PLANT REGULATORY ELEMENTS AND USES THEREOF FOR AUTOEXCISION

§102 §103 §112

Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Status of objections and rejections 1. Claims 1-2 and 5-20 are pending. Claims 3 and 4 are cancelled. Claims 16-20 are previously withdrawn as drawn to non-elected invention. Accordingly, claims 1-2 and 5-15 are examined on merits in the instant Office action. 2. The objections to claims 1, 2, 5-11 and 13-14 is withdrawn in light of claim amendments filed in the papers of July 22, 2026 and upon further consideration. 3. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. 4. Rejection of Claims 1-2 under 35 U.S.C. §101 because the claimed invention was directed to a judicial exception (product of nature) without reciting significantly more is withdrawn in light of claim amendments filed in the papers of July 22, 2026 and upon further consideration. 5. Rejection of Claims 1, 2 and 5-15 under 35 U.S.C. 112(a), first paragraph, as failing to comply with the scope of enablement is withdrawn in light of claim amendments filed in the papers of July 22, 2026 and upon further consideration. 6. Rejection of claims 1, 2, 6, 7, 9, 11, 13, 14 and 15 under 35 U.S.C. 102(a)(1) as being anticipated by Boukharov et al. (US Patent Publication No. US2007/0020621 A1, Published January 25, 2007) is withdrawn in light of claim amendments filed in the papers of July 22, 2026 and upon further consideration. 7. Rejection of Claims 14 and 15 for being provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 12 of copending Application No. 18/903,443 is withdrawn in light of cancellation of claim 12 in the pending US Application No. 18/903,443. Claim Objections 8. Claim 15 remains objected to because of the following informalities: In claim 15, the Markush group members do not correspond to the recitation of plant. For example, the recitation “corn plant part or plant cell” should be replaced with ---corn plant, plant part or plant cell---. Likewise other members of the Markush Group should be amended accordingly. In claim 15, the recitation “and/or” in line 3 should be either replaced by ---and--- or by ---or--- for clarity of the claimed language. Alternatively, claims should be rewritten as dependent claims. Claim Rejections - 35 USC § 112 9A. Claims 1, 2 and 5-15 remain rejected under 35 U.S.C. 112, first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention for the reasons of record stated in the Office action mailed April 27, 2026. Applicant’s arguments are carefully considered but are deemed to be unpersusaive. The claims are broadly drawn to a recombinant DNA molecule comprising a DNA sequence with at least 95 sequence identity to SEQ ID NO: 1; a fragment of SEQ ID NO: 1 with promoter activity in any eukaryotic cell, or wherein the DNA sequence is operably linked to a heterologous transcribable DNA molecule. The breadth of claims would encompass sequences having unspecified changes in the nucleotide sequence of SEQ ID NO: 1, and exhibiting a promoter activity. The breadth of claims also encompass fragments of at least 50 contiguous nucleotides derived from SEQ ID NO: 1, and exhibiting a promoter activity. Thus breadth of claims would encompass a large genus comprising species of unknown structure and thus their function is either unpredictable or unknown. The specification however, only describes the structure of SEQ ID NO: 1. The specification also describes the function of promoter activity for SEQ ID NO: 1 in a plant. The instant specification, however, only describes a nucleic acid sequence of SEQ ID NO: 1 which is a promoter and leader sequence of a truncated transcription factor Cauliflower A-like gene from Glycine soja plant and has promoter activity when operably linked to a transcribable DNA sequence. The specification also describes that SEQ ID NO: 1 was used in construct 1 to drive autoexcision of operably linked sequence in the transformed soybean plants, resulting in marker free transgenic soybean plants. See in particular, examples 1-3; Tables 1-3 at pages 43-46. The specification fails to describe representative species of Applicant’s broadly claimed genus. There is no description of the structure required for the recited function, and no description of the necessary and sufficient elements of promoter activity of sequences having at least 95% identity to SEQ ID NO: 1 or fragments of at least 50 contiguous nucleotides derived from SEQ ID NO: 1. The only species described is SEQ ID NO: 1. One of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly variant, SEQ ID NO: 1 is insufficient to describe the claimed genus. Accordingly, there is lack of adequate description to inform a skilled artisan that applicant was in possession of the claimed invention at the time of filing. See Written Description guidelines published in Federal Register/Vol.66, No. 4/Friday, January 5, 2001/Notices; p. 1099-1111. Given the claim breadth and lack of guidance as discussed above, the specification does not provide written description of the genus broadly claimed. Accordingly, one skilled in the art would not have recognized Applicants to have been in possession of the claimed invention at the time of filing. 9B. Response to Applicant’s arguments: Contrary to Applicant’s arguments, the specification describes only one worked species: full-length SEQ ID NO:1. No variant or fragment sequence, boundary, or tested example exists anywhere in the disclosure. The percent-identity/“functional fragment” language (paragraphs 0054–0055, 0058, 0072) is generic boilerplate shared across all 16 disclosed sequences — a “wish or plan,” not description of possession (Ariad). The Kim et al. reference already of record (small nucleotide changes can abolish promoter activity) directly undercuts any claim that % identity correlates with retained function — so identity alone can’t stand in for structural disclosure (Regents of UC v. Eli Lilly; Amgen v. Sanofi; Enzo Biochem). In response to Applicant’s Vas-Cath/BLAST-alignment argument, it is important to note that identifying candidates by percent identity is a structural-similarity exercise, not evidence of which candidates retain function. The “known methods” (deletion analysis, motif ID) language is characterized as a future research plan, not disclosure of possession. The Federal Circuit has clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). In summary, the court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. A definition by function does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is. The court goes on to say, “A description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” See University of California v. Eli Lilly and Co., 119 F.3d 1559; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). Thus, under Lilly and its progeny, the Specification does not show possession of a sufficient number of sequences falling within their potentially large genus to establish possession of their claimed genus. See Cf Enzo, 323 F.3d at 964 ("if the functional characteristic of... binding to [CD48] were coupled with a disclosed correlation between that function and a structure that is sufficiently known or disclosed," the written description requirement may be met). Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, ("definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is"); see also Kubin, 83 USPQ2d at 1416-17. Also see in re Curtis (69 USPQ2d 1274 (Fed. Cir.2004), where the court held that there was sufficient evidence to indicate that one of ordinary skill in the art could not predict the operability of other species other that the single one disclosed in the specification. The court held that a disclosure naming a single species can support a claim to a genus that includes that species if a person of ordinary skill in the art, reading the initial disclosure, would “instantly recall” additional species of the genus already “stored” in the minds, but if other members of the genus would not “naturally occur” to a person of ordinary skill upon reading the disclosure, then unpredictability in performance of species other than specifically enumerated defeats claims to the genus. In view of above, the requirement for written description has not been met. Claim Rejections - 35 USC § 102 10A. Claims 1, 2, 5-7 and 9-15 remain rejected under 35 U.S.C. 102(a)(1) as being anticipated by Brower-Toland et al. (US Patent Publication No. US 2018/0105819 A1 Published April 19, 2018) for the reasons of record stated in the Office action mailed April 27, 2026. Brower-Toland et al disclose a recombinant DNA molecule comprising a DNA sequence as set forth in SEQ ID NO: 53 and having 99.9% nucleotide sequence identity and 100% similarity to instant SEQ ID NO: 1, wherein said DNA sequence is operably linked to a heterologous transcribable DNA sequence, and wherein said DNA sequence has promoter (same as gene regulatory) activity, or wherein the heterologous transcribable DNA sequence encodes a site-specific recombinase, or wherein the site-specific recombinase is a Cre-recombinase, a Flp-recombinase etc., or a recombinant DNA construct comprising said recombinant DNA molecule and comprising an expression cassette comprising a selectable marker transgene, an expression cassette encoding a site-specific nuclease, one or more expression cassettes encoding one or more guide RNAs or an expression cassette comprising a transgene of agronomic interest, or wherein the selectable marker transgene confers resistance to a herbicide or antibiotic, the transgene of agronomic interest confers herbicide tolerance in plants, or confers increased yield, or encodes a dsRNA, a miRNA, or an siRNA, or wherein the guide RNA comprises a targeting sequence that targets a sequence in the genome of a plant cell for genome editing or site-specific integration, the site-specific nuclease is an RNA-guided endonuclease, the site-specific nuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, or Csf4, or a DNA transformation vector comprising said recombinant DNA molecule or said recombinant DNA construct, having a T-DNA segment bounded by a left border and right border, or wherein said DNA transformation vector having the heterologous transcribable DNA sequence comprised in the recombinant DNA molecule encodes a site-specific recombinase and is located between the left border and the right border of the T-DNA segment, or wherein said DNA transformation vector having said expression cassette comprising a selectable marker transgene, or wherein said DNA transformation vector having the expression cassette encoding the site-specific nuclease, or wherein said DNA transformation vector having the one or more expression cassettes encoding the one or more guide RNAs, or wherein said DNA transformation vector having the transgene of agronomic interest is/are located between the left border and the right border of the T-DNA segment, or a transgenic plant, plant part or plant cell, comprising said recombinant DNA molecule, said recombinant DNA construct, or said DNA transformation vector, or wherein said transgenic plant, plant part or plant cell is from corn, soybean, cotton or canola plant species. See in particular, abstract, Figures 1-13; claims 1-43; paragraphs [0007]-[0298]; Examples 1-24; Tables 1-37. The sequence homology results are as follows: Sequence 53, US/15787359A Publication No. US20180105819A1 GENERAL INFORMATION APPLICANT: MONSANTO TECHNOLOGY LLC APPLICANT: BROWER-TOLAND, Brent APPLICANT: DAI, Shunhong APPLICANT: GABBERT, Karen APPLICANT: GOLDSHMIDT, Alexander APPLICANT: HOWELL, Miya APPLICANT: MCDILL, Brad APPLICANT: OVADYA, Dan APPLICANT: SAVIDGE, Beth APPLICANT: SHARMA, Vijay TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR ALTERING FLOWERING AND PLANT TITLE OF INVENTION: ARCHITECTURE TO IMPROVE YIELD POTENTIAL FILE REFERENCE: P34461US02/0016518.00360 CURRENT APPLICATION NUMBER: US/15/787,359A CURRENT FILING DATE: 2017-10-18 PRIOR APPLICATION NUMBER: 62/411,408 PRIOR FILING DATE: 2016-10-21 PRIOR APPLICATION NUMBER: 62/410,355 PRIOR FILING DATE: 2016-10-19 NUMBER OF SEQ ID NOS: 110 SEQ ID NO 53 LENGTH: 2001 TYPE: DNA ORGANISM: Glycine max Query Match 99.9%; Score 1999; Length 2001; Best Local Similarity 100.0%; Matches 1999; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 TTTCGTGTGTGTGAACAAAATAAATGATCTGCACATGTATCATGGTTATAGTAACAAGTC 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TTTCGTGTGTGTGAACAAAATAAATGATCTGCACATGTATCATGGTTATAGTAACAAGTC 60 Qy 62 CCAGCTCCCAAGGGTAGTAGCTGCTTAAAGACACACGGAAACCCTCGAGGATAATGGTGG 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCAGCTCCCAAGGGTAGTAGCTGCTTAAAGACACACGGAAACCCTCGAGGATAATGGTGG 120 Qy 122 AGAGAGAGTGTTGAAATTTCAACCATCTCACTTTTTTCTTCTACCTTATTCTTTAGCCGA 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AGAGAGAGTGTTGAAATTTCAACCATCTCACTTTTTTCTTCTACCTTATTCTTTAGCCGA 180 Qy 182 AAATTAAGTTCTAACTTTAAAATACAGATTTGCTTCAGAAGTTGATTTTTTAGGTTTTTT 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAATTAAGTTCTAACTTTAAAATACAGATTTGCTTCAGAAGTTGATTTTTTAGGTTTTTT 240 Qy 242 TTTTTCTGGAAGACCAATATTAATTTGTGATAGTTAGTTAAAAAAATTATATTATGTTTT 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TTTTTCTGGAAGACCAATATTAATTTGTGATAGTTAGTTAAAAAAATTATATTATGTTTT 300 Qy 302 GTGATAGTTAGTTGAAAAAATTATATTGTGTTTTGCTACTAATTTACTTTCAAAATATAA 361 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTGATAGTTAGTTGAAAAAATTATATTGTGTTTTGCTACTAATTTACTTTCAAAATATAA 360 Qy 362 ATATCCAAATATATATATAAATCTTATCACTTGAAAATAGATGGTGGGTATATGGACTCA 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ATATCCAAATATATATATAAATCTTATCACTTGAAAATAGATGGTGGGTATATGGACTCA 420 Qy 422 AATCTATGGATCGGTCTGTTTAACCCACGAATTTTGCAGATAACAAGCCTTTTTTTAAAA 481 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AATCTATGGATCGGTCTGTTTAACCCACGAATTTTGCAGATAACAAGCCTTTTTTTAAAA 480 Qy 482 GAAAATTCGCATAACTATATCCAAGTTTTTCTTAGTTCGGTCCATTAAGCTAGCACATCT 541 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GAAAATTCGCATAACTATATCCAAGTTTTTCTTAGTTCGGTCCATTAAGCTAGCACATCT 540 Qy 542 AGTAGTCTTTATCCATGGACATATTATTAATTTGTTATGTTAAAATTTTGATTTTTAATC 601 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AGTAGTCTTTATCCATGGACATATTATTAATTTGTTATGTTAAAATTTTGATTTTTAATC 600 Qy 602 TAGTGGTATATTTTAGTATGATAGATTTTAACTTAAAAAATGAAGTCAATTTTTTATTAC 661 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TAGTGGTATATTTTAGTATGATAGATTTTAACTTAAAAAATGAAGTCAATTTTTTATTAC 660 Qy 662 TAATTTTATACATTTTTCACTTTTAAAAAATATTTATTTCATAAGAAATATTTTTAAATT 721 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TAATTTTATACATTTTTCACTTTTAAAAAATATTTATTTCATAAGAAATATTTTTAAATT 720 Qy 722 ACTATTTGGGTCCATGGATCAATTTATTTATCTGAGTTTTTATGGGCTAGATACAAATCT 781 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ACTATTTGGGTCCATGGATCAATTTATTTATCTGAGTTTTTATGGGCTAGATACAAATCT 780 Qy 782 TGGAAAAAAGCCAATTTATTTCATGGATTGGCTTATTTGATCCGTCTAAAATGCAAGCTT 841 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TGGAAAAAAGCCAATTTATTTCATGGATTGGCTTATTTGATCCGTCTAAAATGCAAGCTT 840 Qy 842 CACAAGACAAACCTTAAACATACCATACCATCCTTTTATCTATCTCTACTTCAAAATCAA 901 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CACAAGACAAACCTTAAACATACCATACCATCCTTTTATCTATCTCTACTTCAAAATCAA 900 Qy 902 TTTTTGCAACATTCACTCAATGGTGCACTTAATTAACAAACCCTCATCCATATACACATA 961 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TTTTTGCAACATTCACTCAATGGTGCACTTAATTAACAAACCCTCATCCATATACACATA 960 Qy 962 TTTAGAGATCAACAATATGATTATCTATCAAAAATACACAAAATCAGTGTGTGTTTGGGT 1021 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TTTAGAGATCAACAATATGATTATCTATCAAAAATACACAAAATCAGTGTGTGTTTGGGT 1020 Qy 1022 AGGCGTTGACAAAAATTAGTTTTGAATGAAATTGATTTTATAATTTTTTTTTTGTTAAAA 1081 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AGGCGTTGACAAAAATTAGTTTTGAATGAAATTGATTTTATAATTTTTTTTTTGTTAAAA 1080 Qy 1082 TTGATTTTGAAGTAATATTATTTATGTTTGGATGTTTTATTAAAAAATTAAGTTATGAAT 1141 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TTGATTTTGAAGTAATATTATTTATGTTTGGATGTTTTATTAAAAAATTAAGTTATGAAT 1140 Qy 1142 AAAATGAAGTACATAATTTTGGACCAAAAATTATTCAAAATTATTTCAACCCAAAATTAA 1201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 AAAATGAAGTACATAATTTTGGACCAAAAATTATTCAAAATTATTTCAACCCAAAATTAA 1200 Qy 1202 TTCTGTATCCAAAGTCAATTTTAAATTTTTCTTTGATGTGAAACTAAACATGTAAAAATG 1261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TTCTGTATCCAAAGTCAATTTTAAATTTTTCTTTGATGTGAAACTAAACATGTAAAAATG 1260 Qy 1262 TATTTAAATTAAAATTAATTTTAGACTTATAATTAATTCTCTGTGGTCAATCCAAATACA 1321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TATTTAAATTAAAATTAATTTTAGACTTATAATTAATTCTCTGTGGTCAATCCAAATACA 1320 Qy 1322 CACTCACACTTAGAATGTATGAAATTTCAATTTTTAACTTTCTCATCTATGAGCTGTTCC 1381 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CACTCACACTTAGAATGTATGAAATTTCAATTTTTAACTTTCTCATCTATGAGCTGTTCC 1380 Qy 1382 TATTCCTCCTTCCCCTCCTATGCCCTCACTAGGGAGCCAGCCAGCCATATTCCAAAAGCC 1441 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TATTCCTCCTTCCCCTCCTATGCCCTCACTAGGGAGCCAGCCAGCCATATTCCAAAAGCC 1440 Qy 1442 CTTATTATCACACATGGGTCCCTCCATAGTCAAAATAAAAATAATATCATGATCACTGTT 1501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CTTATTATCACACATGGGTCCCTCCATAGTCAAAATAAAAATAATATCATGATCACTGTT 1500 Qy 1502 TGGCCATAAAGAGCTATACGACACACATGGACACAGTAGTACACTGCCCAACCAATCACA 1561 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TGGCCATAAAGAGCTATACGACACACATGGACACAGTAGTACACTGCCCAACCAATCACA 1560 Qy 1562 CGTCGACAGCACACCGTTCCCAAACTACTTCACCTTTCCCAAACCAGAAACCAAAACCAC 1621 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CGTCGACAGCACACCGTTCCCAAACTACTTCACCTTTCCCAAACCAGAAACCAAAACCAC 1620 Qy 1622 TTGTCATCAAACCCCTGCCCAGATAGTTTTTCTCCATTTCAATATTTTACTTCACCTTTT 1681 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TTGTCATCAAACCCCTGCCCAGATAGTTTTTCTCCATTTCAATATTTTACTTCACCTTTT 1680 Qy 1682 GAGGCTTTGTGGGTACTACAAAACATAACACAATTGAACTCACTGTGCTTTCCCATGACA 1741 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GAGGCTTTGTGGGTACTACAAAACATAACACAATTGAACTCACTGTGCTTTCCCATGACA 1740 Qy 1742 CACATCTATACTTGTCCAGAAGAAGAAAGATCCATGAACTAACATTCCCACACGCTCGCT 1801 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CACATCTATACTTGTCCAGAAGAAGAAAGATCCATGAACTAACATTCCCACACGCTCGCT 1800 Qy 1802 TCACCATATTTGCCACCCTTTTAACCCTCACTTCTTGGGTTTATTTTGCTCCTTTTTTTT 1861 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TCACCATATTTGCCACCCTTTTAACCCTCACTTCTTGGGTTTATTTTGCTCCTTTTTTTT 1860 Qy 1862 TTCCTTGTTTGGGGTTTGCATTTTTCCTGGTTGAAAAAGGGAAGAACTTGAACTAATTGG 1921 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TTCCTTGTTTGGGGTTTGCATTTTTCCTGGTTGAAAAAGGGAAGAACTTGAACTAATTGG 1920 Qy 1922 TTAAGTTACCTATCTATCTATCTATCTAGGGTATAATATTTTATATCAGTTATTAAAGGA 1981 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTAAGTTACCTATCTATCTATCTATCTAGGGTATAATATTTTATATCAGTTATTAAAGGA 1980 Qy 1982 AAGAAAGAAAGAAACGAAG 2000 ||||||||||||||||||| Db 1981 AAGAAAGAAAGAAACGAAG 1999 10B. Response to Applicant’s arguments: Applicant’s arguments have been fully considered but are not persuasive. Percent Identity: The BLAST alignment of record shows Brower-Toland’s SEQ ID NO:53 (2001 bp, max) is 99.9% identical (1999/2000 nucleotides, 100% best local similarity, no gaps or mismatches other than a leading/trailing offset) to instant SEQ ID NO:1. This exceeds the amended 95% identity threshold of claim 1(a) and independently satisfies the “comprising SEQ ID NO:1” language of claim 1(b) in substance, since the aligned region is identical over its full length. Combination with a recombinase-encoding sequence: Applicant argues that BrowerToland’s disclosure is a “mosaic” of disjunctively listed alternatives (site-specific recombinase, nuclease, guide RNA, or agronomic transgene) and that anticipation requires the specific combination to be disclosed together, citing Net MoneyIN, Inc. v. VeriSign, Inc.,545 F.3d 1359 (Fed. Cir. 2008). The Examiner agrees with this legal standard but disagrees with its application here. As quoted in the prior action, Brower-Toland expressly and directly recites: the DNA sequence “is operably linked to a heterologous transcribable DNA sequence, and wherein said DNA sequence has promoter … activity, or wherein the heterologous transcribable DNA sequence encodes a site-specific recombinase, or wherein the site-specific recombinase is a Cre-recombinase.” This clause directly and grammatically modifies the same antecedent DNA sequence/operable-linkage limitation — it is not drawn from an unrelated list elsewhere in the reference, but is presented as a directly claimed/disclosed embodiment of the very same molecule. This is unlike Net MoneyIN, where the anticipating reference never disclosed the claimed elements in combination at all. Brower-Toland’s own claims and specification (see, e.g., claims reciting the recombinase embodiment; Examples directed to Cre/Lox excision) confirm that this combination is an actually disclosed species, not merely a prophetic possibility assembled by the Examiner from disparate passages. Difference in stated utility is not dispositive: Applicant notes that Brower-Toland’s SEQ ID NO:53 is used to alter flowering time via florigenic FT expression, whereas the instant application uses SEQ ID NO:1 to drive autoexcision. Anticipation, however, is not defeated merely because the prior art reference emphasizes a different intended use for a structurally identical composition; the claims are directed to a composition (a recombinant DNA molecule), not a method limited to a particular application, and the claims do not recite autoexcision, excision efficiency, or any developmental-stage-specific expression profile as a structural or functional limitation. In re Schreiber, 128 F.3d 1473 (Fed. Cir. 1997) (an otherwise anticipatory disclosure of structure is not avoided by attributing a different intended use to that structure). Accordingly, it is maintained that Brower-Toland et al. anticipated the claimed invention. Claim Rejections - 35 USC § 103 11A. Claim(s) 1, 2 and 5-15 are rejected under 35 U.S.C. 103 as being unpatentable over Brower-Toland et al. (US Patent Publication No. US 2018/0105819 A1 Published April 19, 2018) as applied to claims 1-7 and 9-15 above, and further in view of Cox et al. (US Patent No. 6,709,827 B2, Issued March 23, 2004) for the reasons of record stated in the Office action mailed April 27, 2026. Brower-Toland et al teach a recombinant DNA molecule comprising a DNA sequence as set forth in SEQ ID NO: 53 and having 99.9% nucleotide sequence identity and 100% similarity to instant SEQ ID NO: 1, wherein said DNA sequence is operably linked to a heterologous transcribable DNA sequence, and wherein said DNA sequence has promoter (same as gene regulatory) activity, or wherein the heterologous transcribable DNA sequence encodes a site-specific recombinase, or wherein the site-specific recombinase is a Cre-recombinase, a Flp-recombinase etc., or a recombinant DNA construct comprising said recombinant DNA molecule and comprising an expression cassette comprising a selectable marker transgene, an expression cassette encoding a site-specific nuclease, one or more expression cassettes encoding one or more guide RNAs or an expression cassette comprising a transgene of agronomic interest, or wherein the selectable marker transgene confers resistance to a herbicide or antibiotic, the transgene of agronomic interest confers herbicide tolerance in plants, or confers increased yield, or encodes a dsRNA, a miRNA, or an siRNA, or wherein the guide RNA comprises a targeting sequence that targets a sequence in the genome of a plant cell for genome editing or site-specific integration, the site-specific nuclease is an RNA-guided endonuclease, the site-specific nuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, or Csf4, or a DNA transformation vector comprising said recombinant DNA molecule or said recombinant DNA construct, having a T-DNA segment bounded by a left border and right border, or wherein said DNA transformation vector having the heterologous transcribable DNA sequence comprised in the recombinant DNA molecule encodes a site-specific recombinase and is located between the left border and the right border of the T-DNA segment, or wherein said DNA transformation vector having said expression cassette comprising a selectable marker transgene, or wherein said DNA transformation vector having the expression cassette encoding the site-specific nuclease, or wherein said DNA transformation vector having the one or more expression cassettes encoding the one or more guide RNAs, or wherein said DNA transformation vector having the transgene of agronomic interest is/are located between the left border and the right border of the T-DNA segment, or a transgenic plant, plant part or plant cell, comprising said recombinant DNA molecule, said recombinant DNA construct, or said DNA transformation vector, or wherein said transgenic plant, plant part or plant cell is from corn, soybean, cotton or canola plant species. See in particular, abstract, Figures 1-13; claims 1-43; paragraphs [0007]-[0298]; Examples 1-24; Tables 1-37. Brower-Toland et al. do not specifically teach that the recombinant DNA construct comprises pair of site-specific recombination site sequences LoxP or LOxP site having sequence of SEQ ID NO:18. Cox et al. teach site-specific recombination site sequences such as LoxP site sequence as set forth in SEQ ID NO: 1 having 100% identity to instant LoxP site sequence as set forth in SEQ ID NO: 18. See in particular, abstract, Figs. 1-6; column 6, lines 53-65. The sequence homology results are as follows: US-09-271-055A-1 (priority application of 10/072,047, issued as patent No. 6,709,829) Filing date in PALM: 1999-03-17 Sequence 1, US/09271055A Patent No. 6406847 GENERAL INFORMATION APPLICANT: David Cox APPLICANT: Malek Fahan APPLICANT: Siamak Baharloo TITLE OF INVENTION: Mismatch Repair Detection FILE REFERENCE: UCSF-127CIP CURRENT APPLICATION NUMBER: US/09/271,055A CURRENT FILING DATE: 1999-03-17 PRIOR APPLICATION NUMBER: 08/713,751 PRIOR FILING DATE: 1996-09-13 PRIOR APPLICATION NUMBER: 60/004,664 PRIOR FILING DATE: 1995-10-02 NUMBER OF SEQ ID NOS: 2 SEQ ID NO 1 LENGTH: 34 TYPE: DNA ORGANISM: lambda phage Query Match 100.0%; Score 34; Length 34; Best Local Similarity 100.0%; Matches 34; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATAACTTCGTATAGCATACATTATACGAAGTTAT 34 |||||||||||||||||||||||||||||||||| Db 1 ATAACTTCGTATAGCATACATTATACGAAGTTAT 34 Given Brower-Toland et al. teach recombinant plant transformation constructs comprising promoters, expression cassettes, and site-specific recombinases such as Cre, and Cox et al. explicitly teach LoxP site sequences with 100% identity to the claimed sequence and their use with Cre recombinase, it would have been obvious and within the scope for an ordinary skill in the art prior to earliest filing date of instantly claimed invention to incorporate the LoxP sites of Cox et al. into the Brower-Toland constructs to enable the intended Cre-mediated recombination. This is a predictable use of a known element (LoxP) for its established function with Cre recombinase, with a reasonable expectation of success. Further, selecting LoxP represents one of a finite number of well-known recombination systems (e.g., Cre-Lox), providing a clear design choice under KSR. 11B. Response to Applicant’s Arguments: Analogous art: Applicant argues Cox (mismatch-repair detection using a lambda-phagederived LoxP-like sequence) is non-analogous art because it is directed to an unrelated field. The test for analogous art, however, is not confined to the field of endeavor; a reference is analogous if it is reasonably pertinent to the particular problem faced by the inventor. In re Bigio, 381 F.3d 1320 (Fed. Cir. 2004); In re Clay, 966 F.2d 656 (Fed. Cir. 1992). The problem addressed by claims 7-8 is providing a pair of site-specific recombination sequences (e.g., LoxP) recognized by a site-specific recombinase (e.g., Cre) so that flanked DNA can be excised — precisely the general mechanism Cox teaches (a 34-nucleotide LoxP-type recombination sequence recognized for site-specific recombination). Selection of a generic, well-characterized recombination site sequence such as LoxP is not source-organism-specific; LoxP/Cre is a generic molecular tool applied across biological systems (bacterial, mammalian, and plant), and Cox is therefore reasonably pertinent. Unpredictability/unexpected results: Applicant’s data showing that Construct-1 (PGm.CALa/SEQ ID NO:1) achieved higher marker-free frequencies (5.16%/13.15%) than other tested regulatory elements (0.04%–0.69%) is not commensurate in scope with the rejected claims. Claims 1, 6, and 7 recite no functional limitation directed to autoexcision efficiency, marker-free frequency, or any particular percentage of successful excision; they are directed to the structural recombinant DNA molecule, construct, and flanking recombination sites. Unexpected results must be commensurate in scope with what is claimed to rebut a prima facie case of obviousness; evidence of superior performance in one specific embodiment does not establish nonobviousness of the broader claimed genus, which is silent as to efficiency. In re Greenfield, 571 F.2d 1185 (CCPA 1978); In re Peterson, 315 F.3d 1325 (Fed. Cir. 2003). Given that (i) Brower-Toland discloses a nearly identical promoter operably linked to a sequence encoding a site-specific recombinase, and (ii) Cox discloses the LoxP recombination sequence recognized by that same class of recombinase for its known, predictable function, it would have been obvious to a person of ordinary skill to incorporate LoxP sites into the Brower-Toland construct with a reasonable expectation of success — this represents combining known elements according to known methods to yield no more than predictable results. KSR Int’l Co. v. Teleflex Inc., 550 U.S. 398 (2007). In response to applicant’s arguments, it may be noted that, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, one ordinary skill in the art would have arrived at the instantly claimed invention by just combining the cited references as discussed above. It is important to note that the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In the instant, one of ordinary skill in the art one of ordinary skill in the art would have obviously combined the teachings of cited prior as discussed above to arrive at the Applicant’s claimed product with a reasonable expectation of success and without any surprising results. It is further important to note that KSR forecloses the argument that a specific teaching, suggestion or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, -- USPQ2d --, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396). It may be noted that obviousness does not require an absolute certainty of success but merely a reasonable expectation thereof, so long as the motivation or suggestion to combine the teaching of the cited references is known or disclosed in the prior art and is obvious to one skilled in the art and this is sufficient to establish a prima facie case of obviousness. In the instant, one of ordinary skill in the art one of ordinary skill in the art would have obviously combined the teachings of cited prior as discussed above to arrive at the Applicant’s claimed product with a reasonable expectation of success and without any surprising results. Thus, the claimed invention as a whole is prima facie obvious over the combined teachings of the prior art. Accordingly, claims 1, 2 and 5-15 remain rejected under § 103 over Brower-Toland et al. in view of Cox et al. Conclusion 12. Claims 1, 2 and 5-15 remain rejected. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to Vinod Kumar whose telephone number is (571) 272-4445. The examiner can normally be reached on 8.30 a.m. to 5.00 p.m. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A. Abraham can be reached on (571) 270-7058 The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA). /VINOD KUMAR/Primary Examiner, Art Unit 1663