DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 3, 4, and 7-28 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on Oct. 20, 2025. Claims 1-28 are pending, Group II - claims 1, 2, 5, and 6 are elected as well as the species of SEQ ID NO: 1.
Claim Objections
Claims 1 and 6 are objected to because of the following informalities:
For claim 1: in the third line “antisense nucleotide” is recited, and this is technically incorrect because in order for a nucleic acid to be “antisense” it requires more than one nucleotide. This is also recited two more time later in the claim. Applicant is advised to replace “nucleotide” with - - polynucleotide - - .
For claims 6: SEQ ID NO: 1 is recited five times, however, the 2nd through 5th time it is being referenced for a fragment of SEQ ID NO: 1 only. In this instances Applicant should distinguish the nucleotide positions of the fragment; i.e. for the second recitation insert - - nucleotides 1-14 of - - before “SEQ ID NO: 1” in parentheses. Appropriate correction is requested.
Claim Rejections - 35 USC § 112 – Inadequate Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 2, 5, and 6 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim.
The claims are broadly drawn to a method of modulating a stress response in a eukaryotic organism against an environmental stress, said method comprising:
introducing an RNA fragment (RF) or an antisense nucleotide to said eukaryotic organism, wherein the RF comprises:
a sequence recognition site, wherein the sequence recognition site comprises a reverse complement sequence of a nucleotide sequence of the organism, and a stem loop structure, wherein the stem loop structure comprises: a paired region comprising paired RNA nucleotides, and an unpaired region comprising unpaired RNA nucleotides in the form of a loop, and
wherein the antisense nucleotide comprises a nucleotide sequence that is complementary to the reverse complement sequence of the RF; and
wherein the RF or the antisense nucleotide modulates the stress response against the environmental stress; including wherein the RF is SEQ ID NO: 1, 2, 3, or 4 or a sequence with at least 75% identity to any one of SEQ ID NOs: 1-4.
Applicants describe fragments of tRNAs for the amino acids alanine, aspartate, glutamate, and glycine that induce expression of the Pathogenesis-related 1 (PR1) defense gene in Arabidopsis (Spec 21-26; Figure 9B). PR1 is known to be involved in plants’ responses to certain pathogens.
Applicant describe the sequences of the four tRNAs as SEQ ID NOs: 1-4 (Figure 9A). Applicants do not describe any RFs with at least 75% identity to any one of SEQ ID NOs: 1-4 other than the 100% identity RFs described in Figure 9A and in the sequence listing.
Applicants do not describe any RNA fragments or antisense nucleotides other than fragments of tRNAs for the mentioned amino acids.
Applicants do not describe the effect of the tRNAs on any eukaryotic organism other than Arabidopsis.
Applicants do not describe modulation of any stress response other than the increase in expression of the Arabidopsis PR1 gene.
Applicants describe the effector-triggered immunity to Pseudomonas syringae pv. tomato (Pst) in Arabidopsis increasing nuclear-localized tRNAs (Spec 4).
PR1 gene is known in the art to be involved in responses to a variety of pathogens, however, there are no reports in the art of PR1 being involved in other environmental stresses, such as: heat, cold, drought, high salinity, high wind (for plants); disease, malnutrition, thirst, hypoxia, emotional stress (humans). Applicant has not described an RF being effective for modulating any stress response other than the PR1 expression which is involved in the plant pathogen response.
Given the extremely large breadth encompassed by the claims and the vast difference between what is claimed and what was reduced to practice in the instant application, the specification and drawings do not provide an adequate written description across the full breadth of the claims.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Anticipation by Carrington
Claim(s) 1 and 2 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Carrington et al (US Patent No. 8,816,061 B2; issued on Aug. 26, 2014).
Carrington claims a method for silencing or attenuating expression of a target gene by introducing or expressing into a plant (a eukaryotic organism) an engineered single-stranded RNA transcript wherein the transcript has an initiator sequence that has the same sequence as a micro RNA or siRNA present in a plant (claims 15 and 19). Carrington claims this method wherein the target gene is a plant endogene, transgene, or a gene from a plant infecting pathogen; including wherein the pathogen is a virus, fungi, bacteria, insect, or nematode (claims 17 and 18). Carrington claims wherein this method results in disease resistance, herbicide resistance, resistance against biotic or abiotic stress, or improved nutritional value (claims 24 and 25, emphasis added). With regard to the limitation of forming a stem loop structure, miRNAs inherently form stem loop structures (Carrington Figure 8B).
Anticipation by McCallus
Claim(s) 1 and 2 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by McCallus et al (US Patent No. 9,198,927 B2; issued on Dec. 1, 2015).
McCallus claims a method of inhibiting the replication of Hepatitis C Virus (HCV) in a vertebrate cell (eukaryotic organism) by administering to the cell four different dsRNA effector molecules which comprise both a designation sequence and the complement thereof (claim 12), including wherein the effector molecules are short hairpin RNA effector molecules (claim 21). Inhibiting the replication of HCV is a for of modulating a stress response.
Anticipation by Jiang
Claim(s) 1-4 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Jiang et al (US Pre-Grant Publication US 2021/0052631 A1; published on Feb. 25, 2021).
Jiang claims a method of preventing or treating a subject suffering from heart disease (which is a form of modulating a stress response) by administering a transfer RNA molecule or a fragment derived from the transfer molecule wherein the transfer RNA molecule is isolated or derived from a plant of a genus Panax (claim 1). Jiang claims a pharmaceutical composition for preventing or treating heart disease (which are forms of modulating stress response), wherein the composition comprises an effective amount of a transfer RNA molecule isolated or derived from a plant of a genus Panax (claim 9). Jiang claims this transfer RNA molecule is a nucleic acid sequence selected from any one of SEQ ID NOs: 465 to 522 (claim 11). Jiang claims wherein the fragment derived from the transfer RNA molecule is a double-stranded molecule comprises a sense sequence and a complementary antisense sequence (claim 12).
When the Examiner performed a sequence search using the instant SEQ ID NO: 1, the following result was returned:
RESULT 4
US-16-999-051A-481
Sequence 481, US/16999051A
Publication No. US20210052630A1
GENERAL INFORMATION
APPLICANT: Macau University of Science and Technology
TITLE OF INVENTION: Methods and compositions for preventing or treating heart disease
FILE REFERENCE: DIC19110055
CURRENT APPLICATION NUMBER: US/16/999,051A
CURRENT FILING DATE: 2020-08-20
PRIOR APPLICATION NUMBER: CN 201910784150.9
PRIOR FILING DATE: 2019-08-23
NUMBER OF SEQ ID NOS: 522
SEQ ID NO 481
LENGTH: 75
TYPE: DNA
ORGANISM: Panax ginseng
Query Match 100.0%; Score 31; Length 75;
Best Local Similarity 64.5%;
Matches 20; Conservative 11; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTCGTTGTAGTATAGTGGTAAGTATTCCCGC 31
|:||::|:||:|:||:||:|||:|::|||||
Db 1 GUCGUUGUAGUAUAGUGGUAAGUAUUCCCGC 31
The only nucleotides that appear as mismatches are the ones designated in instant SEQ ID NO: 1 as thymine (T), but designated in the prior art SEQ ID NO: 481 as uracil (U). These are not really mismatches, rather one is the DNA designation and the other is the RNA designation. This is actually a 100% match. SEQ ID NO: 481 is one of the sequences claimed by Jiang in claim 11.
Summary
No claim is allowed.
Examiner’s Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHY KINGDON whose telephone number is (571)272-8784. The examiner can normally be reached M-F 9:00 - 5:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
CATHY KINGDON
Primary Examiner
Art Unit 1663
/CATHY KINGDON/Primary Examiner, Art Unit 1663