Prosecution Insights
Last updated: August 06, 2026
Application No. 19/169,933

GENE EXPRESSION ELEMENTS AND SYSTEMS AND USE THEREOF

Non-Final OA §103§112§DOUBLEPATENT
Filed
Apr 03, 2025
Priority
Jan 01, 2019 — provisional 62/787,302 +2 more
Examiner
ZHENG, LI
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Geneneer Ltd.
OA Round
1 (Non-Final)
84%
Grant Probability
Favorable
1-2
OA Rounds
1y 2m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 84% — above average
84%
Career Allowance Rate
1067 granted / 1276 resolved
+23.6% vs TC avg
Moderate +13% lift
Without
With
+12.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
31 currently pending
Career history
1303
Total Applications
across all art units

Statute-Specific Performance

§101
2.9%
-37.1% vs TC avg
§103
17.0%
-23.0% vs TC avg
§102
21.0%
-19.0% vs TC avg
§112
50.6%
+10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1276 resolved cases

Office Action

§103 §112 §DOUBLEPATENT
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION 1. Claims 1-20 are pending and examined on the merits. Specification 2. The abstract remains objected to because it is not within the range of 50-150 words. The specification is objected to under 37 CFR 1.821(d) as failing to refer to a sequence by use of its sequence identifier preceded by “SEQ ID NO:”. The nucleotide sequences in Figures 7A and 7B should be identified with SEQ ID Nos. Alternatively, the brief descriptions of those figures on page 20 can be amended to recite the identifiers. The disclosure is objected to because the status of U.S. application needs to be updated. For example, U.S. application is recited on page 1. Claim objection 3. Claim 1 is objected to for the typo “positions 486”. It is suggested to replace it with –position 48--. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 4. Claims 1-16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. A review of the full content of the specification indicates that polyamine responsive nucleic acid sequences having at least 85% sequence identity to positions 486-590 of the nucleotide sequence of SEQ ID NO: 1 are essential to the operation of the claimed invention. The Federal Circuit has recently clarified the application of the written description requirement. The court stated that a written description of an invention “requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials.” (See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997)). The court also concluded that “naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not a description of that material.” Id. Further, the court held that to adequately describe a claimed genus, Patent Owner must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to “visualize or recognize the identity of the members of the genus.” Id. A review of the language of indicates that the claim is broadly drawn to a genus of polyamine responsive nucleic acid sequences having at least 85% sequence identity to positions 486 to position 590 of the nucleotide sequence of SEQ ID NO: 1. However, the specification does not describes any other species in the claimed genus except for SEQ ID NO: 1 and 3. However, SEQ ID NO:3 is identical to positions 486 to position 590 of the nucleotide sequence of SEQ ID NO: 1. Neither the specification nor the prior art teaches the conserved structures in SEQ ID NO: 3 that are essential for being an polyamine responsive nucleic acid sequence. The only structures correlated with the promoter activity are the sequence of SEQ ID NO: 3. Not a single specie differing in sequence from SEQ ID NO: 3 and as being polyamine responsive nucleic acid sequence is described in the specification. Therefore, given the breadth of the claim and the lack of further guidance, a person skilled in the art would conclude that applicants are not in possession of the claimed genus of polyamine responsive nucleic acid sequences. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 5. Claims 1-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of U.S. Patent No. 12,297,438. Although the claims at issue are not identical, they are not patentably distinct from each other. Claims 1-20 are drawn to an isolated expression control element (ECE), comprising a polyamine or polyamine analog responsive nucleic acid sequence having having at least 85% identity to positions 486 to position 590 of the nucleic acid sequence set forth in SEQ ID NO: 1 flanked at its 5′ end and 3′ end by splice sites, further comprising at least one intron sequence flanking each of the splice sites, wherein the at least one intron length is from 10 nucleotides to 150 nucleotides; or an isolated expression control element (ECE), comprising a polyamine or polyamine analog responsive nucleic acid sequence flanked at its 5' end and 3' end by splice sites, wherein the splice site located 5' to the polyamine or polyamine analog responsive nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:8; expression cassette comprising the ECE or a eukaryotic host cell comprising the EC; or a method for regulating the expression of a transcribable polynucleotide within a host cell by using the ECC. Claims 1-19 of U.S. Patent No. 12,297,438 teach an isolated expression control element (ECE), comprising a polyamine or polyamine analog responsive nucleic acid sequence having the nucleic acid sequence as set forth in SEQ ID NO: 3 flanked at its 5′ end and 3′ end by splice sites, further comprising at least one intron sequence flanking each of the splice sites, wherein the at least one intron length is from 10 nucleotides to 150 nucleotides (claim 1). Claims 1-19 of U.S. Patent No. 12,297,438 further teach the expression cassette (claim 9) and eukaryotic host cell (claims 7-8) comprising the ECE. Claims 1-19 of U.S. Patent No. 12,297,438 further teach a method for regulating the expression of a transcribable polynucleotide within a host cell by using the ECC. Given that SEQ ID NO:3 of U.S. Patent No. 12,297,438 is identical to positions 486 to position 590 of the nucleic acid sequence set forth in SEQ ID NO: 1, claims 1-19 of U.S. Patent No. 12,297,438 anticipates instant claims 1-16. Although claims 1-19 of U.S. Patent No. 12,297,438 do not teach the splice site located 5' to the polyamine or polyamine analog responsive nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:8, such feature is considered merely as a design choice. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 6. Claim(s) 17-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Hyvonen et al. (2006, Rna 12:1569-1582) as applied to claim above, and further in view of Wang et al. (1998, Journal of Biological Chemistry 273:34623-34630) and Ni et al. (2007, Genes & development 21:708-718). Instant claims are an isolated expression control element (ECE) comprising a polyamine responsive nucleic acid sequence flanked by splice site, and wherein the flanking splice site comprises a splice acceptor site located 5’ to the polyamine responsive nucleic acid sequence comprises SEQ ID NO:8; or expression system comprising a promoter operably linked to at least ECE, or eukaryotic host cell comprising the expression system; or a method of regulating the expression of a transcribable polynucleotide comprising transforming into host cell at least one polynucleotide comprising ECE and regulating the amount of polyamine to which the host cell is exposed. Hyvonen et al. discloses that addition of polyamines and analogs thereof reduces amount of variant transcript of human Spermidine/SperminN1 Acetyltransferase(SSAT) gene, whereas depletion of polyamines and analogs thereof enhances X-exon inclusion into SSAT via modulating of alternative splicing (page1578; left column,last paragraph-right column, last paragraph) suggests that polyamines and analogs thereof exert said modulation via polyamine responsive element (PRE). Said PRE is equivalent to polyamine responsive nucleic acid sequence. Hyvonen et al. discloses the experiment is performed on mammal cell culture and in vivo on mice (page 1577, right column, last paragraph). Hyvonen et al. do not teach flanking PRE with splice sites to form ECE or regulating transcribable polynucleotide by ECE. Wang et al. teach structure and localization of PRE in SSAT promoter and report constructure comprising said promoter (page 34626, left column , 1st paragraph). Ni et al. teach inclusion of stop codon exon of SSAT(exon X) along with adjacent intron sequences in heterologous genes cause dependency of alternative splicing of said heterologous genes on level of polyamines (page 715, left column, 2nd paragraph) and Ni et al. imply present of splice sites flanking the exon on junctions of said exon with the adjacent introns given that the effect on alternative splicing of the heterologous genes is mediated by PREs present in said exon. Given the knowledge that polyamine-dependent modulating alternative splicing of SSAT gene by Hyvonen et al., it would have been obvious for skilled in the art to use PRE from human SSAT gene of Wang et al. flanked with splice sites with stop codon given the teaching of Ni et a l. that stop codon exon of SSAT (exon X) along with adjacent intron sequences in heterologous genes cause dependency of alternative splicing of said heterologous genes on level of polyamines. Although combined teachings do not teach using splice acceptor site of SEQ ID NO:8, such sequence is an obvious design choice for splice acceptor site and well known in the art. Alignment of SEQ ID NO:1 and human SSAT gene Homo sapiens spermidine/spermine N1-acetyltransferase 1 (SAT1), transcript variant 2, non-coding RNA Sequence ID: NR_027783.3Length: 1159Number of Matches: 1 Related Information Gene-associated gene details PubChem BioAssay-bioactivity screening Genome Data Viewer-aligned genomic context Range 1: 48 to 1159GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 1471 bits(796) 0.0 1020/1126(91%) 24/1126(2%) Plus/Plus Query 150 GAGGTTCGCCGGGTCATGGTGCCAGCCTGACTGAGAAGAGGACGCTCCCGGGAAACGAAT 209 ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 48 GAGGTTCCTTGGGTCATGGTGCCAGCCTGACTGAGAAGAGGACGCTCCCGGGAGACGAAT 107 Query 210 GAGGAACCACCTCCTCCTGCTGTTCAAGTACAGGGGCCTGGTGCGCAAAGGGAAGAAAAG 269 |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct 108 GAGGAACCACCTCCTCCTACTGTTCAAGTACAGGGGCCTGGTCCGCAAAGGGAAGAAAAG 167 Query 270 CAAAAGACGAAAATGGCTAAATTTAAGATCCGTCCAGCCACTGCCTCTGACTGCAGTGAC 329 ||||||||||||||||||||||| |||||| |||||||||||| | |||||||||||| Sbjct 168 CAAAAGACGAAAATGGCTAAATTCGTGATCCGCCCAGCCACTGCCGCCGACTGCAGTGAC 227 Query 330 ATCCTGCGACTGATCAAGGAACTGGCTAAATATGAATACATGGAAGATCAAGTCATTTTA 389 || ||||| ||||||||||| |||||||||||||||||||||||||| ||||| || ||| Sbjct 228 ATACTGCGGCTGATCAAGGAGCTGGCTAAATATGAATACATGGAAGAACAAGTAATCTTA 287 Query 390 ACTGAGAAAGATCTCCAAGAGGATGGCTTTGGAGAACACCCCTTCTACCACTGCCTGGTT 449 ||||| |||||||| | ||| ||||| |||||||| |||||||| ||||||||||||||| Sbjct 288 ACTGAAAAAGATCTGCTAGAAGATGGTTTTGGAGAGCACCCCTTTTACCACTGCCTGGTT 347 Query 450 GCAGAAGTGCCTAAAGAGCACTGGACCCCTGAAGGTTACAGTCTCTAGCTTCGCCATGTA 509 ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| Sbjct 348 GCAGAAGTGCCGAAAGAGCACTGGACTCCGGAAGGTTACAGTCTCTAGCTTCGCCATGTA 407 Query 510 CATGGCCCTTCTGTGTACATGGATGGGCGGGGAGGTAACTAAAAGACCCTTTACACAATA 569 ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 408 CATGGCCCTTCCGTGTACATGGATGGGCGGGGAGGTAACTAAAAGATCCTTTACACAATA 467 Query 570 AAGTAGATGATCATGATAAATGAGGACATAGCATTGTTGGGTTCGCCATGTACTATTTTA 629 |||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| Sbjct 468 AAGTAGATGATCATGATAAATGAGGACACAGCATTGTTGGTTTTGCCATGTACTATTTTA 527 Query 630 CCTATGACCCATGGATTGGCAAGTTGCTGTATCTTGAAGACTTCTTCGTGATGAGTGATT 689 |||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||| Sbjct 528 CCTATGACCCGTGGATTGGCAAGTTATTGTATCTTGAGGACTTCTTCGTGATGAGTGATT 587 Query 690 ACAGAGGCTTTGGTATAGGATCAGAAATTTTGAAGAATCTAAGCCAGGTTGCCATGAAGT 749 | ||||||||||| ||||||||||||||| |||||||||||||||||||||| |||| || Sbjct 588 ATAGAGGCTTTGGCATAGGATCAGAAATTCTGAAGAATCTAAGCCAGGTTGCAATGAGGT 647 Query 750 GTCGCTGCAGCAGTATGCACTTCTTGGTAGCAGAATGGAATGAACCATCTATCAACTTCT 809 ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| Sbjct 648 GTCGCTGCAGCAGCATGCACTTCTTGGTAGCAGAATGGAATGAACCATCCATCAACTTCT 707 Query 810 ACAAAAGAAGAGGTGCTTCGGATCTGTCCAGTGAAGAGGGATGGAGGCTCTTCAAGATTG 869 | ||||||||||||||||| |||||||||||||||||||| ||||| || |||||||| | Sbjct 708 ATAAAAGAAGAGGTGCTTCTGATCTGTCCAGTGAAGAGGGTTGGAGACTGTTCAAGATCG 767 Query 870 ACAAAGAGTACTTGCTAAAAATGGCAGCAGAGGAGTGAGGCGTGCCGGTGTAGACAATGA 929 |||| ||||||||||||||||||||| ||||||||||||| |||| | ||||| |||| Sbjct 768 ACAAGGAGTACTTGCTAAAAATGGCAACAGAGGAGTGAGGAGTGCTGCTGTAG---ATGA 824 Query 930 CAACCTCCATTGTGCTTTAGAAT-AATTCTCAGCTTCCCTTGCTTTCTATCTTGTGTGTA 988 ||||||||||| | |||||||| ||||| || |||| |||||||||||| ||| |||| Sbjct 825 CAACCTCCATTCTATTTTAGAATAAATTCCCAACTTCTCTTGCTTTCTATGCTGTTTGTA 884 Query 989 GTGAAATAATAGAGCGAGCACCCATTCCAAAGCTTTATTACCAGTGACGTTGTTGCATGT 1048 ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 885 GTGAAATAATAGAATGAGCACCCATTCCAAAGCTTTATTACCAGTGGCGTTGTTGCATGT 944 Query 1049 TTGAAATTCGGTCTGTTTAAAGTGGCA--GTCATGTATGTGGTTTGGAG-G-CAGA---A 1101 ||||||| |||||||||||||||||| ||| | ||| |||||||| | |||| Sbjct 945 TTGAAATGAGGTCTGTTTAAAGTGGCAATCTCA-G-ATGCAGTTTGGAGAGTCAGATCTT 1002 Query 1102 T-T-CTTGAACATCTTTTGATGAAGAACAAGGTGGTATGATCTTACTATATAAGAAAAAC 1159 | | |||||| |||||| ||| || ||||||||||| |||||||| ||||| |||| Sbjct 1003 TCTCCTTGAATATCTTTCGATAAACAACAAGGTGGTGTGATCTTAATATATTTGAAA--- 1059 Query 1160 AAAACTTCATTCTTGTGAGTCATTTAAATGTGTACAATGTACACACTGGTACTTAGAGTT 1219 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1060 AAAACTTCATTCTCGTGAGTCATTTAAATGTGTACAATGTACACACTGGTACTTAGAGTT 1119 Query 1220 TCTGTTTTGATTCttttttttttAAATAAACTACTCTTTGATTTAA 1265 ||||||| ||||||||||| |||||||||||||||||||||| Sbjct 1120 TCTGTTT-GATTCTTTTTT-----AATAAACTACTCTTTGATTTAA 1159 RESULT 1 AA371099 LOCUS AA371099 309 bp mRNA linear EST 18-DEC-2012 DEFINITION EST82849 Prostate gland I Homo sapiens cDNA 5' end similar to similar to spermidine/spermine N1-acetyltransferase, mRNA sequence. ACCESSION AA371099 VERSION AA371099.1 DBLINK BioSample: SAMN00155386 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 309) AUTHORS Adams,M.D., Kerlavage,A.R., Fleischmann,R.D., Fuldner,R.A., Bult,C.J., Lee,N.H., Kirkness,E.F., Weinstock,K.G., Gocayne,J.D., White,O., Sutton,G., Blake,J.A., Brandon,R.C., Man-Wai,C., Clayton,R.A., Cline,T.R., Cotton,M.D., Earle-Hughes,J., Fine,L.D., Fitzgerald,L.M., Fitzhugh,W.M., Fritchman,J.L., Geoghagen,N.S., Glodek,A., Gnehm,C.L., Hanna,M.C., Hedblom,E., Hinkle,P.S. Jr., Kelley,J.M., Kelley,J.C., Liu,L.-I., Marmaros,S.M., Merrick,J.M., Moreno-Palanques,R.F., McDonald,L.A., Nguyen,D.T., Pelligrino,S.M., Phillips,C.A., Ryder,S.E., Scott,J.L., Saudek,D.M., Shirley,R., Small,K.V., Spriggs,T.A., Utterback,T.R., Weidman,J.F., Li,Y., Bednarik,D.P., Cao,L., Cepeda,M.A., Coleman,T.A., Collins,E.J., Dimke,D., Feng,D.-F., Ferrie,A., Fischer,C., Hastings,G.A., He,W.W., Hu,J.S., Greene,J.M., Gruber,J., Hudson,P., Kim,A.K., Kozak,D.L., Kunsch,C., Hungjun,J., Li,H., Meissner,P.S., Olsen,H., Raymond,L., Wei,Y.F., Wing,J., Xu,C., Yu,G.L., Ruben,S.M., Dillion,P.J., Fannon,M.R., Rosen,C.A., Haseltine,W.A., Fields,C., Fraser,C.M. and Venter,J.C. TITLE Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence JOURNAL Nature 377 (6547 Suppl), 3-174 (1995) PUBMED 7566098 COMMENT Other_ESTs: THC172807 Contact: Kerlavage, AR Bioinformatics The Institute for Genomic Research 9712 Medical Center Drive, Rockville, MD 20850 USA Tel: 3018699056 Fax: 3018699423 Email: arkerlav\@tigr.org For clone availability, additional sequence and expression information related to this EST, please check the TIGR Human Gene Index (http://www.tigr.org/tdb/hgi/hgi.html) Seq primer: M13 Reverse. FEATURES Location/Qualifiers source 1..309 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /sex="male" /clone_lib="SAMN00155386 Prostate gland I" /dev_stage="adult, 21 yrs" /note="Organ: prostate; Vector: pBluescript SK-; Site_1: EcoRI; Site_2: XhoI Query Match 96.6%; Score 90; Length 309; Best Local Similarity 90.9%; Matches 90; Conservative 2; Mismatches 7; Indels 0; Gaps 0; Qy 1 TACAGTCTCNAGCTTCGCCATGTACATGGCCCTTCYGTGTACATGGATGGGCGGGNNGGT 60 ||||||||| |||||||||||||||||||||||||:||||||||||||||||||| ||| Db 101 TACAGTCTCTAGCTTCGCCATGTACATGGCCCTTCCGTGTACATGGATGGGCGGGGAGGT 160 Qy 61 AACTAAAAGAYCCNTTACNCAATAAAGTAGATGATAAAT 99 ||||||||||:|| |||| |||||||||||||||| | | Db 161 AACTAAAAGATCCTTTACACAATAAAGTAGATGATCATT 199 Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LI ZHENG whose telephone number is (571)272-8031. The examiner can normally be reached Monday-Friday (9-5). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /LI ZHENG/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Apr 03, 2025
Application Filed
Jul 24, 2026
Non-Final Rejection mailed — §103, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698507
METHODS AND COMPOSITIONS FOR CONFERRING AND/OR ENHANCING HERBICIDE TOLERANCE USING PROTOPORPHYRINOGEN IX OXIDASE OF VARIOUS CYANOBACTERIA OR VARIANT THEREOF
4y 8m to grant Granted Aug 04, 2026
Patent 12696863
PLANTS AND SEEDS OF CORN VARIETY CV991361
2y 7m to grant Granted Aug 04, 2026
Patent 12692507
GENE ZmPLD3 FOR INDUCING MAIZE MATERNAL HAPLOID PRODUCTION AND ITS APPLICATION THEREOF
4y 4m to grant Granted Jul 28, 2026
Patent 12690533
CHLOROSIS RESISTANT CYTOPLASMIC MALE STERILE BRASSICA PLANTS
3y 1m to grant Granted Jul 28, 2026
Patent 12690542
SOYBEAN CULTIVAR 25120839
2y 6m to grant Granted Jul 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
84%
Grant Probability
96%
With Interview (+12.8%)
2y 6m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1276 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month