L L Q I Y K C G L C C Q Y R gggtgtttattctgagcctcgccccattggcactcgttacctcacccgtaatctgtaatt G C L F - A S P H W H S L P H P - S V I gcttgttaatcaataaaccggttgattcgtttcagttgaactttgg A C - S I N R L I R F S - T L
In regard to dependent claims 3-6, 8-11, and 14, encompassing the produced AAVrh96 vectors with various transgenes, methods of delivery, and host cells, as stated supra, the specification discloses no such AAVrh96 vectors, nor methods of delivery, nor host cells thereof
Accordingly, Applicant did not demonstrate a reduction to practice of a method of making and using the AAVrh96 vector as claimed.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
The method of making the claimed invention is not well established. Although the sequence data for related AAV vectors was known in the state of the art, one of skill in the art would neither expect nor predict an appropriate function of an AAVrh96 vector according to the claimed genus of compositions.
Specifically, the closest prior art to SEQ ID NO:13 is from the inventors previous patent document of Wilson et al., US 2007/0036760, filed 9/30/2004, published 2/15/2007, which discloses the AAVrh46 vector of SEQ ID NO:19 that is over 90% identical to SEQ ID NO:13 (see SCORE search 9/21/2026, rnpbm file, result #7), but critically does not include the frame-shift insertion (see highlighted c in sequence above).
Since the prior art at the effective filing date of the present application did not provide guidance for making and using the AAVrh96 as claimed, it is incumbent upon the instant specification to do so. The physiological art is recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires: “That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.” Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maize!.). In view of the foregoing, due to the lack of sufficient guidance provided by the specification regarding the issues set forth above, the state of the relevant art, and the breadth of the claims, it would have required undue experimentation for one skilled in the art to make and use the instant broadly claimed invention.
CONCLUSION
In conclusion, since the art teaches that success of said method is prone to influence by multiple factors, and is highly unpredictable with respect to making and using the AAVrh96 vector as claimed, and the specification does not provide ample guidance with respect to achieving the unexpected results, one would be burdened with undue experimentation to use the claimed embodiment. Given the breadth of the claims and the limited scope of the specification, an undue quantity of experimentation is require to make and use the invention beyond the scope AAVrh94, 95, 97, 98 and 99.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-11 and 14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 1 recites the limitation for the AAVrh94 plasmid that position N263 is deamidated “based on the residue position numbers of SEQ ID NO:10”. Since SEQ ID NO:10 does not have an asparagine at position 263, the claim is indefinite, and the Examiner has interpreted the claim as not requiring the entirety of SEQ ID NO:10, but only having one or more deamidated asparagines at the indicated position(s) “based on” SEQ ID NO:10. Dependent claims 2-11 are included in the basis of this rejection because they do not clarify the N263 position based on SEQ ID NO:10.
Claim 2 recites the broad recitations for (a)-(e) of “about” residue ranges for SEQ ID NOs:10, 12, 16, 18, and 20, and the claim also recites specific SEQ ID NOs: 34, 35, 36, 37, and 37, respectively, which is the narrower statement of the range. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) is considered indefinite, since the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c).
Claim 2 uses the phrases in (a)-(e) of “95% to 100% deaminated”, followed at least 3 or 4 possible asparagine positions to be deaminated. The phrase is indefinite because the specification does not clearly define how to achieve 95%-99% of 3 or 4 options. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999).
Claim 2 recites the VP3 proteins for (a)-(e) have amino acid residue ranges for SEQ ID NOs:10, 12, 16, 18, and 20, wherein the range begins on amino acid 204, 212, 204, 204, and 212, respectively, yet the claim also recites that position N57 of said SEQ ID NOs is deamidated. As position N57 is NOT within the recited range(s), the claim is indefinite.
Similar to claim 1, Claim 2 recites the limitation for the AAVrh94 plasmid that position N263 is deamidated “based on the residue position numbers of SEQ ID NO:10”. Since SEQ ID NO:10 does not have an asparagine at position 263, the claim is indefinite, and the Examiner has interpreted the claim as not requiring the entirety of SEQ ID NO:10, but only having one or more deamidated asparagines at the indicated position(s) “based on” SEQ ID NO:10.
Claim 3 recites the limitation that the gene product is “useful” in treating a disorder. A claim may be rendered indefinite by reference to subjective term (see MPEP 2173.05(b), IV). Specifically, the term “useful” is a subjective term which renders the claim indefinite. The term "useful" is not defined by the claim, the specification does not provide a standard for some standard for measuring the scope of the term, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Specifically, a claim that requires the exercise of subjective judgment without restriction may render the claim indefinite. In re Musgrave, 431 F.2d 882, 893, 167 USPQ 280, 289 (CCPA 1970). Claim scope cannot depend solely on the unrestrained, subjective opinion of a particular individual purported to be practicing the invention.
Claim 14 recites the limitation "the plasmid” in regard to Claim 13. There is insufficient antecedent basis for this limitation in the claim because Claim 13 is silent to a plasmid, thereby rendering Claim 14 indefinite.
Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3, 5, 6, 8-14 are rejected under 35 U.S.C. 103 as being unpatentable over Vandenberghe et al., US 2009/0197338, filed 4/07/2006, published 8/06/2009), in view of Scaria et al., (WO2015/168666, filed 5/02/2015, published 11/05/2015)
In regard to claims 1, 11, 12, and 13, Vandenberghe et al., teach the modified AAVrh73 vector comprising a capsid corresponding to SEQ ID NO:5 (see Claim 18 of Vandenberghe), which is 99.9% identical (737/738 amino acids) to SEQ ID NO:16 (see SCORE search 9/21/2026, rnpbm file, result #3), wherein the single difference in at position Q588R. Furthermore, in regard to independent claims 1, 11-13, and claims 9 and 14, Vandenberghe teaches methods of using the AAVrh vectors comprise an expression cassette, to deliver a transgene to a cell, plasmids encoding the capsid, and methods of making the AAVrh vectors with a rep gene, AAV 5’ and 3’ ITRs, and sufficient helper functions with host cells [0060-0066, 0091-0114].
However, Vandenvberghe is silent with respect to the AAV capsid that is 100% identical to SEQ ID NO:16.
Nevertheless, Scaria teaches that Q588 (in bold) and its neighboring amino acids (i.e., VADNLQQQNTAP) are conserved in sequence and position in the related VP1 capsid of AAV8 (see relevant region from SEQ ID NO:14 of Scaria). Furthermore, Scaria teaches the amino acid substitution of Q588R, based on the numbering of the VP1 capsid of AAV8 (see claim 343 of Scaria).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the AAV vectors as taught by Vandenberghe, and choose a Q588R mutation as taught by Scaria with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Scaria because this mutation can modulate the transduction properties of AAV capsid to HSPG and improve transduction of the retina [0165, 0219-0220]. This would be especially important for the delivery of neurotrophic factors (e.g., BDNF, EPO, etc), angiogenic factors (e.g., VEGF, angiopoietins), and/or anti-antiangiogenic factors (angiostatins) of Vandenberghe to the eye [0124-0125, 0128].
In regard to claim 3, as stated supra, Vandenberghe and Scaria make obvious SEQ ID NO:16, which according to Applicant’s claims is to be interpreted as an AAVrh97 vector. Furthermore, Vandenberghe teaches the expression cassette comprises a useful gene product for treating a disorder [0127-0151].
In regard to claim 5, Vandenberghe teaches the expression cassette comprises a constitutive promoter [0085, 0143].
In regard to claim 6, alternatively Vandenberghe teaches the expression cassette comprises a tissue specific promoter [0086-0087].
In regard to claim 8, as stated supra, Vandenberghe teaches the expression cassette comprises a therapeutic gene product [0127-0151].
In regard to claim 10, Vandenberghe teaches the AAV vector is in a pharmaceutical composition and physiologically compatible carrier [0122].
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claims 1, 2, and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Vandenberghe et al., US 2009/0197338, filed 4/07/2006, published 8/06/2009), in view of Scaria et al., (WO2015/168666, filed 5/02/2015, published 11/05/2015) and Wilson et al. (WO2019/169004, filed 2/27/2019, published 9/06/2019)
In regard to claims 1, 2 and 7, as stated supra, Vandenberghe et al., teach a modified AAVrh vector comprising a capsid corresponding to SEQ ID NO:5 (see Claim 18 of Vandenberghe), which is 99.9% identical (737/738 amino acids) to SEQ ID NO:16 (see SCORE search 9/21/2026, rnpbm file, result #3), wherein Scaria teaches the single difference at position Q588R would have been obvious to generate so as to influence HSPG binding, thereby making obvious an AAVrh97 capsid.
However, Vandenberghe is silent with respect to position N263 of the AAVrh capsid of SEQ ID NO:16 being deamidated. Note that in regard to claims 1, 2, and 7, directed to the N263 position “based on” SEQ ID NO:10, the Examiner has interpreted the claim as not requiring the entirety of SEQ ID NO:10, but only having one or more deamidated asparagines at the indicated position(s) “based on” SEQ ID NO:10, thereby making obvious the AAVrh94 capsid by and AAV capsid that has a deamidated N263.
Wilson claims an rAAVrh vector comprising a VP3 capsid with amino acids 204-738, wherein 100% of the N263 position are deamidated (see Claims 1 and 6 of Wilson).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the AAV vectors as taught by Vandenberghe, and choose an AAVrh vector comprising 100% of the N263 position of SEQ ID NO:16 being deamidated as taught by Wilson with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Wilson because deamidation naturally continues after expression and purification until NG sites are “completely deaminated” (p. 87, 3rd para.), and that these deamidated sites should be carefully monitored during vector production (p. 89, 1st para.).
In regard to claim 7, as stated supra, Vandenberghe and Scaria make obvious deamidation of N263 of SEQ ID NO:16, which according to Applicant’s claims is to be interpreted as a position based on N263 of SEQ ID NO:10 and therefore encompasses an AAVrh94 capsid. Furthermore, as stated supra, Vandenberghe teaches the expression cassette comprises a therapeutic gene product such as an immunogen [0142-0151].
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Vandenberghe et al., US 2009/0197338, filed 4/07/2006, published 8/06/2009), in view of Scaria et al., (WO2015/168666, filed 5/02/2015, published 11/05/2015), as applied to claim 1, in further view of Kantardzhieva et al. (WO2019/102381, filed 11/21/2019, published 5/31/2019)
As stated supra, Vandenberghe et al., suggest a modified AAVrh97 vector comprising a capsid corresponding to SEQ ID NO:16 with altered HSPG binding for delivery of transgenes to the eye.
However, Vandenberghe et al. are silent with respect to the transgene being a gene editing nuclease.
Kantardzhieva teaches and claims an AAV vector comprising a self-inactivating SaCas9 gene editing nuclease for delivery to the eye of a subject ([00475-00495], Fig. 5, see claim 133)
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the AAV vectors as suggested by Vandenberghe, and include an SaCas9 transgene as taught by Kantardzhieva with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Kantardzhieva because the SaCas9 gene editing nuclease can permanently correct genetic diseases of the eye (Summary, [0007-0010]).
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Conclusion
No claims are allowed.
Examiner Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ARTHUR S LEONARD whose telephone number is (571)270-3073. The examiner can normally be reached on Mon-Fri 9am-5pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Doug Schultz can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ARTHUR S LEONARD/Examiner, Art Unit 1631
Prosecution Insights