Prosecution Insights
Last updated: April 19, 2026
Application No. 17/924,811

DUAL PROMOTER SYSTEMS

Non-Final OA §103
Filed
Nov 11, 2022
Examiner
O'NEILL, MARISOL ANN
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children'S Hospital (Dba Seattle Children'S Research Institute)
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allow Rate
8 granted / 17 resolved
-12.9% vs TC avg
Strong +75% interview lift
Without
With
+75.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
31 currently pending
Career history
48
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
42.0%
+2.0% vs TC avg
§102
23.8%
-16.2% vs TC avg
§112
24.8%
-15.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 17 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made that the instant application is a National Stage of International application No. PCT/US2021/031986 (filed 05/12/2021), which claims the benefits of US Provisional Application No. 63/024946 (filed 05/14/2020). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 98-107, 109-114, and 116-117 are rejected under 35 U.S.C. 103 as being unpatentable over Wei et al (WO201821332A1) in view of Saitoh et al (EMBO, 2000) and Spits et al (WO2003052083A2). Wei et al discloses a cell comprising a vector, wherein the vector comprises an inducible synthetic promoter, a gene encoding a molecule, and a sequence encoding a chimeric antigen receptor (CAR) (See ¶007). The inducible synthetic promoter comprises one or more of SEQ ID NOs: 1-33 and is inducible by chimeric antigen receptor activation (See ¶007 and claims 1-3). In some embodiments, the promoter comprises an endogenous IL2 minimal promoter sequence (See ¶007). The cell comprising the vector is a CD8+ or CD4+ cell, in some embodiments (See ¶007). The molecule encoded by the vector can be CASTAT5 (See ¶007). The molecule is expressed under control of the inducible synthetic promoter (See ¶009). In an exemplary embodiment, the nucleic acid for expression of the CAR comprises an EF1a promoter, a CD19 scFV, an EGFRt marker protein, and a DFIFRdm drug inducible promoter (See Fig. 12). Interaction of the CAR comprising the CD19 scFV with CD19+ cells leads to activation of the inducible synthetic promoter (See ¶0025 and Fig. 16). Wei et al additionally discloses a method of treating a disease such as leukemia by administering the cell comprising the vector to a subject (See claim 36). The treatment method can further comprise administering PMA or Ionomycin to the subject (See claim 41). Regarding claims 98, 99, 102-103, and 105: Wei et al disclose a vector comprising a nucleotide sequence encoding an inducible synthetic promoter (reads on first promoter) which can drive expression of CASTAT5 (reads on constitutively active STAT5). The inducible synthetic promoter can comprise a nucleotide sequence of SEQ ID NO: 7 which comprises a sequence 100% identical to SEQ ID NO: 1 of the instant application (See sequence alignment at end of office action). The vector of Wei et al further comprises a nucleotide sequence encoding a CAR (reads on a receptor). In an exemplary embodiment, Wei et al discloses a nucleic acid sequence for expression of CAR, driven by an EF1a promoter (reads on a second promoter operably linked to a polynucleotide encoding a receptor). Wei et al do not disclose the following limitations 1) Wei et al do not explicitly disclose an embodiment in which the vector comprises a second promoter, 2) Wei et al do not disclose a first insulator is located between the first polynucleotide and the second polynucleotide, 3) Wei et al do not disclose a first promoter operably linked to a polynucleotide encoding a fusion protein comprising a constitutively activated STAT5a and an estrogen receptor. Regarding the first, although Wei et al do not explicitly disclose an embodiment in which the vector comprises an EF1a promoter driving expression of the CAR, it would have been prima facie obvious to substitute the nucleic acid sequence encoding the CAR in the vector of Wei et al with the nucleic acid sequence, encoding a CAR, driven by an EF1a promoter. One would have expected the two nucleic acid sequences to work equivocally in the vector of Wei et al, because both nucleic acid sequences encode a CAR. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable is considered to be obvious. See KSR International Co. V Teleflex Inc 82 USPQ2d 1385 (US2007) at page 1395. Regarding the second, Saitoh et al teach a 3’ HS-A chicken ß-globin sequence which functions as an insulator (See abstract and Fig. 4). The 3’HS-A ß-globin sequence of Saitoh et al has a sequence that is 100% identical to SEQ ID NO: 6 of the instant application (See Fig. 4 and sequence alignment below). Insulators block activation a gene by an enhancer when placed between a promoter and an enhancer (See pg. 2315, Sec. Introduction, first two paragraphs) . Saitoh further teach including two of the 3’ HS-A chicken ß-globin locus improves enhancer blocking activity compared to one copy (See Fig. 6). Given that Wei et al disclose a vector which expresses a CAR, which can be driven by an EF1a promoter and a CASTAT5 driven by an inducible synthetic promoter and Saitoh et al discloses a 3’ HS-A ß-globin insulator locus, it would have been prima facie obvious to modify the vector of Wei et al by inserting two copies of the 3’ HS-A ß-globin of Saitoh et al, which acts as an insulator, 5’ of the EF1a promoter, 5’ of the inducible synthetic promoter, or 5’ of both promoters thereby producing a vector which comprises two copies of an insulator between the first polynucleotide and the second polynucleotide. One would have been motivated to include two copies of the ß-globin insulator in the vector of Wei et al because Saitoh et al teach including two copies of the insulator sequence can reduce transcription of the gene driven by the promoter. There is a reasonable expectation of success because Saitoh et al teach the sequence can function as an insulator and including insulators in vectors is a known technique in the art. Regarding the third, Spits et al disclose a nucleic acid construct comprising a nucleic acid sequence encoding a constitutively active STAT5-ER fusion protein (See claims 27 and 29). The STAT5 of the fusion protein can be STAT5a or STAT5b (See claim 28). Spits et al teaches the estrogen receptor in the STAT5-ER fusion protein acts as an inactivating agent to STAT5. The fusion protein is inactive because it forms a complex with heat shock proteins in the cytosol preventing the STAT5 protein from reaching the nucleus. Addition of 4 hydroxy-tamoxifen allows the fusion protein to dissociate from the heat shock proteins and enter the nucleus in its active form to drive transcription (See pg. 14, ln15 - pg. 15, ln 2). Given that Wei et al disclose a vector which expresses a constitutively active STAT5 and Spits et al teaches fusing ER to a constitutively active STAT5 allows one to regulate STAT5 mediated transcription, it would have been prima facie obvious, before the effective filing date, to modify the vector Wei et al to comprise the CA-STAT5a-ER fusion protein of Spits et al as the molecule in the vector. One would have been motivated to modify the vector of Wei et al to comprise the CA-STAT5a-ER fusion protein because Spits et al teaches fusing ER to STAT5 allows one to regulate STAT5 mediated transcription. There is a reasonable expectation of success because cloning constructs into vectors is a known technique in the field. Regarding claim 100: Following the discussion of claim 98 above, Wei et al disclose in some embodiments, the inducible promoter further comprises an endogenous IL2 minimal promoter sequence which reads on the first promoter further comprises an IL-2 minimal promoter. Regarding claim 101: Following the discussion of claim 1 above, Wei et al disclose an exemplary embodiment in which the nucleotide encoding the CAR is driven by an EF1a promoter (reads on an EF1α promoter). Regarding claim 104: Following the discussion of claim 98 above, Wei et al disclose an exemplary CAR (reads on receptor) which is activated by binding CD19+ cells. Thus, CD19 reads on a ligand which binds to the CAR leading to activation of the CAR. Regarding claims 106 and 107: Following the discussion of claim 98 above, Wei et al disclose an exemplary nucleotide sequence encoding a CAR which further comprises an EGFRt marker protein which reads on a selectable marker that is a cell-surface selectable marker. Regarding claim 109: Following the discussion of claim 1 above, Wei et al discloses a vector which can comprise an inducible synthetic promoter driving expression of CA-STAT5 and an EF1a promoter driving expression of a CAR. It would have been prima facie obvious to include two copies of a 3’ HS-A ß-globin insulator 5’ of both promoters (See rejection of claim 98 above). Addition of two 3’ HS-A insulators 5’ of both promoters would result in a vector which comprises from 5’ to 3’: two 3’ HS-A insulators, an inducible synthetic promoter, CA-STAT5, two 3’ HS-A insulators, an EF1a promoter, and sequence encoding a CAR which reads on having a second insulator located 5’ to the first polynucleotide and a third insulator located 3’ to the first polynucleotide. Regarding claims 110-112: Following the discussion of claim 98 above, Wei et al disclose a cell, which can be CD8+ or CD4+ (reads on an immune cell, a CD8+ T cell, and a CD4+ T cell), comprising the disclosed vector. Regarding claim 113: Wei et al in view of Saitoh et al and Spits et al render obvious the cell of claim 110 (See rejection of claim 110 above). Wei et al further discloses a method of treating a disease comprising administering cells comprising a vector comprising the inducible synthetic promoter and a CAR to a subject. Given that Wei et al teaches a method of treating a disease comprising administering a cell comprising an inducible synthetic promoter and a CAR to a subject and Wei et al in view of Saitoh et al and Spits et al teach a cell comprising an inducible synthetic promoter and a CAR, it would have been prima facie obvious to substitute the cell in the method of Wei et al for the modified immune cell taught by Wei et al in view of Saitoh et al and Spits et al. One would have expected the cells to work equivocally because both cells comprise an inducible synthetic promoter and a CAR. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable is considered to be obvious. See KSR International Co. V Teleflex Inc 82 USPQ2d 1385 (US2007) at page 1395. Regarding claims 114 and 116: Following the discussion of claim 13 above, the disease treating method of Wei et al further comprises administering PMA or Ionomycin which reads on administering an activator. Regarding claims 114 and 117: Following the discussion of claim 13 above, Wei et al teach a vector expressing CA-STAT5, Spits et al teach a CA-STAT5a-ER fusion protein in which STAT5a mediated transcription can be activated by addition of 4 hydroxy-tamoxifen (reads on a metabolite of tamoxifen). It would have been prima facie obvious to modify the vector of Wei et al to include a sequence expressing the CA-STAT5a-ER fusion protein of Spits et al and insert the modified vector into an immune cell (See rejection of claims 98 and 110 above). Given that Wei et al in view of Saitoh et al and Spits et al teach an immune cell comprising a CA-STAT5a-ER fusion protein which is inactive in the absence of 4 hydroxy-tamoxifen, it would have been prima facie obvious to administer 4-hydroxytamoxifen to a subject in the disease treating method of Wei et al in order to activate STAT5a mediated transcription. Claims 98-114, and 116-117 are rejected under 35 U.S.C. 103 as being unpatentable over Wei et al (WO201821332A1) in view of Saitoh et al (EMBO, 2000), Spits et al (WO2003052083A2), and Makrides (Gene Transfer and Expression in Mammalian Cells, 2003). The teachings of Wei et al, Saitoh et al and Spits at al are set forth above. Wei et al, Saitoh et al, and Spits et al render claims 98-107, 109-114, and 116-117 obvious. Regarding claim 108: Following the discussion of claim 98 above, Wei et al disclose a vector comprising nucleotide sequences which encode CA-STAT5 and a CAR. Wei et al do not disclose a nucleic acid that encodes a ribosome skip sequence or an IRES. Makrides two or more gene may be connected via an IRES element which facilitates ribosome binding to the second and subsequent transcription units thereby coordinating expression of two or more genes expressed by a vector (See pgs. 23-24, Sec. 8.(d)). Given that Wei et al disclose a vector which expresses two genes and Makrides teaches including an IRES facilitates ribosome binding to second transcription unit and coordinates expression of two or more genes in a vector, it would have been prima facie obvious to modify the vector of Wei et al by inserting an IRES. One would have been motivated to add an IRES to the vector of Wei et al because Makrides teaches including an IRES in a vector can facilitate ribosome binding to the second transcriptional unit. There is a reasonable expectation of success because Makrides teaches including an IRES element in a vector is a standard method for coordinating expression of multiple genes. Claims 98-107, 109-117 are rejected under 35 U.S.C. 103 as being unpatentable over Wei et al (WO201821332A1) in view of Saitoh et al (EMBO, 2000), Spits et al (WO2003052083A2), and Lindauer et al (Recent Results Cancer Res. 2018) The teachings of Wei et al, Saitoh et al and Spits at al are set forth above. Wei et al, Saitoh et al, and Spits et al render claims 98-107, 109-114, and 116-117 obvious. Regarding claims 115: Following the discussion of claims 113 and 114 above, Wei et al disclose a method of treating a disease such as leukemia by administering a cell comprising an inducible synthetic promoter and a CAR. Wei et al do not disclose administering dasatinib to the subject. Lindauer et al teach dasatinib is an oral short acting inhibitor of multiple tyrosine kinases that is used as a treatment for leukemia (See abstract). Given that the method of Wei et al can be used to treat a subject with leukemia, it would have been obvious to modify the method of Wei et al to include administering dasatinib to the subject in order to create a more robust treatment method for leukemia. One would have been motivated to include dasatinib in the leukemia treatment method of Wei et al because Lindauer et al teach dasatinib is a medication for treating leukemia. There is a reasonable expectation of success because Lindauer et al teach dasatinib can be used to treat leukemia. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARISOL A O'NEILL whose telephone number is (571)272-2490. The examiner can normally be reached Monday - Friday 7:30 - 5:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARISOL ANN O'NEILL/Examiner, Art Unit 1633 /CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633 Sequence Alignments Qy: SEQ ID NO:1 vs. DB: SEQ ID NO: 7 (WO2018213332A1) Query Match 100.0%; Score 333; Length 390; Best Local Similarity 100.0%; Matches 333; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGGGGGCGGGGTCGAGGAGGAAAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 36 TCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGGGGGCGGGGTCGAGGAGGAAAAA 95 Qy 61 CTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 96 CTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCG 155 Qy 121 TGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCCTACGCGCTGAACGCCAGCCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 156 TGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCCTACGCGCTGAACGCCAGCCC 215 Qy 181 CGATCGACCCCGCCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 216 CGATCGACCCCGCCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACAT 275 Qy 241 CATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 276 CATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTT 335 Qy 301 CCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGA 333 ||||||||||||||||||||||||||||||||| Db 336 CCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGA 368 Qy: SEQ ID NO:6 vs. DB: 3’ HS-A ß-globin sequence of Saitoh et al Query Match 100.0%; Score 29; DB 1; Length 29; Best Local Similarity 100.0%; Matches 29; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGAGATCTTTCACAAAACACCAGTTATGC 29 ||||||||||||||||||||||||||||| Db 1 TGAGATCTTTCACAAAACACCAGTTATGC 29
Read full office action

Prosecution Timeline

Nov 11, 2022
Application Filed
Oct 23, 2025
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600987
COMPOSITIONS AND METHODS FOR CIRCULAR RNA EXPRESSION
2y 5m to grant Granted Apr 14, 2026
Patent 12582678
METHOD FOR TREATING PLEURAL EFFUSION
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+75.0%)
3y 7m
Median Time to Grant
Low
PTA Risk
Based on 17 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month