Prosecution Insights
Last updated: September 29, 2026
Application No. 19/220,933

METHODS AND COMPOSITIONS FOR PLANT PATHOGEN RESISTANCE IN PLANTS

Non-Final OA §112
Filed
May 28, 2025
Priority
Nov 03, 2017 — provisional 62/581,491 +4 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
Tech Center
Assignee
University of Florida Research Foundation Inc.
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
1y 6m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
392 granted / 543 resolved
+12.2% vs TC avg
Strong +21% interview lift
Without
With
+21.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
27 currently pending
Career history
566
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
31.7%
-8.3% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
36.1%
-3.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 543 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The Information Disclosure Statements filed on 9/29/2025 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action. Status of claims Claims 1-18 are pending and examined in the office action. Priority Instant application 19220933, filed 05/28/2025, is a Divisional of 18089985, filed 12/28/2022, now U.S. Patent # 12344854. 18089985 is a Divisional of 16761409, filed 05/04/2020, now U.S. Patent # 11634725. 16761409 is a National Stage entry of PCT/US2018/059269, International Filing Date: 11/05/2018. PCT/US2018/059269 Claims Priority from Provisional Application 62581491, filed 11/03/2017, and Provisional Application 62627496, filed 02/07/2018. 62627496 and 62581491 disclosed the instant claimed subject matter including SDE Las4025 and PP2-B2. 62581491 disclosed SEQ ID NO: 31 but not SEQ ID NO: 30 (7810 bp). Neither 62627496 nor 62581491 disclosed SEQ ID NO: 30 (7810 bp). PCT/US2018/059269 disclosed SEQ ID NO: 30 (7810 bp). Thus, 11/03/2017 is recognized as the priority date of claims 1-2, 4-18. 11/05/2018 is recognized as the priority date of claim 3. Claim Objections Claim 1 is objected to because of the following informalities: In line 5, the article of “an SDE” appears to be a wrong article. Since in line 2, the “a Sec-dependent effector (SDE)” uses wrong article “an”, it is suggested to change the “an SDE” in line 5 to –the SDE--. In line 7, the “PP2” appears in a claim for the first time, the full name should be recited, followed by the abbreviation in a (). See the specification ([0195]). In lines 8-11, the article “;” in line 8 is wrong. It is suggested to be changed to ---:---. Lines 8-11 should read: --- endogenous gene comprising: insertion of at least 1 nucleotide, a deletion of at least 1 nucleotide, and/or a substitution of at least 1 nucleotide ---. See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate correction is required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1 and 10 and dependent claims 2-9, 11-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claims 1 and 10 recite a term “PP2-B2/12” without a full name. According to the specification ([0195]), PP2 is the abbreviation of Phloem protein 2. According to the According to the specification ([0183], Table 1B), “PP2-B2/12” is “orange 1.1t04174”. According to www.uniprot.org/uniprotkb/Q9ZVR5/entry, “PP2-B2” refers to “Phloem protein 2-LIKE B2”, or “Putative F-box protein PP2-B2”. Accordingly, the metes and bounds of “PP2-B2” is reasonably clear. However, the specification does not define “PP2-B2/12”. In fact, the specification does not even use a full name of “PP2-B2/12”. The specification only discloses that SEQ ID NO: 30 is PP2-B2/12 orange 1.1t04174 gene sequence from Citrus sinensis cultivar Valencia; and SEQ ID NO:31 is PP2-B2/12 orange 1.1t04174 cDNA sequence from Citrus sinensis cultivar Valencia ([0049]-[0050]). In the art, there is no definition or description of “PP2-B2/12”, or “orange 1.1t04174”. In another word, “PP2-B2/12” or “orange 1.1t04174” is not searchable in the art, not only prior art. Therefore, “PP2-B2/12” is not an art recognized name or term. One skill in the art does not know how to modify the “PP2-B2/12” gene as claimed, thus, cannot make and use the claimed invention. Appropriate correction and clarification are required. Dependent claims do not cure the deficiency, thus, are included. Since SEQ ID NOs: 30 and 31 are genomic DNA and cDNA sequences of “PP2-B2/12” and are the only sequences of “PP2-B2/12” in the specification and in the art, it is suggested to recite the SEQ ID NOs in a wherein clause, to overcome the rejection. For compact prosecution, by BRI, “PP2-B2/12” is interpreted as a genus of proteins, more than just that encoded by SEQ ID NO: 30 or 31. For compact prosecution, by BRI, “PP2-B2” (broader than “PP2-B2/12”) is examined for merits. SEQ ID NOs: 30 and 31 (the only known “PP2-B2/12”, narrower than “PP2-B2/12”) are also examined for merits. Failing to further limit parent claim(s) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The claim depends on claim 1, and recites that wherein the modification is made to at least one of SEQ ID NO: 30, 31, or a sequence comprising at least 95% identity therewith. However, claim 1 recites that wherein the endogenous gene encodes PP2-B2/12 and the modification comprises a modification to the endogenous gene. According to the specification ([0050]), SEQ ID NO:31 is PP2-B2/12 orange 1.1t04174 cDNA sequence from Citrus sinensis cultivar Valencia. A cDNA is not endogenous. Thus, SEQ ID NO: 31, a cDNA, is outside of the scope of claim 1. The applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Lacking written description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claim 1-18 are rejected under 35 U.S.C. 112(a), as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. To claim a genus under the written description requirement, the applicant is required to describe a representative number of species to reflect the variation within the genus or structures sufficient to define the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combinations thereof. By court’s statement in Regents of the Univ. of Cal. v. Eli Lilly, 119 F.3d 1559, 1566, 43 USPQ2d 1398, 1404 (Fed. Cir. 1997), a written description of an invention “requires a precise definition, such as a structure, formula, or chemical name, of the claimed subject matter sufficient to distinguish it from other materials”; further, a written description of a claimed genus requires a description of a representative number of species of the claimed genus, and one of skill in the art should be able to “visualize or recognize the identity of the members of the genus”. Claim 1 is broadly drawn to a genus of plants comprising plant cells comprising modifications to a genus of endogenous genes (encoding PP2-B2/12), wherein the polypeptide encoded by the endogenous gene interacts with a genus of Sec-dependent effectors (SDEs) secreted by a bacterial species from the genus Ca. Liberibacter, Claim 10 is broadly drawn to methods comprising the steps of: (a) modifying a genus of PP2-B2/12 genes of a citrus plant cell such that expression of the PP2-B2/12 genes are knocked-down or reduced and/or interaction of the polypeptide encoded by said PP2- B2/12 genes with a genus of Sec-dependent effectors (SDEs) secreted by a bacteria species from the genus Ca. Liberibacter is reduced; and (b) regenerating the modified plant from said plant cell or a progenitor cell thereof, wherein said the plant comprises said modification. The claimed functions are that (1) the modifications knock-down or reduce expression of the endogenous gene and/or interrupts interaction of the polypeptide with the SDEs, and (2) the modifications lead to conferring resistance or tolerance to Ca Liberibacter infection in the plants. What are described: According to the specification ([0012] and [0020]), CLIBASIA_04025 is also called Las4025 and SDE15. According to the specification ([0049]-[0050]), SEQ ID NO: 30 is PP2-B2/12 orange 1.1t04174 gene sequence from Citrus sinensis cultivar Valencia; SEQ ID NO:31 is PP2-B2/12 orange 1.1t04174 cDNA sequence from Citrus sinensis cultivar Valencia. The specification describes the structures of SEQ ID NO: 30-31 by providing sequence information. The specification also describes that PP2-B2/12 (orange 1.1t04174) is one of the target proteins of CLIBASIA_04025 (Las4025, SDE15) (Example 2, Table 1B in page 56). According to the specification (Example 2, [0184]-[0185], and Figure 2), CLIBASIA_04025 (Las4025, SDE15) was demonstrated and confirmed to interact with PP2-B2 (orange 1.1t04174), a phloem protein, not with other targeted proteins. Thus, the specification only describes the protein encoded by SEQ ID NO: 30 or 31 is interacted with SDE 15/Las4025. The specification describes that over-expression of SDE15, a Sec-dependent effector from Ca. Liberibacter, caused infection in Nicotiana tabacum and Citrus and HLB-like symptoms (Example 5, [0194]), and that Las4025/SDE15 suppresses programed cell death (PCD) and promotes Las (Ca. Liberibacter) growth in plants infected by Ca. Liberibacter (Example 7, [0198]-[0200]). The specification does not have examples of modifying any endogenous gene including SEQ ID NO: 30 or 31. Thus, at best, the specification describes the protein encoded by SEQ ID NOs: 31, and the interaction of the encoded protein with Las4025/SDE15. Knocking-down or reducing expression of SEQ ID NO: 30 or 31, or interrupting the interaction of SEQ ID NO: 30 or 31 with Las4025 may lead to the function of conferring resistance to Ca. Liberibacter in the plants infected by Ca. Liberibacter. Please note that SEQ ID NO: 30 is an endogenous sequence of Citrus sinensis cultivar Valencia, and SEQ ID NO: 17 is a cDNA sequence from Citrus sinensis cultivar Valencia. In another word, the interaction of encoded protein by SEQ ID NO: 30 or 31 (in Citrus plant only), with Las4025/SDE15, and the resistance to Ca. Liberibacter by such interaction, are deemed reasonably described. What are not described: (1) The specification does not describe any modification of genus of endogenous genes encoding “PP2-B2/12”. As analyzed above, by BRI, “PP2-B2/12” is interpreted as a genus of proteins, more than just that encoded by SEQ ID NO: 30 or 31. The specification does not describe the common structure feature of the genus “PP2-B2/12”, the modification thereof, not to mention the function related to resistance or susceptibility to Ca. Liberibacter; (2) The specification does not describe the genus of interactions of genus of SDEs (except SDE15/Las4025) with the protein encoded by modified SEQ ID NO: 30 or 31. In the art, CLIBASIA_04025 (Las4025) has been characterized. See “Remarks” below. However, the art does not describe any interaction with any endogenous plant gene to be associated to resistance or susceptibility to Ca. Liberibacter. Pang et al (Citrus CsACD2 Is a Target of Candidatus Liberibacter Asiaticus in Huanglongbing Disease. Plant Physiology, Vol. 184, pp. 792–805, 2020, not prior art) suggest that the SDE15 suppression of plant immunity is CsACD2-dependent (p799, left col, 1st para), and that Cs1g22670 is potentially involved in plant immunity (p796, left col, 1st para). Thus, in 2020, the art had not described any modification to the endogenous gene including SEQ ID NO: 30 or 31, not to mention the association to resistance to infection of Ca. Liberibacter; and (3) Since SEQ ID NO: 30 is an endogenous sequence of Citrus sinensis cultivar Valencia, SEQ ID NO: 17 is a cDNA sequence from Citrus sinensis cultivar Valencia. By sequence search, no plants other than citrus comprise SEQ ID NO: 30 or 31. Thus, the genus of plants are not described (except in Citrus plant). The claimed interaction is a new interaction, which has not been described in the art. Regarding the description of a representative number of species Pang et al (2020) teach that there have identified 86 putative SDE proteins with functional Sec-dependent secretion signal peptides in Ca Liberibacter (p794, left col, 1st para). As research and development progress, more SDEs can be disclosed. As analyzed above, the “PP2-B2/12” is not art recognized. The exact scope of the “PP2-B2/12” is also unclear. How many species in the genus is not known. According to How many plant species are there in the world? Scientists now have an answer, there are about 391,000 species of vascular plants currently known to science, of which about 369,000 species (or 94 percent) are flowering plants, according to a report by the Royal Botanic Gardens, Kew, in the United Kingdom. About 2,000 new plant species are discovered or described every year, many of which are already on the verge of extinction. In sum, the number of interactions between the SDEs and modified “PP2-B2/12”s is an extremely large number. The specification does not provide a single example of the claimed modification nor interaction, not to mention a representative number of modifications or interactions to represent the genus of modifications or interactions, thus does not provide any structure feature not to mention common structure feature of the genus of modifications and interactions associated to the claimed conferring resistance to Ca. Liberibacter infection. Therefore, the application has not met either of the two elements of the written description requirement as set forth in the court’s decision in Eli Lilly, and has not shown her/his possession of the claimed genus at the time of the application. Remarks Prior art does not disclose full length sequences of SEQ ID NO: 30 or 31. See “Sequence Matches” at the end of office action. Prior art does not teach or suggest the interaction of SDE with any plant modified endogenous gene(s), not to mention for the resistance or tolerance to Ca Liberibacter infection in the plants. The closest sequence matches are provided below: Dinant et al (Diversity of the Superfamily of Phloem Lectins (Phloem Protein 2) in Angiosperms. Plant Physiology, 131, pp. 114–128, 2003). The reference teaches PP2-B2 (p120, Table II), however does not teach SDE, nor the interaction. Pitino et al (Transient Expression of Candidatus Liberibacter Asiaticus Effector Induces Cell Death in Nicotiana benthamiana. Frontiers in Plant Science, p1-13, 2016). The reference teaches CLIBASIA_04025 (p4, Table 1, right col, 1st para), however does not teach modifying plant endogenous gene(s), nor the interaction. Wang et al (US 20160227774, published 8/11/2016, filed 2/8/2016, now abandoned). The reference teaches PP2 ([0115], Table 1; [0123], [0131]), and teach Ca Liberibacter resistance in plants (Abstract; claim 12), however does not teach the subject of SDE, nor the interaction of SDE with any endogenous gene(s). US patent 11634725 and 12344854, by Wang et al of University of Florida, is not rejected for double patenting, because they claim the subject matter of SDE15, however the interaction of SDE15 with different endogenous proteins. US patent 12344854, by Wang et al of University of Florida, is not rejected for double patenting, because they claim the subject matter of SDE15/Las4025, however the interaction of SDE15 with different endogenous proteins. Sequence Matches Against instant SEQ ID NO: 30 (genomic DNA) Against polynucleotides LOCUS XM_024185079 879 bp mRNA linear PLN 26-FEB-2018 DEFINITION PREDICTED: Citrus clementina putative F-box protein PP2-B12 (LOC18041970), mRNA. ACCESSION XM_024185079 VERSION XM_024185079.1 DBLINK BioProject: PRJNA232045 KEYWORDS RefSeq. SOURCE Citrus x clementina ORGANISM Citrus x clementina Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Aurantioideae; Citrus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006262201.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Citrus clementina Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..879 /organism="Citrus x clementina" /mol_type="mRNA" /cultivar="Clemenules" /db_xref="taxon:85681" /chromosome="Unknown" gene 1..879 /gene="LOC18041970" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 9% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:18041970" CDS 1..879 /gene="LOC18041970" /codon_start=1 /product="putative F-box protein PP2-B12" /protein_id="XP_024040847.1" Score Expect Identities Gaps Strand 1363 bits(738) 0.0 744/747(99%) 0/747(0%) Plus/Plus Query 7064 CTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGCGATGCAAGTAGG 7123 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 133 CTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGCGATGCAAGTAGG 192 Query 7124 TTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATGGGAGAAG 7183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 193 TTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATGGGAGAAG 252 Query 7184 TTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATCGACAGGAAGAAG 7243 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 253 TTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATCGACAAGAAGAAG 312 Query 7244 AAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATACCGCGAGC 7303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 313 AAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATACCGCGAGC 372 Query 7304 TTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCAAAATGGATTTAT 7363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 373 TTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCAAAATGGATTTAT 432 Query 7364 GAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCAGCTGGATCTAGG 7423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 433 GAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCAGCTGGATCTAGG 492 Query 7424 TTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATCGAAGCAAGATTTGGT 7483 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 493 TTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATCGAAGCAAGATTTGGT 552 Query 7484 ACAACAATTTTTTCACCCAAAACCAATTATGCAGCTTACTTTGTGTTCAAGTTTGCGGAA 7543 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct 553 ACAACAATTTTTTCACCCAAAACCAATTATGCCGCTTACTTTGTGTTCAAGTTTGCGGAA 612 Query 7544 TTCAGAGAAGGGCCTGAAACTAGTCCTATAGATTTTGAAGTCTATTTTGAGGGAAGCCAT 7603 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 613 TTCAGAGAAGGGCCTGAAACTAGTCCTATAGATTTTGAAGTCTATTTTGATGGAAGCCAT 672 Query 7604 AATGGCAAAAAGCGTAGAGAGTTTCTTGATCCTCAACTATCTCAAGACCGAGGAAATAGG 7663 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 673 AATGGCAAAAAGCGTAGAGAGTTTCTTGATCCTCAACTATCTCAAGACCGAGGAAATAGG 732 Query 7664 TGGATAGAGATTAAGATGGGTGAGTTCTCTATTGAAAATGGAGATGAAGGAACAGTAGTT 7723 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 733 TGGATAGAGATTAAGATGGGTGAGTTCTCTATTGAAAATGGAGATGAAGGAACAGTAGTT 792 Query 7724 TGTAGGCTGTCCGAACCAGAACCCTTATCTAAGCGTGGCACTATTATTTTCCAAGGTATT 7783 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 793 TGTAGGCTGTCCGAACCAGAACCCTTATCTAAGCGTGGCACTATTATTTTCCAAGGTATT 852 Query 7784 GAGGTTAGGCCTGAATATGGCAGGTAA 7810 ||||||||||||||||||||||||||| Sbjct 853 GAGGTTAGGCCTGAATATGGCAGGTAA 879 Range 2: 1 to 72GenBankGraphicsNext MatchPrevious MatchFirst Match Alignment statistics for match #2 Score Expect Identities Gaps Strand 128 bits(69) 1e-23 71/72(99%) 0/72(0%) Plus/Plus Query 5860 ATGAGCTCTTACGGCCAGAAAACTAAGCCAGGACGGCAAAGGCTTAAGCGAAAAGAATAC 5919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGAGCTCTTACGGCCAGAAAACTAAGCCAGGACGGCAAAGGCTTAAGCGAAAAGAATAC 60 Query 5920 ATTTGGCCAGGT 5931 |||| ||||||| Sbjct 61 ATTTTGCCAGGT 72 Range 3: 69 to 136GenBankGraphicsNext MatchPrevious MatchFirst Match Alignment statistics for match #3 Score Expect Identities Gaps Strand 115 bits(62) 1e-19 66/68(97%) 0/68(0%) Plus/Plus Query 6611 aggttctGAGGTGATTGGTGAGAGTGGTTCGATTCTTACTTATCAAAAGAAAAAACTCGA 6670 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 69 AGGTTCTGAGGTGATTGGTAAGAGTGGTTCGATTCTTACTTATCAAAAGAAAAAACTCGA 128 Query 6671 AGATGTAC 6678 |||| ||| Sbjct 129 AGATCTAC 136 RESULT 1 EY873597 LOCUS EY873597 995 bp mRNA linear EST 31-JAN-2012 DEFINITION CL06-C4-501-019-H02-CT.F Rangpur lime root, plant with hydric stress Citrus limonia cDNA, mRNA sequence. ACCESSION EY873597 VERSION EY873597.1 DBLINK BioSample: SAMN00154576 KEYWORDS EST. SOURCE Citrus limonia (Rangpur lime) ORGANISM Citrus limonia Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Aurantioideae; Citrus. REFERENCE 1 (bases 1 to 995) AUTHORS Machado,M.A., Takita,M.A., Amaral,A.M., Basilio-Palmieri,A.C., Bastianel,M., Berger,I.J., Boscariol-Camargo,R.L., Carlos,E.F., Coletta-Filho,H.D., Cristofani-Yaly,M., Freitas-Astua,J., Locali-Fabris,E.C., Novelli,V.M., Palmieri,D.A., Peroni,L., Silva-Pinhati,A.C.O., Souza,A.A., Stach-Machado,D.R., Targon,M.L.N.P. and Reis,M.S. TITLE Global analysis of Citrus Expression JOURNAL Unpublished COMMENT Contact: Reis MS Centro APTA Citros Sylvio Moreira Agronomic Institute of Campinas Rod. Anhanguera Km 158, CEP 13490-970, Box 4, Cordeiropolis, Brazil Tel: 55 19 3546 1399 Fax: 55 19 3546 1399 Email: marcelo.reis\@gmail.com. FEATURES Location/Qualifiers source 1..995 /organism="Citrus limonia" /mol_type="mRNA" /db_xref="taxon:171249" /tissue_type="root" /clone_lib="SAMN00154576 Rangpur lime root, plant with hydric stress" ORIGIN Query Match 9.2%; Score 719.4; Length 995; Best Local Similarity 98.4%; Matches 737; Conservative 0; Mismatches 11; Indels 1; Gaps 1; Qy 7063 GCTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGCGATGCAAGTAG 7122 || || |||||||||||||||| |||||||||||||||||||||||||| ||||||||| Db 5 GCGTCCGGCAAAGTGCATTTCGCTCATCATTTCTCTTACGACACCTCGCGCTGCAAGTAG 64 Qy 7123 GTTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATGGGAGAA 7182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 65 GTTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATGGGAGAA 124 Qy 7183 GTTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATCGACAGGAAGAA 7242 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 125 GTTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATCGACAAGAAGAA 184 Qy 7243 GAAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATACCGCGAG 7302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 185 GAAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATACCGCGAG 244 Qy 7303 CTTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCAAAATGGATTTA 7362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 245 CTTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCAAAATGGATTTA 304 Qy 7363 TGAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCAGCTGGATCTAG 7422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 305 TGAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCAGCTGGATCTAG 364 Qy 7423 GTTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATCGAAGCAAGATTTGG 7482 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 365 GTTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATCGAAGCAAGATTTGG 424 Qy 7483 TACAACAATTTTTTCACCCAAAACCAATTATGCAGCTTACTTTGTGTTCAAGTTTGCGGA 7542 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Db 425 TACAACAATTTTTTCACCCAAAACCAATTATGCCGCTTACTTTGTGTTCAAGTTTGCGGA 484 Qy 7543 ATTCAGAGAAGGGCCTGAAACTAGTCCTATAGATTTTGAAGTCTATTTTGAGGGAAGCCA 7602 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 485 ATTCAGAGAAGGGCCTGAAACTAGTCCTATAGATTTTGAAGTCTATTTTGAGGGAAGCCA 544 Qy 7603 TAATGGCAAAAAGCGTAGAGAGTTTCTTGATCCTCAACTATCTCAAGACCGAGGAAATAG 7662 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 545 TAATGGCAAAAAGCGTAGAGAGTTTCTTGATCCTCAACTATCTCAAGACCGAGGAAATAG 604 Qy 7663 GTGGATAGAGATTAAGATGGGTGAGTTCTCTATTGAAAATGGAGATGAAGGAACAGTAGT 7722 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 605 GTGGATAGAGATTAAGATGGGTGAGTTCTCTATTGAAAATGGAGATGAAGGAACAGTAGT 664 Qy 7723 TTGTAGGCTGTCCGAACCAGAACCCTTATCTAAGCGTGGCACTATTATTTTCCAAGGTAT 7782 ||||||||||||||||||||||||||| ||||||||||||||| ||||||| | |||||| Db 665 TTGTAGGCTGTCCGAACCAGAACCCTTTTCTAAGCGTGGCACTTTTATTTTTCCAGGTAT 724 Qy 7783 TGAGGTTAGG-CCTGAATATGGCAGGTAA 7810 |||||||||| |||||||||||||||||| Db 725 TGAGGTTAGGCCCTGAATATGGCAGGTAA 753 Against polypeptides RESULT 4 V4SBU7_CITCL ID V4SBU7_CITCL Unreviewed; 295 AA. AC V4SBU7; DT 22-JAN-2014, integrated into UniProtKB/TrEMBL. DT 22-JAN-2014, sequence version 1. DT 28-JAN-2026, entry version 30. DE RecName: Full=F-box domain-containing protein {ECO:0000259|PROSITE:PS50181}; GN ORFNames=CICLE_v10003407mg {ECO:0000313|EMBL:ESR45048.1}; OS Citrus clementina (Clementine) (Citrus deliciosa x Citrus sinensis). OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; OC Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; OC rosids; malvids; Sapindales; Rutaceae; Aurantioideae; Citrus. OX NCBI_TaxID=85681 {ECO:0000313|EMBL:ESR45048.1, ECO:0000313|Proteomes:UP000030687}; RN [1] {ECO:0000313|EMBL:ESR45048.1, ECO:0000313|Proteomes:UP000030687} RP NUCLEOTIDE SEQUENCE. RC STRAIN=cv. Clemenules {ECO:0000313|Proteomes:UP000030687}; RG International Citrus Genome Consortium; RA Jenkins J., Schmutz J., Prochnik S., Rokhsar D., Gmitter F., Ollitrault P., RA Machado M., Talon M., Wincker P., Jaillon O., Morgante M.; RL Submitted (OCT-2013) to the EMBL/GenBank/DDBJ databases. CC --------------------------------------------------------------------------- CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms CC Distributed under the Creative Commons Attribution (CC BY 4.0) License CC --------------------------------------------------------------------------- DR EMBL; KI536799; ESR45048.1; -; Genomic_DNA. DR AlphaFoldDB; V4SBU7; -. DR STRING; 85681.V4SBU7; -. DR Gramene; ESR45048; ESR45048; CICLE_v10003407mg. DR KEGG; cic:CICLE_v10003407mg; -. DR eggNOG; ENOG502QTAJ; Eukaryota. DR InParanoid; V4SBU7; -. DR Proteomes; UP000030687; Unassembled WGS sequence. DR CDD; cd22162; F-box_AtSKIP3-like; 1. DR Gene3D; 1.20.1280.50; -; 1. DR InterPro; IPR036047; F-box-like_dom_sf. DR InterPro; IPR001810; F-box_dom. DR InterPro; IPR025886; PP2-like. DR PANTHER; PTHR32278; F-BOX DOMAIN-CONTAINING PROTEIN; 1. DR PANTHER; PTHR32278:SF144; F-BOX PROTEIN PP2-B12 ISOFORM X1; 1. DR Pfam; PF12937; F-box-like; 1. DR Pfam; PF14299; PP2; 1. DR SMART; SM00256; FBOX; 1. DR SUPFAM; SSF81383; F-box domain; 1. DR PROSITE; PS50181; FBOX; 1. PE 4: Predicted; KW Reference proteome {ECO:0000313|Proteomes:UP000030687}. FT DOMAIN 39..85 FT /note="F-box" FT /evidence="ECO:0000259|PROSITE:PS50181" SQ SEQUENCE 295 AA; 33501 MW; 096050317F321F79 CRC64; Alignment Scores: Length: 295 Score: 1308.00 Matches: 265 Percent Similarity: 67.2% Conservative: 3 Best Local Similarity: 66.4% Mismatches: 1 Query Match: 9.8% Indels: 131 Gaps: 1 US-19-220-933-30 (1-7810) x V4SBU7_CITCL (1-295) Qy 6612 GGTTCTGAGGTGATTGGTGAGAGTGGTTCGATTCTTACTTATCAAAAGAAAAAACTCGAA 6671 ||||||||||||||||||:::||||||||||||||||||||||||||||||||||||||| Db 24 GlySerGluValIleGlyLysSerGlySerIleLeuThrTyrGlnLysLysLysLeuGlu 43 Qy 6672 GATGT-ACGAATTTGAGCTCTTTCTATTATTGATATTAGATACATGTCATTTACAAATTT 6730 ||| Db 44 AspLeu------------------------------------------------------ 45 Qy 6731 TTACCACTATGATTAAATCTATTTTTGATTTTCAGATTGGTTAGTAGTAATAAATATCCC 6790 Db 45 ------------------------------------------------------------ 45 Qy 6791 AAAATTTTATCCAAAAATAATTGGGCATGTGATGTATGATTCATCAAAATAGTTGATAAA 6850 Db 45 ------------------------------------------------------------ 45 Qy 6851 TCTTATAGGTCCCAAGTAAATTAGTTATAATATTTCACTATCCAAACAAATACTACATCA 6910 Db 45 ------------------------------------------------------------ 45 Qy 6911 TTTAGGATCAAAGTTTGGGATAGGAAAAAAAAATATTTTGCTTGAAAATTATTTTTGATT 6970 Db 45 ------------------------------------------------------------ 45 Qy 6971 TTGTCCAGTCGGGTATAATTTTCGGACACTGTTGTAGTGCTCTTTGTGATGTATTTTGAG 7030 Db 45 ------------------------------------------------------------ 45 Qy 7031 ATAAATTCAGTACATTGTCTTACATTTGTGCAGCTACCTGCAAAGTGCATTTCGCGCATC 7090 |||||||||||||||||||||||| Db 46 ------------------------------------ProAlaLysCysIleSerArgIle 53 Qy 7091 ATTTCTCTTACGACACCTCGCGATGCAAGTAGGTTGGCACTGGTATGTCCCGCCTTCAGA 7150 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 54 IleSerLeuThrThrProArgAspAlaSerArgLeuAlaLeuValCysProAlaPheArg 73 Qy 7151 TCGGCTGCGGATTCAGATTCCGTATGGGAGAAGTTTTTGCCGTCCGATTACGAAGGGTTC 7210 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 74 SerAlaAlaAspSerAspSerValTrpGluLysPheLeuProSerAspTyrGluGlyPhe 93 Qy 7211 ATTTCGAACTCATCTTTGATCGACAGGAAGAAGAAGGATCTTTATTTTCATCTATGTCGC 7270 ||||||||||||||||||||||||:::||||||||||||||||||||||||||||||||| Db 94 IleSerAsnSerSerLeuIleAspLysLysLysLysAspLeuTyrPheHisLeuCysArg 113 Qy 7271 AACCCCATCCTCTTCGACAATAATACCGCGAGCTTTGGGCTAGAGCAAGAGAGTGGTAAA 7330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 114 AsnProIleLeuPheAspAsnAsnThrAlaSerPheGlyLeuGluGlnGluSerGlyLys 133 Qy 7331 AAATGTTACATGGCTGGTGCAAAATGGATTTATGAAAATTCGGGAATTTCACACCGAGAT 7390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 134 LysCysTyrMetAlaGlyAlaLysTrpIleTyrGluAsnSerGlyIleSerHisArgAsp 153 Qy 7391 TGCGAAATGATTCCTTCATCAGCTGGATCTAGGTTTCCTGAAGTGATTGAACTTAAGCTT 7450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 154 CysGluMetIleProSerSerAlaGlySerArgPheProGluValIleGluLeuLysLeu 173 Qy 7451 ATGTCGAGTTTAGAAATCGAAGCAAGATTTGGTACAACAATTTTTTCACCCAAAACCAAT 7510 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 174 MetSerSerLeuGluIleGluAlaArgPheGlyThrThrIlePheSerProLysThrAsn 193 Qy 7511 TATGCAGCTTACTTTGTGTTCAAGTTTGCGGAATTCAGAGAAGGGCCTGAAACTAGTCCT 7570 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 194 TyrAlaAlaTyrPheValPheLysPheAlaGluPheArgGluGlyProGluThrSerPro 213 Qy 7571 ATAGATTTTGAAGTCTATTTTGAGGGAAGCCATAATGGCAAAAAGCGTAGAGAGTTTCTT 7630 |||||||||||||||||||||:::|||||||||||||||||||||||||||||||||||| Db 214 IleAspPheGluValTyrPheAspGlySerHisAsnGlyLysLysArgArgGluPheLeu 233 Qy 7631 GATCCTCAACTATCTCAAGACCGAGGAAATAGGTGGATAGAGATTAAGATGGGTGAGTTC 7690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 234 AspProGlnLeuSerGlnAspArgGlyAsnArgTrpIleGluIleLysMetGlyGluPhe 253 Qy 7691 TCTATTGAAAATGGAGATGAAGGAACAGTAGTTTGTAGGCTGTCCGAACCAGAACCCTTA 7750 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 254 SerIleGluAsnGlyAspGluGlyThrValValCysArgLeuSerGluProGluProLeu 273 Qy 7751 TCTAAGCGTGGCACTATTATTTTCCAAGGTATTGAGGTTAGGCCTGAATATGGCAGG 7807 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 274 SerLysArgGlyThrIleIlePheGlnGlyIleGluValArgProGluTyrGlyArg 292 Against instant SEQ ID NO: 31 (cDNA) Against polynucleotides RESULT 1 EY819057 LOCUS EY819057 900 bp mRNA linear EST 15-MAY-2008 DEFINITION PT11-C1-901-005-A07-CT.F Poncirus trifoliata leaf, infected with CTV Citrus trifoliata cDNA, mRNA sequence. ACCESSION EY819057 VERSION EY819057.1 DBLINK BioSample: SAMN00154600 KEYWORDS EST. SOURCE Citrus trifoliata (trifoliate orange) ORGANISM Citrus trifoliata Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Aurantioideae; Citrus. REFERENCE 1 (bases 1 to 900) AUTHORS Machado,M.A., Takita,M.A., Amaral,A.M., Basilio-Palmieri,A.C., Bastianel,M., Berger,I.J., Boscariol-Camargo,R.L., Carlos,E.F., Coletta-Filho,H.D., Cristofani-Yaly,M., Freitas-Astua,J., Locali-Fabris,E.C., Novelli,V.M., Palmieri,D.A., Peroni,L., Silva-Pinhati,A.C.O., Souza,A.A., Stach-Machado,D.R., Targon,M.L.N.P. and Reis,M.S. TITLE Global analysis of Citrus Expression JOURNAL Unpublished COMMENT Contact: Reis MS Centro APTA Citros Sylvio Moreira Agronomic Institute of Campinas Rod. Anhanguera Km 158, CEP 13490-970, Box 4, Cordeiropolis, Brazil Tel: 55 19 3546 1399 Fax: 55 19 3546 1399 Email: marcelo.reis\@gmail.com. FEATURES Location/Qualifiers source 1..900 /organism="Citrus trifoliata" /mol_type="mRNA" /db_xref="taxon:37690" /tissue_type="leaf" /clone_lib="SAMN00154600 Poncirus trifoliata leaf, infected with CTV" ORIGIN Query Match 58.3%; Score 836; Length 900; Best Local Similarity 97.5%; Matches 870; Conservative 0; Mismatches 20; Indels 2; Gaps 2; Qy 201 GCTTCAACGAAAGGAAAAAATTTGGCCAGGATCTGAAGAGGTAATTGGTGACGGTTGTCA 260 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 11 GCTTCAACGAAAGGAAAAAATTTGGCCAGGTTCTGAAGAGGTAATTGGTGACGGTTGTCA 70 Qy 261 TGTTTCGATTCGTACGGAAACTAGGAAAAAACTTAAAGATATTCGCGGAAACAATCCATA 320 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 71 TGTTTCGATTCGTACGGAAACTAAGAAAAAACTTAAAGATATTCGCGGAAACAATCCATA 130 Qy 321 CCCAGGATCCATGGTCAAGGATAAAGCAAAAGAAATTGTTGATGACAATAAGGAAACAGT 380 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | Db 131 CCCAGGATCCAGGGTCAAGGATAAAGCAAAAGAAATTGTTGATGACAATAAGGAAACATT 190 Qy 381 TGCTAATTCAATTAGTGAAGGCTTTGAAGTGATTGGCGACGAGACAAGCTCTATCAACCA 440 |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Db 191 TGCTGATTCAATTAGTGAAGGCTTTGAAGTGATTGGCGACGAGACAAGGTCTATCAACCA 250 Qy 441 AGAAATTAGGCCACGACGACAAAGGCTTCAGCGAAACGGAAACATTTGGCCAGGCTCTGA 500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 251 AGAAATTAGGCCACGACGACAAAGGCTTCAGCGAAACGGAAACATTTGGCCAGGCTCTGA 310 Qy 501 GGTGATTGTTGACGATGTTCAAGATTCGGTTCCTGTGGATTCTGGGACCAACAATATGAG 560 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 311 GGTGATTGTTGACGATGTTCAAGATTCGGTTCCTGTGGATTCTGGGACCAACAATTTGAA 370 Qy 561 CTCTTACGGCCAGAAAACTAAGCCAGGACGGCAAAGGCTTAAGCGAAAAGAATACATTTG 620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 371 CTCTTACGGCCAGAAAACTAAGCCAGGACGGCAAAGGCTTAAGCGAAAAGAATACATTTG 430 Qy 621 GCCAGGTTCTGAGGTGATTGGTGAGAGTGGTTCGATTCTTACTTATCAAAAGAAAAAACT 680 |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 431 GCCAGGTTATGAGGTGATTGGTGAGAGTGGTTCGATTCTTACTTATCAAAAGCAAAAACT 490 Qy 681 CGAAGATCTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGCGATGC 740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 491 CGAAGATCTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGCGATGC 550 Qy 741 AAGTAGGTTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATG 800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 551 AAGTAGGTTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCCGTATG 610 Qy 801 GGAGAAGTTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATCGACAG 860 |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| Db 611 GGAGAAGTTTTTGCCGTCCGATTACGAAAGGTTCATTTCCAACTCATCTTTGATCGACAA 670 Qy 861 GAAGAAGAAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATAC 920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 671 GAAGAAGAAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAATAATAC 730 Qy 921 CGCGAGCTTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCAAAATG 980 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Db 731 CGCGAGCTTTGGGCTAGAGCAAGAGAGTGGT-AAAAATGTTACATGGCTGGTGCAAAATG 789 Qy 981 GATTTATGAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCAGCTGG 1040 |||||||||||||||||| |||||||||||||| |||||||||||| |||| |||||||| Db 790 GATTTATGAAAATTCGGGGATTTCACACCGAGAATGCGAAATGATT-CTTCCTCAGCTGG 848 Qy 1041 ATCTAGGTTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATC 1092 ||||||||||| ||||||| |||||||||||||| |||||||||||||||| Db 849 ATCTAGGTTTCTTGAAGTGGATGAACTTAAGCTTAAGTCGAGTTTAGAAATC 900 Against polypeptides RESULT 5 V4SBU7_CITCL ID V4SBU7_CITCL Unreviewed; 295 AA. AC V4SBU7; DT 22-JAN-2014, integrated into UniProtKB/TrEMBL. DT 22-JAN-2014, sequence version 1. DT 28-JAN-2026, entry version 30. DE RecName: Full=F-box domain-containing protein {ECO:0000259|PROSITE:PS50181}; GN ORFNames=CICLE_v10003407mg {ECO:0000313|EMBL:ESR45048.1}; OS Citrus clementina (Clementine) (Citrus deliciosa x Citrus sinensis). OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; OC Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; OC rosids; malvids; Sapindales; Rutaceae; Aurantioideae; Citrus. OX NCBI_TaxID=85681 {ECO:0000313|EMBL:ESR45048.1, ECO:0000313|Proteomes:UP000030687}; RN [1] {ECO:0000313|EMBL:ESR45048.1, ECO:0000313|Proteomes:UP000030687} RP NUCLEOTIDE SEQUENCE. RC STRAIN=cv. Clemenules {ECO:0000313|Proteomes:UP000030687}; RG International Citrus Genome Consortium; RA Jenkins J., Schmutz J., Prochnik S., Rokhsar D., Gmitter F., Ollitrault P., RA Machado M., Talon M., Wincker P., Jaillon O., Morgante M.; RL Submitted (OCT-2013) to the EMBL/GenBank/DDBJ databases. CC --------------------------------------------------------------------------- CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms CC Distributed under the Creative Commons Attribution (CC BY 4.0) License CC --------------------------------------------------------------------------- DR EMBL; KI536799; ESR45048.1; -; Genomic_DNA. DR AlphaFoldDB; V4SBU7; -. DR STRING; 85681.V4SBU7; -. DR Gramene; ESR45048; ESR45048; CICLE_v10003407mg. DR KEGG; cic:CICLE_v10003407mg; -. DR eggNOG; ENOG502QTAJ; Eukaryota. DR InParanoid; V4SBU7; -. DR Proteomes; UP000030687; Unassembled WGS sequence. DR CDD; cd22162; F-box_AtSKIP3-like; 1. DR Gene3D; 1.20.1280.50; -; 1. DR InterPro; IPR036047; F-box-like_dom_sf. DR InterPro; IPR001810; F-box_dom. DR InterPro; IPR025886; PP2-like. DR PANTHER; PTHR32278; F-BOX DOMAIN-CONTAINING PROTEIN; 1. DR PANTHER; PTHR32278:SF144; F-BOX PROTEIN PP2-B12 ISOFORM X1; 1. DR Pfam; PF12937; F-box-like; 1. DR Pfam; PF14299; PP2; 1. DR SMART; SM00256; FBOX; 1. DR SUPFAM; SSF81383; F-box domain; 1. DR PROSITE; PS50181; FBOX; 1. PE 4: Predicted; KW Reference proteome {ECO:0000313|Proteomes:UP000030687}. FT DOMAIN 39..85 FT /note="F-box" FT /evidence="ECO:0000259|PROSITE:PS50181" SQ SEQUENCE 295 AA; 33501 MW; 096050317F321F79 CRC64; Alignment Scores: Length: 295 Score: 1514.00 Matches: 288 Percent Similarity: 99.7% Conservative: 3 Best Local Similarity: 98.6% Mismatches: 1 Query Match: 60.3% Indels: 0 Gaps: 0 US-19-220-933-31 (1-1434) x V4SBU7_CITCL (1-295) Qy 556 ATGAGCTCTTACGGCCAGAAAACTAAGCCAGGACGGCAAAGGCTTAAGCGAAAAGAATAC 615 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 MetSerSerTyrGlyGlnLysThrLysProGlyArgGlnArgLeuLysArgLysGluTyr 20 Qy 616 ATTTGGCCAGGTTCTGAGGTGATTGGTGAGAGTGGTTCGATTCTTACTTATCAAAAGAAA 675 ||| |||||||||||||||||||||:::|||||||||||||||||||||||||||||| Db 21 IleLeuProGlySerGluValIleGlyLysSerGlySerIleLeuThrTyrGlnLysLys 40 Qy 676 AAACTCGAAGATCTACCTGCAAAGTGCATTTCGCGCATCATTTCTCTTACGACACCTCGC 735 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 41 LysLeuGluAspLeuProAlaLysCysIleSerArgIleIleSerLeuThrThrProArg 60 Qy 736 GATGCAAGTAGGTTGGCACTGGTATGTCCCGCCTTCAGATCGGCTGCGGATTCAGATTCC 795 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AspAlaSerArgLeuAlaLeuValCysProAlaPheArgSerAlaAlaAspSerAspSer 80 Qy 796 GTATGGGAGAAGTTTTTGCCGTCCGATTACGAAGGGTTCATTTCGAACTCATCTTTGATC 855 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 81 ValTrpGluLysPheLeuProSerAspTyrGluGlyPheIleSerAsnSerSerLeuIle 100 Qy 856 GACAGGAAGAAGAAGGATCTTTATTTTCATCTATGTCGCAACCCCATCCTCTTCGACAAT 915 |||:::|||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 101 AspLysLysLysLysAspLeuTyrPheHisLeuCysArgAsnProIleLeuPheAspAsn 120 Qy 916 AATACCGCGAGCTTTGGGCTAGAGCAAGAGAGTGGTAAAAAATGTTACATGGCTGGTGCA 975 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AsnThrAlaSerPheGlyLeuGluGlnGluSerGlyLysLysCysTyrMetAlaGlyAla 140 Qy 976 AAATGGATTTATGAAAATTCGGGAATTTCACACCGAGATTGCGAAATGATTCCTTCATCA 1035 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 141 LysTrpIleTyrGluAsnSerGlyIleSerHisArgAspCysGluMetIleProSerSer 160 Qy 1036 GCTGGATCTAGGTTTCCTGAAGTGATTGAACTTAAGCTTATGTCGAGTTTAGAAATCGAA 1095 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 161 AlaGlySerArgPheProGluValIleGluLeuLysLeuMetSerSerLeuGluIleGlu 180 Qy 1096 GCAAGATTTGGTACAACAATTTTTTCACCCAAAACCAATTATGCAGCTTACTTTGTGTTC 1155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AlaArgPheGlyThrThrIlePheSerProLysThrAsnTyrAlaAlaTyrPheValPhe 200 Qy 1156 AAGTTTGCGGAATTCAGAGAAGGGCCTGAAACTAGTCCTATAGATTTTGAAGTCTATTTT 1215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 201 LysPheAlaGluPheArgGluGlyProGluThrSerProIleAspPheGluValTyrPhe 220 Qy 1216 GAGGGAAGCCATAATGGCAAAAAGCGTAGAGAGTTTCTTGATCCTCAACTATCTCAAGAC 1275 :::||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 221 AspGlySerHisAsnGlyLysLysArgArgGluPheLeuAspProGlnLeuSerGlnAsp 240 Qy 1276 CGAGGAAATAGGTGGATAGAGATTAAGATGGGTGAGTTCTCTATTGAAAATGGAGATGAA 1335 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ArgGlyAsnArgTrpIleGluIleLysMetGlyGluPheSerIleGluAsnGlyAspGlu 260 Qy 1336 GGAACAGTAGTTTGTAGGCTGTCCGAACCAGAACCCTTATCTAAGCGTGGCACTATTATT 1395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 261 GlyThrValValCysArgLeuSerGluProGluProLeuSerLysArgGlyThrIleIle 280 Qy 1396 TTCCAAGGTATTGAGGTTAGGCCTGAATATGGCAGG 1431 |||||||||||||||||||||||||||||||||||| Db 281 PheGlnGlyIleGluValArgProGluTyrGlyArg 292 Conclusion No claim is allowed. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

May 28, 2025
Application Filed
Aug 21, 2026
Non-Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12733641
CELL DEATH INHIBITOR AND CELL DEATH INHIBITION METHOD
4y 8m to grant Granted Sep 15, 2026
Patent 12723251
MATERIALS AND METHODS FOR PUFA PRODUCTION, AND PUFA-CONTAINING COMPOSITIONS
3y 7m to grant Granted Sep 01, 2026
Patent 12716071
METHODS FOR PLANT TRANSFORMATION
5y 11m to grant Granted Aug 25, 2026
Patent 12709756
PLANT CELLS, PLANTS, AND SEEDS HAVING TARGETED ENHANCER ELEMENT INSERTIONS
3y 6m to grant Granted Aug 18, 2026
Patent 12708092
PEPPER HYBRID SVPB8161 AND PARENTS THEREOF
2y 5m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.4%)
2y 10m (~1y 6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 543 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month